This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCRISPR::rpsL
catalog :
44505
citations: 1
Reference
Jiang W, Bikard D, Cox D, Zhang F, Marraffini L. RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol. 2013;31:233-9 pubmed publisher
product information
Catalog Number :
44505
Product Name :
pCRISPR::rpsL
article :
doi10.1038/nbt.2508
id6312
pubmed_id23360965
bacterial resistance :
Kanamycin
cloning :
backbonepZE21-MCS1
backbone_mutation
backbone_origin
backbone_size2254
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
CRISPR
Other
E.coli
growth notes :
gRNA target sequence aaaaaaccgaactccgcgctgcgtaaagta This plasmid is also known as pDB130. For more information on Marraffini Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/marraffini/
growth strain :
A crRNA expression plasmid specific to the rpsL allele.
origin :
37
pi :
alt_names
cloning
entrez_gene
aliasesb3342, ECK3329, asuB, strA
generpsL
id947845
genbank_ids
mutation
nameCRISPR::rpsL
shRNA_sequence
size
species
tags
resistance markers :
1451
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA