This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCas9_GFP
catalog :
44719
citations: 125
Reference
Saiz Baggetto S, Dolz Edo L, M xe9 ndez E, Garc xed a Bolufer P, Mar xed M, Ba xf1 xf3 M, et al. A Multimodel Study of the Role of Novel PKC Isoforms in the DNA Integrity Checkpoint. Int J Mol Sci. 2023;24: pubmed publisher
Singh A, Khan S, Moore D, Andrews S, Christophorou M. Transcriptomic analysis of PADI4 target genes during multi-lineage differentiation of embryonic stem cells. Philos Trans R Soc Lond B Biol Sci. 2023;378:20220236 pubmed publisher
Littleton S, Trang K, Volpe C, Cook K, DeBruyne N, Ann Maguire J, et al. Variant-to-function analysis of the childhood obesity chr12q13 locus implicates rs7132908 as a causal variant within the 3' UTR of FAIM2. bioRxiv. 2023;: pubmed publisher
Sonti S, Littleton S, Pahl M, Zimmerman A, Chesi A, Palermo J, et al. Perturbation of the insomnia WDR90 GWAS locus pinpoints rs3752495 as a causal variant influencing distal expression of neighboring gene, PIG-Q. bioRxiv. 2023;: pubmed publisher
Repina N, Johnson H, Bao X, Zimmermann J, Joy D, Bi S, et al. Optogenetic control of Wnt signaling models cell-intrinsic embryogenic patterning using 2D human pluripotent stem cell culture. Development. 2023;150: pubmed publisher
Valtonen J, Prajapati C, Cherian R, Vanninen S, Ojala M, Leivo K, et al. The Junctophilin-2 Mutation p.(Thr161Lys) Is Associated with Hypertrophic Cardiomyopathy Using Patient-Specific iPS Cardiomyocytes and Demonstrates Prolonged Action Potential and Increased Arrhythmogenicity. Biomedicines. 2023;11: pubmed publisher
Huang B, Zeng Z, Li H, Li Z, Chen X, Guo J, et al. Modeling kidney development, disease, and plasticity with clonal expandable nephron progenitor cells and nephron organoids. bioRxiv. 2023;: pubmed publisher
Gil N, Perry R, Mukamel Z, Tuck A, B xfc hler M, Ulitsky I. Complex regulation of Eomes levels mediated through distinct functional features of the Meteor long non-coding RNA locus. Cell Rep. 2023;42:112569 pubmed publisher
Sui L, Du Q, Romer A, Su Q, Chabosseau P, Xin Y, et al. ZnT8 Loss of Function Mutation Increases Resistance of Human Embryonic Stem Cell-Derived Beta Cells to Apoptosis in Low Zinc Condition. Cells. 2023;12: pubmed publisher
Chakraborty S, Kopitchinski N, Zuo Z, Eraso A, Awasthi P, Chari R, et al. Enhancer-promoter interactions can bypass CTCF-mediated boundaries and contribute to phenotypic robustness. Nat Genet. 2023;55:280-290 pubmed publisher
Broadway B, Boneski P, Bredenberg J, Kolicheski A, Hou X, Soto Beasley A, et al. Systematic Functional Analysis of PINK1 and PRKN Coding Variants. Cells. 2022;11: pubmed publisher
Gonz xe1 lez B, Zhao H, Niu J, Williams D, Lee J, Goulbourne C, et al. Reduced calcium levels and accumulation of abnormal insulin granules in stem cell models of HNF1A deficiency. Commun Biol. 2022;5:779 pubmed publisher
Upadhya D, Attaluri S, Liu Y, Hattiangady B, Castro O, Shuai B, et al. Grafted hPSC-derived GABA-ergic interneurons regulate seizures and specific cognitive function in temporal lobe epilepsy. NPJ Regen Med. 2022;7:38 pubmed publisher
Lehmusvaara S, Haikarainen T, Saarikettu J, Martínez Nieto G, Silvennoinen O. Inhibition of RNA Binding in SND1 Increases the Levels of miR-1-3p and Sensitizes Cancer Cells to Navitoclax. Cancers (Basel). 2022;14: pubmed publisher
Jaura R, Yeh S, Montanera K, Ialongo A, Anwar Z, Lu Y, et al. Extended intergenic DNA contributes to neuron-specific expression of neighboring genes in the mammalian nervous system. Nat Commun. 2022;13:2733 pubmed publisher
Collier A, Bendall A, Fabian C, Malcolm A, Tilgner K, Semprich C, et al. Genome-wide screening identifies Polycomb repressive complex 1.3 as an essential regulator of human naïve pluripotent cell reprogramming. Sci Adv. 2022;8:eabk0013 pubmed publisher
Joshi J, Xu B, Rubart M, Chang Y, Bao X, Chaliki H, et al. Optogenetic Control of Engrafted Human Induced Pluripotent Stem Cell-Derived Cardiomyocytes in Live Mice: A Proof-of-Concept Study. Cells. 2022;11: pubmed publisher
Kaushal K, Kim E, Tyagi A, Karapurkar J, Haq S, Jung H, et al. Genome-wide screening for deubiquitinase subfamily identifies ubiquitin-specific protease 49 as a novel regulator of odontogenesis. Cell Death Differ. 2022;: pubmed publisher
Kaushal K, Tyagi A, Karapurkar J, Kim E, Tanguturi P, Kim K, et al. Genome-Wide CRISPR/Cas9-Based Screening for Deubiquitinase Subfamily Identifies Ubiquitin-Specific Protease 11 as a Novel Regulator of Osteogenic Differentiation. Int J Mol Sci. 2022;23: pubmed publisher
Boukrout N, Souidi M, Lahdaoui F, Duchene B, Neve B, Coppin L, et al. Antagonistic Roles of the Tumor Suppressor miR-210-3p and Oncomucin MUC4 Forming a Negative Feedback Loop in Pancreatic Adenocarcinoma. Cancers (Basel). 2021;13: pubmed publisher
Flores Bellver M, Mighty J, Aparicio Domingo S, Li K, Shi C, Zhou J, et al. Extracellular vesicles released by human retinal pigment epithelium mediate increased polarised secretion of drusen proteins in response to AMD stressors. J Extracell Vesicles. 2021;10:e12165 pubmed publisher
Philippi A, Heller S, Costa I, Senée V, Breunig M, Li Z, et al. Mutations and variants of ONECUT1 in diabetes. Nat Med. 2021;27:1928-1940 pubmed publisher
Kai Y, Li B, Zhu M, Li G, Chen F, Han Y, et al. Mapping the evolving landscape of super-enhancers during cell differentiation. Genome Biol. 2021;22:269 pubmed publisher
Ladha F, Thakar K, Pettinato A, Legere N, Ghahremani S, Cohn R, et al. Actinin BioID reveals sarcomere crosstalk with oxidative metabolism through interactions with IGF2BP2. Cell Rep. 2021;36:109512 pubmed publisher
Pereira J, DUBREUIL D, Devlin A, Held A, Sapir Y, Berezovski E, et al. Human sensorimotor organoids derived from healthy and amyotrophic lateral sclerosis stem cells form neuromuscular junctions. Nat Commun. 2021;12:4744 pubmed publisher
Solé A, Grossetete S, Heintzé M, Babin L, Zaidi S, Revy P, et al. Unraveling Ewing sarcoma tumorigenesis originating from patient-derived Mesenchymal Stem Cells. Cancer Res. 2021;: pubmed publisher
Zhou Z, Ma L, Zhang X. Protocol for genome-scale CRISPR screening in engineered lineage reporter hPSCs to study cell fate determination. STAR Protoc. 2021;2:100548 pubmed publisher
Rhie B, Antao A, Karapurkar J, Kim M, Jo W, Ramakrishna S, et al. Ubiquitin-Specific Protease 3 Deubiquitinates and Stabilizes Oct4 Protein in Human Embryonic Stem Cells. Int J Mol Sci. 2021;22: pubmed publisher
Breunig M, Merkle J, Wagner M, Melzer M, Barth T, Engleitner T, et al. Modeling plasticity and dysplasia of pancreatic ductal organoids derived from human pluripotent stem cells. Cell Stem Cell. 2021;28:1105-1124.e19 pubmed publisher
Feng Y, Xu H, Liu J, Xie N, Gao L, He Y, et al. Functional and Adaptive Significance of Promoter Mutations That Affect Divergent Myocardial Expressions of TRIM72 in Primates. Mol Biol Evol. 2021;38:2930-2945 pubmed publisher
Singh G, Mullany S, Moorthy S, Zhang R, Mehdi T, Tian R, et al. A flexible repertoire of transcription factor binding sites and a diversity threshold determines enhancer activity in embryonic stem cells. Genome Res. 2021;31:564-575 pubmed publisher
Wang L, Liu Y, Stratigopoulos G, Panigrahi S, Sui L, Zhang Y, et al. Bardet-Biedl syndrome proteins regulate intracellular signaling and neuronal function in patient-specific iPSC-derived neurons. J Clin Invest. 2021;131: pubmed publisher
Shah P, Lv W, Rhoades J, Poleshko A, Abbey D, Caporizzo M, et al. Pathogenic LMNA variants disrupt cardiac lamina-chromatin interactions and de-repress alternative fate genes. Cell Stem Cell. 2021;: pubmed publisher
Lopes C, Tang Y, Anjo S, Manadas B, Onofre I, de Almeida L, et al. Mitochondrial and Redox Modifications in Huntington Disease Induced Pluripotent Stem Cells Rescued by CRISPR/Cas9 CAGs Targeting. Front Cell Dev Biol. 2020;8:576592 pubmed publisher
Hezroni H, Ben Tov Perry R, Gil N, Degani N, Ulitsky I. Regulation of neuronal commitment in mouse embryonic stem cells by the Reno1/Bahcc1 locus. EMBO Rep. 2020;21:e51264 pubmed publisher
Xiong M, Tao Y, Gao Q, Feng B, Yan W, Zhou Y, et al. Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 2021;28:112-126.e6 pubmed publisher
Najm R, Zalocusky K, Zilberter M, Yoon S, Hao Y, Koutsodendris N, et al. In Vivo Chimeric Alzheimer's Disease Modeling of Apolipoprotein E4 Toxicity in Human Neurons. Cell Rep. 2020;32:107962 pubmed publisher
Sousa L, Pankonien I, Clarke L, Silva I, Kunzelmann K, Amaral M. KLF4 Acts as a wt-CFTR Suppressor through an AKT-Mediated Pathway. Cells. 2020;9: pubmed publisher
Wang X, Cai L, Xie J, Cui X, Zhang J, Wang J, et al. A caveolin binding motif in Na/K-ATPase is required for stem cell differentiation and organogenesis in mammals and C.elegans. Sci Adv. 2020;6:eaaw5851 pubmed publisher
Weisheit I, Kroeger J, Malik R, Klimmt J, Crusius D, Dannert A, et al. Detection of Deleterious On-Target Effects after HDR-Mediated CRISPR Editing. Cell Rep. 2020;31:107689 pubmed publisher
Das S, Chandrasekaran A, Suresh B, Haq S, Kang J, Lee S, et al. Genome-scale screening of deubiquitinase subfamily identifies USP3 as a stabilizer of Cdc25A regulating cell cycle in cancer. Cell Death Differ. 2020;: pubmed publisher
Toyohara T, Roudnicky F, Florido M, Nakano T, Yu H, Katsuki S, et al. Patient hiPSCs Identify Vascular Smooth Muscle Arylacetamide Deacetylase as Protective against Atherosclerosis. Cell Stem Cell. 2020;27:147-157.e7 pubmed publisher
Smith C, Castanon O, Said K, Volf V, Khoshakhlagh P, Hornick A, et al. Enabling large-scale genome editing at repetitive elements by reducing DNA nicking. Nucleic Acids Res. 2020;48:5183-5195 pubmed publisher
Chang Y, Hellwarth P, Randolph L, Sun Y, Xing Y, Zhu W, et al. Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells. Biotechnol Bioeng. 2020;117:2177-2186 pubmed publisher
Yagi H, Yagi Utsumi M, Honda R, Ohta Y, Saito T, Nishio M, et al. Improved secretion of glycoproteins using an N-glycan-restricted passport sequence tag recognized by cargo receptor. Nat Commun. 2020;11:1368 pubmed publisher
Wardhani B, Puteri M, Watanabe Y, Louisa M, Setiabudy R, Kato M. TGF-β-Induced TMEPAI Attenuates the Response of Triple-Negative Breast Cancer Cells to Doxorubicin and Paclitaxel. J Exp Pharmacol. 2020;12:17-26 pubmed publisher
Helms A, Tang V, O Leary T, Friedline S, Wauchope M, Arora A, et al. Effects of MYBPC3 loss-of-function mutations preceding hypertrophic cardiomyopathy. JCI Insight. 2020;5: pubmed publisher
Bode K, Bujupi F, Link C, Hein T, Zimmermann S, Peiris D, et al. Dectin-1 Binding to Annexins on Apoptotic Cells Induces Peripheral Immune Tolerance via NADPH Oxidase-2. Cell Rep. 2019;29:4435-4446.e9 pubmed publisher
Goldstein J, Valido A, Lewandowski J, Walker R, Mills M, Messemer K, et al. Variation in zygotic CRISPR/Cas9 gene editing outcomes generates novel reporter and deletion alleles at the Gdf11 locus. Sci Rep. 2019;9:18613 pubmed publisher
Rom A, Melamed L, Gil N, Goldrich M, Kadir R, Golan M, et al. Regulation of CHD2 expression by the Chaserr long noncoding RNA gene is essential for viability. Nat Commun. 2019;10:5092 pubmed publisher
Liu Z, Easson G, Zhao J, Makki N, Ahituv N, Hilton M, et al. Dysregulation of STAT3 signaling is associated with endplate-oriented herniations of the intervertebral disc in Adgrg6 mutant mice. PLoS Genet. 2019;15:e1008096 pubmed publisher
Xiong Z, Xie Y, Yang Y, Xue Y, Wang D, Lin S, et al. Efficient gene correction of an aberrant splice site in β-thalassaemia iPSCs by CRISPR/Cas9 and single-strand oligodeoxynucleotides. J Cell Mol Med. 2019;23:8046-8057 pubmed publisher
Yahia Cherbal H, Rybczynska M, Lovecchio D, Stephen T, Lescale C, Placek K, et al. NFAT primes the human RORC locus for RORγt expression in CD4+ T cells. Nat Commun. 2019;10:4698 pubmed publisher
Cardenas Diaz F, Maguire J, Gadue P, French D. Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells. J Vis Exp. 2019;: pubmed publisher
Koike H, Iwasawa K, Ouchi R, Maezawa M, Giesbrecht K, Saiki N, et al. Modelling human hepato-biliary-pancreatic organogenesis from the foregut-midgut boundary. Nature. 2019;574:112-116 pubmed publisher
Romer A, Singer R, Sui L, Egli D, Sussel L. Murine Perinatal β-Cell Proliferation and the Differentiation of Human Stem Cell-Derived Insulin-Expressing Cells Require NEUROD1. Diabetes. 2019;68:2259-2271 pubmed publisher
Freihen V, Rönsch K, Mastroianni J, Frey P, Rose K, Boerries M, et al. SNAIL1 employs β-Catenin-LEF1 complexes to control colorectal cancer cell invasion and proliferation. Int J Cancer. 2019;: pubmed publisher
Wang X, Ye F, Wen Z, Guo Z, Yu C, Huang W, et al. Structural interaction between DISC1 and ATF4 underlying transcriptional and synaptic dysregulation in an iPSC model of mental disorders. Mol Psychiatry. 2019;: pubmed publisher
Kwart D, Gregg A, Scheckel C, Murphy E, Paquet D, Duffield M, et al. A Large Panel of Isogenic APP and PSEN1 Mutant Human iPSC Neurons Reveals Shared Endosomal Abnormalities Mediated by APP β-CTFs, Not Aβ. Neuron. 2019;104:256-270.e5 pubmed publisher
Beyes S, Andrieux G, Schrempp M, Aicher D, Wenzel J, Antón García P, et al. Genome-wide mapping of DNA-binding sites identifies stemness-related genes as directly repressed targets of SNAIL1 in colorectal cancer cells. Oncogene. 2019;38:6647-6661 pubmed publisher
Matsuda Lennikov M, Biancalana M, Zou J, Ravell J, Zheng L, Kanellopoulou C, et al. Magnesium transporter 1 (MAGT1) deficiency causes selective defects in N-linked glycosylation and expression of immune-response genes. J Biol Chem. 2019;294:13638-13656 pubmed publisher
Low J, Li P, Chew E, Zhou B, Suzuki K, Zhang T, et al. Generation of Human PSC-Derived Kidney Organoids with Patterned Nephron Segments and a De Novo Vascular Network. Cell Stem Cell. 2019;25:373-387.e9 pubmed publisher
Liu C, Banister C, Buckhaults P. Spindle Assembly Checkpoint Inhibition Can Resensitize p53-Null Stem Cells to Cancer Chemotherapy. Cancer Res. 2019;79:2392-2403 pubmed publisher
Hu W, Jiang C, Guan D, Dierickx P, Zhang R, Moscati A, et al. Patient Adipose Stem Cell-Derived Adipocytes Reveal Genetic Variation that Predicts Antidiabetic Drug Response. Cell Stem Cell. 2019;24:299-308.e6 pubmed publisher
Maguire J, Cardenas Diaz F, Gadue P, French D. Highly Efficient CRISPR-Cas9-Mediated Genome Editing in Human Pluripotent Stem Cells. Curr Protoc Stem Cell Biol. 2019;48:e64 pubmed publisher
Rossidis A, Stratigis J, Chadwick A, Hartman H, Ahn N, Li H, et al. In utero CRISPR-mediated therapeutic editing of metabolic genes. Nat Med. 2018;24:1513-1518 pubmed publisher
Festuccia N, Halbritter F, Corsinotti A, Gagliardi A, Colby D, Tomlinson S, et al. Esrrb extinction triggers dismantling of naïve pluripotency and marks commitment to differentiation. EMBO J. 2018;37: pubmed publisher
Esparza Moltó P, Nuevo Tapioles C, Chamorro M, Najera L, Torresano L, Santacatterina F, et al. Tissue-specific expression and post-transcriptional regulation of the ATPase inhibitory factor 1 (IF1) in human and mouse tissues. FASEB J. 2018;:fj201800756R pubmed publisher
Koefoed K, Skat Rørdam J, Andersen P, Warzecha C, Pye M, Andersen T, et al. The E3 ubiquitin ligase SMURF1 regulates cell-fate specification and outflow tract septation during mammalian heart development. Sci Rep. 2018;8:9542 pubmed publisher
Jun S, Lim H, Jang H, Lee W, Ahn J, Lee J, et al. Straightforward Delivery of Linearized Double-Stranded DNA Encoding sgRNA and Donor DNA for the Generation of Single Nucleotide Variants Based on the CRISPR/Cas9 System. ACS Synth Biol. 2018;7:1651-1659 pubmed publisher
Olive J, Qin Y, Decristo M, Laszewski T, Greathouse F, McAllister S. Accounting for tumor heterogeneity when using CRISPR-Cas9 for cancer progression and drug sensitivity studies. PLoS ONE. 2018;13:e0198790 pubmed publisher
Stratigopoulos G, De Rosa M, LeDuc C, Leibel R, Doege C. DMSO increases efficiency of genome editing at two non-coding loci. PLoS ONE. 2018;13:e0198637 pubmed publisher
Liu C, Banister C, Weige C, Altomare D, Richardson J, Contreras C, et al. PRDM1 silences stem cell-related genes and inhibits proliferation of human colon tumor organoids. Proc Natl Acad Sci U S A. 2018;115:E5066-E5075 pubmed publisher
van der Wal E, Herrero Hernandez P, Wan R, Broeders M, In t Groen S, van Gestel T, et al. Large-Scale Expansion of Human iPSC-Derived Skeletal Muscle Cells for Disease Modeling and Cell-Based Therapeutic Strategies. Stem Cell Reports. 2018;10:1975-1990 pubmed publisher
Fan H, Huang H, Hu L, Zhu W, Yu Y, Lou J, et al. The activation of STIM1 mediates S-phase arrest and cell death in paraquat induced acute lung intoxication. Toxicol Lett. 2018;292:123-135 pubmed publisher
Xu J, Bartolome C, Low C, Yi X, Chien C, Wang P, et al. Genetic identification of leptin neural circuits in energy and glucose homeostases. Nature. 2018;556:505-509 pubmed publisher
Wu M, Liu S, Gao Y, Bai H, Machairaki V, Li G, et al. Conditional gene knockout and reconstitution in human iPSCs with an inducible Cas9 system. Stem Cell Res. 2018;29:6-14 pubmed publisher
Aneichyk T, Hendriks W, Yadav R, Shin D, Gao D, Vaine C, et al. Dissecting the Causal Mechanism of X-Linked Dystonia-Parkinsonism by Integrating Genome and Transcriptome Assembly. Cell. 2018;172:897-909.e21 pubmed publisher
Tamura I, Jozaki K, Sato S, Shirafuta Y, Shinagawa M, Maekawa R, et al. The distal upstream region of insulin-like growth factor-binding protein-1 enhances its expression in endometrial stromal cells during decidualization. J Biol Chem. 2018;293:5270-5280 pubmed publisher
Naumann J, Widen J, Jonart L, Ebadi M, Tang J, Gordon D, et al. SN-38 Conjugated Gold Nanoparticles Activated by Ewing Sarcoma Specific mRNAs Exhibit In Vitro and In Vivo Efficacy. Bioconjug Chem. 2018;29:1111-1118 pubmed publisher
Jägle S, Busch H, Freihen V, Beyes S, Schrempp M, Boerries M, et al. SNAIL1-mediated downregulation of FOXA proteins facilitates the inactivation of transcriptional enhancer elements at key epithelial genes in colorectal cancer cells. PLoS Genet. 2017;13:e1007109 pubmed publisher
Tothova Z, Krill Burger J, Popova K, Landers C, Sievers Q, Yudovich D, et al. Multiplex CRISPR/Cas9-Based Genome Editing in Human Hematopoietic Stem Cells Models Clonal Hematopoiesis and Myeloid Neoplasia. Cell Stem Cell. 2017;21:547-555.e8 pubmed publisher
Tamura I, Shirafuta Y, Jozaki K, Kajimura T, Shinagawa M, Maekawa R, et al. Novel Function of a Transcription Factor WT1 in Regulating Decidualization in Human Endometrial Stromal Cells and Its Molecular Mechanism. Endocrinology. 2017;158:3696-3707 pubmed publisher
Tchieu J, Zimmer B, Fattahi F, Amin S, Zeltner N, Chen S, et al. A Modular Platform for Differentiation of Human PSCs into All Major Ectodermal Lineages. Cell Stem Cell. 2017;21:399-410.e7 pubmed publisher
Burdick R, Delviks Frankenberry K, Chen J, Janaka S, Sastri J, HU W, et al. Dynamics and regulation of nuclear import and nuclear movements of HIV-1 complexes. PLoS Pathog. 2017;13:e1006570 pubmed publisher
Qing X, Walter J, Jarazo J, Arias Fuenzalida J, Hillje A, Schwamborn J. CRISPR/Cas9 and piggyBac-mediated footprint-free LRRK2-G2019S knock-in reveals neuronal complexity phenotypes and ?-Synuclein modulation in dopaminergic neurons. Stem Cell Res. 2017;24:44-50 pubmed publisher
Thomas C, Tejwani L, Trujillo C, Negraes P, Herai R, Mesci P, et al. Modeling of TREX1-Dependent Autoimmune Disease using Human Stem Cells Highlights L1 Accumulation as a Source of Neuroinflammation. Cell Stem Cell. 2017;21:319-331.e8 pubmed publisher
Chadwick A, Wang X, Musunuru K. In Vivo Base Editing of PCSK9 (Proprotein Convertase Subtilisin/Kexin Type 9) as a Therapeutic Alternative to Genome Editing. Arterioscler Thromb Vasc Biol. 2017;37:1741-1747 pubmed publisher
Burnight E, Gupta M, Wiley L, Anfinson K, Tran A, Triboulet R, et al. Using CRISPR-Cas9 to Generate Gene-Corrected Autologous iPSCs for the Treatment of Inherited Retinal Degeneration. Mol Ther. 2017;25:1999-2013 pubmed publisher
Pashos E, Park Y, Wang X, Raghavan A, Yang W, Abbey D, et al. Large, Diverse Population Cohorts of hiPSCs and Derived Hepatocyte-like Cells Reveal Functional Genetic Variation at Blood Lipid-Associated Loci. Cell Stem Cell. 2017;20:558-570.e10 pubmed publisher
Carlson Stevermer J, Saha K. Genome Editing in Human Pluripotent Stem Cells. Methods Mol Biol. 2017;1590:165-174 pubmed publisher
Balczon R, Morrow K, Zhou C, Edmonds B, Alexeyev M, Pittet J, et al. Pseudomonas aeruginosa infection liberates transmissible, cytotoxic prion amyloids. FASEB J. 2017;31:2785-2796 pubmed publisher
Vaeth M, Yang J, Yamashita M, Zee I, Eckstein M, Knosp C, et al. ORAI2 modulates store-operated calcium entry and T cell-mediated immunity. Nat Commun. 2017;8:14714 pubmed publisher
Bu Q, Wang A, Hamzah H, Waldman A, Jiang K, Dong Q, et al. CREB Signaling Is Involved in Rett Syndrome Pathogenesis. J Neurosci. 2017;37:3671-3685 pubmed publisher
Havlicek S, Shen Y, Alpagu Y, Bruntraeger M, Zufir N, Phuah Z, et al. Re-engineered RNA-Guided FokI-Nucleases for Improved Genome Editing in Human Cells. Mol Ther. 2017;25:342-355 pubmed publisher
Kwart D, Paquet D, Teo S, Tessier Lavigne M. Precise and efficient scarless genome editing in stem cells using CORRECT. Nat Protoc. 2017;12:329-354 pubmed publisher
Bressan R, Dewari P, Kalantzaki M, Gangoso E, Matjusaitis M, Garcia Diaz C, et al. Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells. Development. 2017;144:635-648 pubmed publisher
Collinson A, Collier A, Morgan N, Sienerth A, Chandra T, Andrews S, et al. Deletion of the Polycomb-Group Protein EZH2 Leads to Compromised Self-Renewal and Differentiation Defects in Human Embryonic Stem Cells. Cell Rep. 2016;17:2700-2714 pubmed publisher
Jägle S, Dertmann A, Schrempp M, Hecht A. ZEB1 is neither sufficient nor required for epithelial-mesenchymal transition in LS174T colorectal cancer cells. Biochem Biophys Res Commun. 2017;482:1226-1232 pubmed publisher
Moorthy S, Davidson S, Shchuka V, Singh G, Malek Gilani N, Langroudi L, et al. Enhancers and super-enhancers have an equivalent regulatory role in embryonic stem cells through regulation of single or multiple genes. Genome Res. 2017;27:246-258 pubmed publisher
Zeltner N, Fattahi F, Dubois N, Saurat N, Lafaille F, Shang L, et al. Capturing the biology of disease severity in a PSC-based model of familial dysautonomia. Nat Med. 2016;22:1421-1427 pubmed publisher
Pham X, Song G, Lao S, Goff L, Zhu H, Valle D, et al. The DPYSL2 gene connects mTOR and schizophrenia. Transl Psychiatry. 2016;6:e933 pubmed publisher
Yagi H, Kuo C, Obayashi T, Ninagawa S, Khoo K, Kato K. Direct Mapping of Additional Modifications on Phosphorylated O-glycans of α-Dystroglycan by Mass Spectrometry Analysis in Conjunction with Knocking Out of Causative Genes for Dystroglycanopathy. Mol Cell Proteomics. 2016;15:3424-3434 pubmed
Liu Z, Hui Y, Shi L, Chen Z, Xu X, Chi L, et al. Efficient CRISPR/Cas9-Mediated Versatile, Predictable, and Donor-Free Gene Knockout in Human Pluripotent Stem Cells. Stem Cell Reports. 2016;7:496-507 pubmed publisher
Bao X, Ong S, Goldberger O, Peng J, Sharma R, Thompson D, et al. Mitochondrial dysfunction remodels one-carbon metabolism in human cells. elife. 2016;5: pubmed publisher
Gossai N, Naumann J, Li N, Zamora E, Gordon D, Piccirilli J, et al. Drug conjugated nanoparticles activated by cancer cell specific mRNA. Oncotarget. 2016;7:38243-38256 pubmed publisher
Shinkuma S, Guo Z, Christiano A. Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa. Proc Natl Acad Sci U S A. 2016;113:5676-81 pubmed publisher
Moorthy S, Mitchell J. Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells. J Vis Exp. 2016;:e53552 pubmed publisher
Smith C, Ye Z, Cheng L. Genome Editing in Human Pluripotent Stem Cells. Cold Spring Harb Protoc. 2016;2016:pdb.top086819 pubmed publisher
Smith C, Ye Z, Cheng L. A Method for Genome Editing in Human Pluripotent Stem Cells. Cold Spring Harb Protoc. 2016;2016:pdb.prot090217 pubmed publisher
Liu L, Liu X, Ren X, Tian Y, Chen Z, Xu X, et al. Smad2 and Smad3 have differential sensitivity in relaying TGFβ signaling and inversely regulate early lineage specification. Sci Rep. 2016;6:21602 pubmed publisher
Yoshimi K, Kunihiro Y, Kaneko T, Nagahora H, Voigt B, Mashimo T. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 2016;7:10431 pubmed publisher
Tak Y, Hung Y, Yao L, Grimmer M, Do A, Bhakta M, et al. Effects on the transcriptome upon deletion of a distal element cannot be predicted by the size of the H3K27Ac peak in human cells. Nucleic Acids Res. 2016;44:4123-33 pubmed publisher
Gupta R, Meissner T, Cowan C, Musunuru K. Genome-Edited Human Pluripotent Stem Cell-Derived Macrophages as a Model of Reverse Cholesterol Transport--Brief Report. Arterioscler Thromb Vasc Biol. 2016;36:15-8 pubmed publisher
Ramlee M, Yan T, Cheung A, Chuah C, Li S. High-throughput genotyping of CRISPR/Cas9-mediated mutants using fluorescent PCR-capillary gel electrophoresis. Sci Rep. 2015;5:15587 pubmed publisher
Freedman B, Brooks C, Lam A, Fu H, Morizane R, Agrawal V, et al. Modelling kidney disease with CRISPR-mutant kidney organoids derived from human pluripotent epiblast spheroids. Nat Commun. 2015;6:8715 pubmed publisher
Kang S, Kim S, Chai J, Kim S, Won K, Lee Y, et al. Transcriptomic Profiling and H3K27me3 Distribution Reveal Both Demethylase-Dependent and Independent Regulation of Developmental Gene Transcription in Cell Differentiation. PLoS ONE. 2015;10:e0135276 pubmed publisher
Laperle A, Hsiao C, Lampe M, Mortier J, Saha K, Palecek S, et al. α-5 Laminin Synthesized by Human Pluripotent Stem Cells Promotes Self-Renewal. Stem Cell Reports. 2015;5:195-206 pubmed publisher
Ogawa Y, Shiraki T, Kojima D, Fukada Y. Homeobox transcription factor Six7 governs expression of green opsin genes in zebrafish. Proc Biol Sci. 2015;282:20150659 pubmed publisher
Chen Y, Cao J, Xiong M, Petersen A, Dong Y, Tao Y, et al. Engineering Human Stem Cell Lines with Inducible Gene Knockout using CRISPR/Cas9. Cell Stem Cell. 2015;17:233-44 pubmed publisher
Beaudoin M, Gupta R, Won H, Lo K, Do R, Henderson C, et al. Myocardial Infarction-Associated SNP at 6p24 Interferes With MEF2 Binding and Associates With PHACTR1 Expression Levels in Human Coronary Arteries. Arterioscler Thromb Vasc Biol. 2015;35:1472-1479 pubmed publisher
McGrath P, Watson C, Ingram C, Helmrath M, Wells J. The Basic Helix-Loop-Helix Transcription Factor NEUROG3 Is Required for Development of the Human Endocrine Pancreas. Diabetes. 2015;64:2497-505 pubmed publisher
Renouf B, Piganeau M, Ghezraoui H, Jasin M, Brunet E. Creating cancer translocations in human cells using Cas9 DSBs and nCas9 paired nicks. Methods Enzymol. 2014;546:251-71 pubmed publisher
Zhu X, Xu Y, Yu S, Lu L, Ding M, Cheng J, et al. An efficient genotyping method for genome-modified animals and human cells generated with CRISPR/Cas9 system. Sci Rep. 2014;4:6420 pubmed publisher
Ding Q, Regan S, Xia Y, Oostrom L, Cowan C, Musunuru K. Enhanced efficiency of human pluripotent stem cell genome editing through replacing TALENs with CRISPRs. Cell Stem Cell. 2013;12:393-4 pubmed publisher
product information
Catalog Number :
44719
Product Name :
pCas9_GFP
article :
doi10.1016/j.stem.2013.03.006
id6547
pubmed_id23561441
bacterial resistance :
Ampicillin
cloning :
backbonepCAG
backbone_mutation
backbone_origin
backbone_size4200
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
CRISPR
growth notes :
For more information on Musunuru Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Musunuru/
growth strain :
Co-expression of human codon-optimized Cas9 nuclease and GFP, plasmid optimized for expression in human pluripotent stem cells
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3Unknown
cloning_site_5EcoRI
promoterCAG
sequencing_primer_3M13R
sequencing_primer_5ggctctagtgcctctgctaacc
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameCas9-2A-GFP
shRNA_sequence
size4926
species
100
Synthetic
tags
locationC terminal on insert
tag2A-GFP
plasmid copy :
George Church
resistance markers :
1454
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA