This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pGL3 BRE Luciferase
catalog :
45126
citations: 24
Reference
Chomette L, Hupkens E, Romitti M, Dewachter L, Vachi xe9 ry J, Bailly S, et al. Pediatric pulmonary arterial hypertension due to a novel homozygous GDF2 missense variant affecting BMP9 processing and activity. Am J Med Genet A. 2023;191:2064-2073 pubmed publisher
Manissorn J, Tonsomboon K, Wangkanont K, Thongnuek P. Effects of Chemical Additives in Refolding Buffer on Recombinant Human BMP-2 Dimerization and the Bioactivity on SaOS-2 Osteoblasts. ACS Omega. 2023;8:2065-2076 pubmed publisher
Chen H, Lin P, Yuan X, Chen R. Two novel AMHR2 gene variants in monozygotic twins with persistent Müllerian duct syndrome: A case report and functional study. Mol Genet Genomic Med. 2022;:e1999 pubmed publisher
Forouhan M, Lim W, Zanetti Domingues L, Tynan C, Roberts T, Malik B, et al. AR cooperates with SMAD4 to maintain skeletal muscle homeostasis. Acta Neuropathol. 2022;143:713-731 pubmed publisher
Horie T, Fukasawa K, Yamada T, Mizuno S, Iezaki T, Tokumura K, et al. Erk5 in Bone Marrow Mesenchymal Stem Cells Regulates Bone Homeostasis by Preventing Osteogenesis in Adulthood. Stem Cells. 2022;40:411-422 pubmed publisher
Ferrarini E, De Marco G, Orsolini F, Gianetti E, Benelli E, Fruzzetti F, et al. Characterization of a novel mutation V136L in bone morphogenetic protein 15 identified in a woman affected by POI. J Ovarian Res. 2021;14:85 pubmed publisher
Ichinose M, Suzuki N, Wang T, Kobayashi H, Vrbanac L, Ng J, et al. The BMP antagonist gremlin 1 contributes to the development of cortical excitatory neurons, motor balance and fear responses. Development. 2021;148: pubmed publisher
Guo L, Iida A, Bhavani G, Gowrishankar K, Wang Z, Xue J, et al. Deficiency of TMEM53 causes a previously unknown sclerosing bone disorder by dysregulation of BMP-SMAD signaling. Nat Commun. 2021;12:2046 pubmed publisher
Saraswat D, Shayya H, Polanco J, Tripathi A, Welliver R, Pol S, et al. Overcoming the inhibitory microenvironment surrounding oligodendrocyte progenitor cells following experimental demyelination. Nat Commun. 2021;12:1923 pubmed publisher
Frey P, Devisme A, Schrempp M, Andrieux G, Boerries M, Hecht A. Canonical BMP Signaling Executes Epithelial-Mesenchymal Transition Downstream of SNAIL1. Cancers (Basel). 2020;12: pubmed publisher
Li Q, Sun Y, Jarugumilli G, Liu S, Dang K, Cotton J, et al. Lats1/2 Sustain Intestinal Stem Cells and Wnt Activation through TEAD-Dependent and Independent Transcription. Cell Stem Cell. 2020;26:675-692.e8 pubmed publisher
Al Dalahmah O, Campos Soares L, Nicholson J, Draijer S, Mundim M, Lu V, et al. Galectin-3 modulates postnatal subventricular zone gliogenesis. Glia. 2020;68:435-450 pubmed publisher
Davidson R, Green J, Gardner S, Bao Y, Cassidy A, Clark I. Identifying chondroprotective diet-derived bioactives and investigating their synergism. Sci Rep. 2018;8:17173 pubmed publisher
Choi H, Kim T, Jeong J, Strandgren C, Eriksson M, Cho E. Expression of the Hutchinson-Gilford Progeria Mutation Leads to Aberrant Dentin Formation. Sci Rep. 2018;8:15368 pubmed publisher
Brand S, Roy S, Schroder P, Rathmer B, Roos J, Kapoor S, et al. Combined Proteomic and In Silico Target Identification Reveal a Role for 5-Lipoxygenase in Developmental Signaling Pathways. Cell Chem Biol. 2018;25:1095-1106.e23 pubmed publisher
Iezaki T, Fukasawa K, Horie T, Park G, Robinson S, Nakaya M, et al. The MAPK Erk5 is necessary for proper skeletogenesis involving a Smurf-Smad-Sox9 molecular axis. Development. 2018;145: pubmed publisher
Tolkachov A, Fischer C, Ambrosi T, Bothe M, Han C, Muenzner M, et al. Loss of the Hematopoietic Stem Cell Factor GATA2 in the Osteogenic Lineage Impairs Trabecularization and Mechanical Strength of Bone. Mol Cell Biol. 2018;38: pubmed publisher
Kuang W, Zheng L, Xu X, Lin Y, Lin J, Wu J, et al. Dysregulation of the miR-146a-Smad4 axis impairs osteogenesis of bone mesenchymal stem cells under inflammation. Bone Res. 2017;5:17037 pubmed publisher
Dufton N, Peghaire C, Osuna Almagro L, Raimondi C, Kalna V, Chuahan A, et al. Dynamic regulation of canonical TGFβ signalling by endothelial transcription factor ERG protects from liver fibrogenesis. Nat Commun. 2017;8:895 pubmed publisher
Zhou C, Xiong Q, Zhu X, Du W, Deng P, Li X, et al. AFF1 and AFF4 differentially regulate the osteogenic differentiation of human MSCs. Bone Res. 2017;5:17044 pubmed publisher
Figueiredo Neto M, Figueiredo M. Combination of Interleukin-27 and MicroRNA for Enhancing Expression of Anti-Inflammatory and Proosteogenic Genes. Arthritis. 2017;2017:6365857 pubmed publisher
Bellanger A, Donini C, Vendrell J, Lavaud J, Machuca Gayet I, Ruel M, et al. The critical role of the ZNF217 oncogene in promoting breast cancer metastasis to the bone. J Pathol. 2017;242:73-89 pubmed publisher
Chen C, Kao Y, Yang P, Sung P, Wen Z, Chen J, et al. A Small Dibromotyrosine Derivative Purified From Pseudoceratina Sp. Suppresses TGF-β Responsiveness by Inhibiting TGF-β Type I Receptor Serine/Threonine Kinase Activity. J Cell Biochem. 2016;117:2800-2814 pubmed publisher
Korchynskyi O, Ten Dijke P. Identification and functional characterization of distinct critically important bone morphogenetic protein-specific response elements in the Id1 promoter. J Biol Chem. 2002;277:4883-91 pubmed
product information
Catalog Number :
45126
Product Name :
pGL3 BRE Luciferase
article :
doi10.1074/jbc.M111023200
id6678
pubmed_id11729207
bacterial resistance :
Ampicillin
cloning :
backbonepGL3-Basic
backbone_mutation
backbone_originPromega
backbone_size4818
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Luciferase
Other
BMP/Smad Transcriptional Reporter
growth notes :
CGGCGCCAGCCTGACAGCCCGTCCTGGCGTCTAACGGTCTGAGCTAGC The presence of the hairpin can make sequencing this region difficult by traditional Sanger Sequencing. Protocols for difficult templates or GC rich may help.
GCTAGCTCAGACCGTTAGACGCCAGGACGGGCTGTCAGG
CTGGCGCCG
Synthetic oligonucleotides containing two CAGC sites, GGCGCC palindrome and MluI 5 -overhang (on the sense strand) and two SBE sites, one GGCG site and NheI 5 -overhang (on the antisense strand) were ligated and inserted into NheI sites in pGL3-MLP-luc minimal promoter vector. Thus the construct was created with a 5 site for NheI site followed by 2 SBEs, 1 GGCG site, 2 CAGC sites, 2 GGCGCC palindromes, 2 CAGC sites, 1 GGCG site, 2 SBEs, and an NheI 3 site. Based on the above description and the associated publication, the deduced sequence of the full hairpin is:
origin :
37
pi :
alt_names
BRE-Luc reporter
cloning
clone_methodRestriction Enzyme
cloning_site_3NheI
cloning_site_5NheI
promoter
sequencing_primer_3LucNRev
sequencing_primer_5RVprimer3
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameId1-BRE
shRNA_sequence
size
species
tags
resistance markers :
1113
1538
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA