This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pAAV-hSyn-DIO-hM4D(Gi)-mCherry
catalog :
44362
citations: 147
Reference
Wang L, Cheng M, Wang Y, Chen J, Xie F, Huang L, et al. Fasting-activated ventrolateral medulla neurons regulate T cell homing and suppress autoimmune disease in mice. Nat Neurosci. 2024;: pubmed publisher
Parrini M, Tricot G, Caroni P, Spolidoro M. Circuit mechanisms of navigation strategy learning in mice. Curr Biol. 2024;34:79-91.e4 pubmed publisher
Derman R, Bryda E, Ferrario C. Role of nucleus accumbens D1-type medium spiny neurons in the expression and extinction of sign-tracking. Behav Brain Res. 2024;459:114768 pubmed publisher
Ding W, Yang L, Shi E, Kim B, Löw S, Hu K, et al. The endocannabinoid N-arachidonoyl dopamine is critical for hyperalgesia induced by chronic sleep disruption. Nat Commun. 2023;14:6696 pubmed publisher
Carzoli K, Kogias G, Fawcett Patel J, Liu S. Cerebellar interneurons control fear memory consolidation via learning-induced HCN plasticity. Cell Rep. 2023;42:113057 pubmed publisher
Zhang S, Kim A, Madara J, Zhu P, Christenson L, Lutas A, et al. Competition between stochastic neuropeptide signals calibrates the rate of satiation. bioRxiv. 2023;: pubmed publisher
Kim S, Tran L, Namkoong C, Choi H, Chun H, Lee Y, et al. Mitochondria-derived peptide SHLP2 regulates energy homeostasis through the activation of hypothalamic neurons. Nat Commun. 2023;14:4321 pubmed publisher
Dorofeikova M, Stelly C, Duong A, Basavanhalli S, Bean E, Weissmuller K, et al. The role of genetically distinct central amygdala neurons in appetitive and aversive responding assayed with a novel dual valence operant conditioning paradigm. bioRxiv. 2023;: pubmed publisher
Kassraian P, Bigler S, Gilly D, Shrotri N, Siegelbaum S. A neural mechanism for discriminating threatening from safe social experiences. bioRxiv. 2023;: pubmed publisher
Balouek J, Mclain C, Minerva A, Rashford R, Bennett S, Rogers F, et al. Reactivation of early-life stress-sensitive neuronal ensembles contributes to lifelong stress hypersensitivity. J Neurosci. 2023;: pubmed publisher
Elbaz M, Demers M, Kleinfeld D, Ethier C, Desch xea nes M. Interchangeable Role of Motor Cortex and Reafference for the Stable Execution of an Orofacial Action. J Neurosci. 2023;43:5521-5536 pubmed publisher
Xie X, Chen R, Wang X, Smith L, Wang J. Activity-dependent labeling and manipulation of fentanyl-recruited striatal ensembles using ArcTRAP approach. STAR Protoc. 2023;4:102369 pubmed publisher
Becchi S, Chieng B, Bradfield L, Capell xe1 n R, Leung B, Balleine B. Cognitive effects of thalamostriatal degeneration are ameliorated by normalizing striatal cholinergic activity. Sci Adv. 2023;9:eade8247 pubmed publisher
Assareh N, Fenech C, Power R, Uddin M, Otsu Y, Aubrey K. Bidirectional Modulation of Nociception by GlyT2+ Neurons in the Ventrolateral Periaqueductal Gray. Eneuro. 2023;10: pubmed publisher
Lyu J, Nagarajan R, Kambali M, Wang M, Rudolph U. Selective inhibition of somatostatin-positive dentate hilar interneurons induces age-related cellular changes and cognitive dysfunction. PNAS Nexus. 2023;2:pgad134 pubmed publisher
Liao Y, Sun L, Su Y, Yao W, Yu L. Medial and dorsal lateral septum involving social disruption stress-primed escalation in acid-induced writhes. Front Mol Neurosci. 2023;16:1158525 pubmed publisher
Fetcho R, Hall B, Estrin D, Walsh A, Schuette P, Kaminsky J, et al. Regulation of social interaction in mice by a frontostriatal circuit modulated by established hierarchical relationships. Nat Commun. 2023;14:2487 pubmed publisher
Yang S, Yang E, Lee J, Kim J, Yoo H, Park H, et al. Neural mechanism of acute stress regulation by trace aminergic signalling in the lateral habenula in male mice. Nat Commun. 2023;14:2435 pubmed publisher
Chen W, Mehlkop O, Scharn A, Nolte H, Klemm P, Henschke S, et al. Nutrient-sensing AgRP neurons relay control of liver autophagy during energy deprivation. Cell Metab. 2023;35:786-806.e13 pubmed publisher
Tsuji S, Brace C, Yao R, Tanie Y, Tada H, Rensing N, et al. Sleep-wake patterns are altered with age, Prdm13 signaling in the DMH, and diet restriction in mice. Life Sci Alliance. 2023;6: pubmed publisher
Lawson K, Ruiz C, Mahler S. A head-to-head comparison of two DREADD agonists for suppressing operant behavior in rats via VTA dopamine neuron inhibition. bioRxiv. 2023;: pubmed publisher
Ratigan H, Krishnan S, Smith S, Sheffield M. Direct Thalamic Inputs to Hippocampal CA1 Transmit a Signal That Suppresses Ongoing Contextual Fear Memory Retrieval. bioRxiv. 2023;: pubmed publisher
Inaba H, Li H, Kawatake Kuno A, Dewa K, Nagai J, Oishi N, et al. GPCR-mediated calcium and cAMP signaling determines psychosocial stress susceptibility and resiliency. Sci Adv. 2023;9:eade5397 pubmed publisher
Lal N, Le P, Aggarwal S, Zhang A, Wang K, Qi T, et al. Xiphoid nucleus of the midline thalamus controls cold-induced food seeking. bioRxiv. 2023;: pubmed publisher
Torres Rodriguez J, Wilson T, Singh S, Chaudhry S, Adke A, Becker J, et al. The parabrachial to central amygdala circuit is a key mediator of injury-induced pain sensitization. bioRxiv. 2023;: pubmed publisher
Nakamura Y, Kurabe M, Matsumoto M, Sato T, Miyashita S, Hoshina K, et al. Cerebrospinal fluid-contacting neuron tracing reveals structural and functional connectivity for locomotion in the mouse spinal cord. elife. 2023;12: pubmed publisher
Nebeling F, Poll S, Justus L, Steffen J, Keppler K, Mittag M, et al. Microglial motility is modulated by neuronal activity and correlates with dendritic spine plasticity in the hippocampus of awake mice. elife. 2023;12: pubmed publisher
Zuk K, Cansler H, Wang J, Meeks J. Arc-Expressing Accessory Olfactory Bulb Interneurons Support Chemosensory Social Behavioral Plasticity. J Neurosci. 2023;43:1178-1190 pubmed publisher
Ding W, Fischer L, Chen Q, Li Z, Yang L, You Z, et al. Highly synchronized cortical circuit dynamics mediate spontaneous pain in mice. J Clin Invest. 2023;133: pubmed publisher
Campagner D, Vale R, Tan Y, Iordanidou P, Pav xf3 n Arocas O, Claudi F, et al. A cortico-collicular circuit for orienting to shelter during escape. Nature. 2023;613:111-119 pubmed publisher
Goutaudier R, Joly F, Mallet D, Bartolomucci M, Guicherd D, Carcenac C, et al. Hypodopaminergic state of the nigrostriatal pathway drives compulsive alcohol use. Mol Psychiatry. 2023;28:463-474 pubmed publisher
Canetta S, Holt E, Benoit L, Teboul E, Sahyoun G, Ogden R, et al. Mature parvalbumin interneuron function in prefrontal cortex requires activity during a postnatal sensitive period. elife. 2022;11: pubmed publisher
Chen D, Qi Y, Zhang J, Yang Y. Deconstruction of a hypothalamic astrocyte-white adipocyte sympathetic axis that regulates lipolysis in mice. Nat Commun. 2022;13:7536 pubmed publisher
Morais Silva G, Campbell R, Nam H, Basu M, Pagliusi M, Fox M, et al. Molecular, circuit, and stress response characterization of Ventral Pallidum Npas1-neurons. J Neurosci. 2022;: pubmed publisher
Miranda J, Cruz E, Bessi xe8 res B, Alberini C. Hippocampal parvalbumin interneurons play a critical role in memory development. Cell Rep. 2022;41:111643 pubmed publisher
Kathe C, Skinnider M, Hutson T, Regazzi N, Gautier M, Demesmaeker R, et al. The neurons that restore walking after paralysis. Nature. 2022;611:540-547 pubmed publisher
Krishnan S, Heer C, Cherian C, Sheffield M. Reward expectation extinction restructures and degrades CA1 spatial maps through loss of a dopaminergic reward proximity signal. Nat Commun. 2022;13:6662 pubmed publisher
Li H, Sung H, Lau C. Activation of Somatostatin-Expressing Neurons in the Lateral Septum Improves Stress-Induced Depressive-like Behaviors in Mice. Pharmaceutics. 2022;14: pubmed publisher
Singh S, Wilson T, Valdivia S, Benowitz B, Chaudhry S, Ma J, et al. An inhibitory circuit from central amygdala to zona incerta drives pain-related behaviors in mice. elife. 2022;11: pubmed publisher
Chen A, Malgady J, Chen L, Shi K, Cheng E, Plotkin J, et al. Nigrostriatal dopamine pathway regulates auditory discrimination behavior. Nat Commun. 2022;13:5942 pubmed publisher
Belmer A, Depoortere R, Beecher K, Newman Tancredi A, Bartlett S. Neural serotonergic circuits for controlling long-term voluntary alcohol consumption in mice. Mol Psychiatry. 2022;27:4599-4610 pubmed publisher
Broussot L, Contesse T, Costa Campos R, Glangetas C, Royon L, Fôfo H, et al. A non-canonical GABAergic pathway to the VTA promotes unconditioned freezing. Mol Psychiatry. 2022;27:4905-4917 pubmed publisher
Keller D, L xe1 ng T, Cserven xe1 k M, Puska G, Barna J, Csillag V, et al. A thalamo-preoptic pathway promotes social grooming in rodents. Curr Biol. 2022;32:4593-4606.e8 pubmed publisher
Woon E, Butkovich L, Peluso A, Elbasheir A, Taylor K, Gourley S. Medial orbitofrontal neurotrophin systems integrate hippocampal input into outcome-specific value representations. Cell Rep. 2022;40:111334 pubmed publisher
McKendrick G, McDevitt D, Shafeek P, Cottrill A, Graziane N. Anterior cingulate cortex and its projections to the ventral tegmental area regulate opioid withdrawal, the formation of opioid context associations and context-induced drug seeking. Front Neurosci. 2022;16:972658 pubmed publisher
Merseburg A, Kasemir J, Buss E, Leroy F, Bock T, Porro A, et al. Seizures, behavioral deficits, and adverse drug responses in two new genetic mouse models of HCN1 epileptic encephalopathy. elife. 2022;11: pubmed publisher
Takeuchi D, Roy D, Muralidhar S, Kawai T, Bari A, Lovett C, et al. Cingulate-motor circuits update rule representations for sequential choice decisions. Nat Commun. 2022;13:4545 pubmed publisher
Sohn J, Suzuki M, Youssef M, Hatada S, Larkum M, Kawaguchi Y, et al. Presynaptic supervision of cortical spine dynamics in motor learning. Sci Adv. 2022;8:eabm0531 pubmed publisher
Silva M, Decoster L, Trova S, Mimouni N, Delli V, Chachlaki K, et al. Female sexual behavior is disrupted in a preclinical mouse model of PCOS via an attenuated hypothalamic nitric oxide pathway. Proc Natl Acad Sci U S A. 2022;119:e2203503119 pubmed publisher
Yu J, Sesack S, Huang Y, Schl xfc ter O, Grace A, Dong Y. Contingent Amygdala Inputs Trigger Heterosynaptic LTP at Hippocampus-To-Accumbens Synapses. J Neurosci. 2022;42:6581-6592 pubmed publisher
Dixsaut L, Gr xe4 ff J. Brain-wide screen of prelimbic cortex inputs reveals a functional shift during early fear memory consolidation. elife. 2022;11: pubmed publisher
Tsai T, Fang Y, Hung Y, Hung L, Hsu K. A dorsal CA2 to ventral CA1 circuit contributes to oxytocinergic modulation of long-term social recognition memory. J Biomed Sci. 2022;29:50 pubmed publisher
Li L, Wyler S, León Mercado L, Xu B, Oh Y, Swati -, et al. Delineating a serotonin 1B receptor circuit for appetite suppression in mice. J Exp Med. 2022;219: pubmed publisher
Wong F, Selten M, Rosés Novella C, Sreenivasan V, Pallas Bazarra N, Serafeimidou Pouliou E, et al. Serotonergic regulation of bipolar cell survival in the developing cerebral cortex. Cell Rep. 2022;40:111037 pubmed publisher
Goldenberg A, Schmidt S, Mitelman R, Levy D, Prigge M, Katz Y, et al. Localized chemogenetic silencing of inhibitory neurons: a novel mouse model of focal cortical epileptic activity. Cereb Cortex. 2022;: pubmed publisher
Cooper A, Hedden N, Prasoon P, Qi Y, Taylor B. Post-surgical latent pain sensitization is driven by descending serotonergic facilitation and masked by µ-opioid receptor constitutive activity (MORCA) in the rostral ventromedial medulla. J Neurosci. 2022;: pubmed publisher
La Vu M, Sethi E, Maesta Pereira S, Schuette P, Tobias B, Reis F, et al. Sparse genetically defined neurons refine the canonical role of periaqueductal gray columnar organization. elife. 2022;11: pubmed publisher
Zhang T, Perkins M, Chang H, Han W, de Araujo I. An inter-organ neural circuit for appetite suppression. Cell. 2022;185:2478-2494.e28 pubmed publisher
Fleming W, Lee J, Briones B, Bolkan S, Witten I. Cholinergic interneurons mediate cocaine extinction in male mice through plasticity across medium spiny neuron subtypes. Cell Rep. 2022;39:110874 pubmed publisher
Benoit L, Holt E, Posani L, Fusi S, Harris A, Canetta S, et al. Adolescent thalamic inhibition leads to long-lasting impairments in prefrontal cortex function. Nat Neurosci. 2022;25:714-725 pubmed publisher
Ambler M, Hitrec T, Wilson A, Cerri M, Pickering A. Neurons in the Dorsomedial Hypothalamus Promote, Prolong, and Deepen Torpor in the Mouse. J Neurosci. 2022;42:4267-4277 pubmed publisher
Niu M, Kasai A, Tanuma M, Seiriki K, Igarashi H, Kuwaki T, et al. Claustrum mediates bidirectional and reversible control of stress-induced anxiety responses. Sci Adv. 2022;8:eabi6375 pubmed publisher
He L, Caudill M, Jing J, Wang W, Sun Y, Tang J, et al. A weakened recurrent circuit in the hippocampus of Rett syndrome mice disrupts long-term memory representations. Neuron. 2022;110:1689-1699.e6 pubmed publisher
Baek S, Park J, Kim J, Yamamoto Y, Tanaka Yamamoto K. VTA-projecting cerebellar neurons mediate stress-dependent depression-like behaviors. elife. 2022;11: pubmed publisher
Topilko T, Diaz S, Pacheco C, Verny F, Rousseau C, Kirst C, et al. Edinger-Westphal peptidergic neurons enable maternal preparatory nesting. Neuron. 2022;110:1385-1399.e8 pubmed publisher
Xie A, Iguchi N, Clarkson T, Malykhina A. Pharmacogenetic inhibition of lumbosacral sensory neurons alleviates visceral hypersensitivity in a mouse model of chronic pelvic pain. PLoS ONE. 2022;17:e0262769 pubmed publisher
Chang C, Zhao M, Grudzien S, Oginsky M, Yang Y, Kwon S. A Cortico-Cortical Pathway Targets Inhibitory Interneurons and Modulates Paw Movement during Locomotion in Mice. J Neurosci. 2022;42:44-57 pubmed publisher
Kearns A, Siemsen B, Hopkins J, Weber R, Scofield M, Peters J, et al. Chemogenetic inhibition of corticostriatal circuits reduces cued reinstatement of methamphetamine seeking. Addict Biol. 2022;27:e13097 pubmed publisher
Xing B, Mack N, Zhang Y, McEachern E, Gao W. Distinct roles for prefrontal dopamine D1 and D2 neurons in social hierarchy. J Neurosci. 2021;: pubmed publisher
Zhang C, Koukouli F, Allegra M, Ortiz C, Kao H, Maskos U, et al. Inhibitory control of synaptic signals preceding locomotion in mouse frontal cortex. Cell Rep. 2021;37:110035 pubmed publisher
Lee E, Park J, Kwon H, Han P. Repeated exposure with short-term behavioral stress resolves pre-existing stress-induced depressive-like behavior in mice. Nat Commun. 2021;12:6682 pubmed publisher
Botterill J, Khlaifia A, Walters B, Brimble M, Scharfman H, Arruda Carvalho M. Off-Target Expression of Cre-Dependent Adeno-Associated Viruses in Wild-Type C57BL/6J Mice. Eneuro. 2021;8: pubmed publisher
Feng H, Su J, Fang W, Chen X, He J. The entorhinal cortex modulates trace fear memory formation and neuroplasticity in the mouse lateral amygdala via cholecystokinin. elife. 2021;10: pubmed publisher
Krause W, Rodriguez R, Gegenhuber B, Matharu N, Rodriguez A, Padilla Roger A, et al. Oestrogen engages brain MC4R signalling to drive physical activity in female mice. Nature. 2021;599:131-135 pubmed publisher
Fratzl A, Koltchev A, Vissers N, Tan Y, Marques Smith A, Stempel A, et al. Flexible inhibitory control of visually evoked defensive behavior by the ventral lateral geniculate nucleus. Neuron. 2021;109:3810-3822.e9 pubmed publisher
Kim A, Madara J, Wu C, Andermann M, Lowell B. Neural basis for regulation of vasopressin secretion by anticipated disturbances in osmolality. elife. 2021;10: pubmed publisher
Kabahizi A, Wallace B, Lieu L, Chau D, Dong Y, Hwang E, et al. Glucagon-like peptide-1 (GLP-1) signalling in the brain: From neural circuits and metabolism to therapeutics. Br J Pharmacol. 2021;: pubmed publisher
Huang T, Guan F, Licinio J, Wong M, Yang Y. Activation of septal OXTr neurons induces anxiety- but not depressive-like behaviors. Mol Psychiatry. 2021;: pubmed publisher
Smith A, Jonkman S, DiFeliceantonio A, O Connor R, Ghoshal S, Romano M, et al. Opposing roles for striatonigral and striatopallidal neurons in dorsolateral striatum in consolidating new instrumental actions. Nat Commun. 2021;12:5121 pubmed publisher
Siemian J, Arenivar M, Sarsfield S, Borja C, Russell C, Aponte Y. Lateral hypothalamic LEPR neurons drive appetitive but not consummatory behaviors. Cell Rep. 2021;36:109615 pubmed publisher
Heinsbroek J, Giannotti G, Mandel M, Josey M, Aston Jones G, James M, et al. A common limiter circuit for opioid choice and relapse identified in a rodent addiction model. Nat Commun. 2021;12:4788 pubmed publisher
Berrios J, Li C, Madara J, Garfield A, Steger J, Krashes M, et al. Food cue regulation of AGRP hunger neurons guides learning. Nature. 2021;595:695-700 pubmed publisher
Comeras L, Hörmer N, Mohan Bethuraj P, Tasan R. NPY Released From GABA Neurons of the Dentate Gyrus Specially Reduces Contextual Fear Without Affecting Cued or Trace Fear. Front Synaptic Neurosci. 2021;13:635726 pubmed publisher
Devienne G, Picaud S, Cohen I, Piquet J, Tricoire L, Testa D, et al. Regulation of perineuronal nets in the adult cortex by the activity of the cortical network. J Neurosci. 2021;: pubmed publisher
Siemian J, Arenivar M, Sarsfield S, Borja C, Erbaugh L, Eagle A, et al. An excitatory lateral hypothalamic circuit orchestrating pain behaviors in mice. elife. 2021;10: pubmed publisher
Cleary C, Milla B, Kuo F, James S, Flynn W, Robson P, et al. Somatostatin-expressing parafacial neurons are CO2/H+ sensitive and regulate baseline breathing. elife. 2021;10: pubmed publisher
Liu C, Lee C, Asher G, Cao L, Terakoshi Y, Cao P, et al. Posterior subthalamic nucleus (PSTh) mediates innate fear-associated hypothermia in mice. Nat Commun. 2021;12:2648 pubmed publisher
Helseth A, Hernández Martinez R, Hall V, Oliver M, Turner B, Caffall Z, et al. Cholinergic neurons constitutively engage the ISR for dopamine modulation and skill learning in mice. Science. 2021;372: pubmed publisher
Achilly N, Wang W, Zoghbi H. Presymptomatic training mitigates functional deficits in a mouse model of Rett syndrome. Nature. 2021;592:596-600 pubmed publisher
Lilascharoen V, Wang E, Do N, Pate S, Tran A, Yoon C, et al. Divergent pallidal pathways underlying distinct Parkinsonian behavioral deficits. Nat Neurosci. 2021;24:504-515 pubmed publisher
Wang R, Guo H, Jiang S, Liu Z, Qu W, Huang Z, et al. Control of wakefulness by lateral hypothalamic glutamatergic neurons in male mice. J Neurosci Res. 2021;99:1689-1703 pubmed publisher
Kato Y, Katsumata H, Inutsuka A, Yamanaka A, Onaka T, Minami S, et al. Involvement of MCH-oxytocin neural relay within the hypothalamus in murine nursing behavior. Sci Rep. 2021;11:3348 pubmed publisher
Brommer B, He M, Zhang Z, Yang Z, Page J, Su J, et al. Improving hindlimb locomotor function by Non-invasive AAV-mediated manipulations of propriospinal neurons in mice with complete spinal cord injury. Nat Commun. 2021;12:781 pubmed publisher
Nguyen E, Lim G, Ding H, Hachisuka J, Ko M, Ross S. Morphine acts on spinal dynorphin neurons to cause itch through disinhibition. Sci Transl Med. 2021;13: pubmed publisher
Botterill J, Vinod K, Gerencer K, Teixeira C, Lafrancois J, Scharfman H. Bidirectional regulation of cognitive and anxiety-like behaviors by dentate gyrus mossy cells in male and female mice. J Neurosci. 2021;: pubmed publisher
Houtz J, Liao G, An J, Xu B. Discrete TrkB-expressing neurons of the dorsomedial hypothalamus regulate feeding and thermogenesis. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Fee C, Prévôt T, Misquitta K, Knutson D, Li G, Mondal P, et al. Behavioral deficits induced by somatostatin-positive GABA neuron silencing are rescued by alpha 5 GABA-A receptor potentiation. Int J Neuropsychopharmacol. 2021;: pubmed publisher
Borodovitsyna O, Duffy B, Pickering A, Chandler D. Anatomically and functionally distinct locus coeruleus efferents mediate opposing effects on anxiety-like behavior. Neurobiol Stress. 2020;13:100284 pubmed publisher
Zhang J, Chen D, Sweeney P, Yang Y. An excitatory ventromedial hypothalamus to paraventricular thalamus circuit that suppresses food intake. Nat Commun. 2020;11:6326 pubmed publisher
Leyrer Jackson J, Holter M, Overby P, Newbern J, Scofield M, Olive M, et al. Accumbens Cholinergic Interneurons Mediate Cue-Induced Nicotine Seeking and Associated Glutamatergic Plasticity. Eneuro. 2021;8: pubmed publisher
Do J, Chang Z, Sekerkova G, McCrimmon D, Martina M. A Leptin-Mediated Neural Mechanism Linking Breathing to Metabolism. Cell Rep. 2020;33:108358 pubmed publisher
Townsley K, Borrego M, OZBURN A. Effects of chemogenetic manipulation of the nucleus accumbens core in male C57BL/6J mice. Alcohol. 2020;91:21-27 pubmed publisher
Strong C, Hagarty D, Brea Guerrero A, Schoepfer K, Cajuste S, Kabbaj M. Chemogenetic selective manipulation of nucleus accumbens medium spiny neurons bidirectionally controls alcohol intake in male and female rats. Sci Rep. 2020;10:19178 pubmed publisher
Sherafat Y, Bautista M, Fowler J, Chen E, Ahmed A, Fowler C. The Interpeduncular-Ventral Hippocampus Pathway Mediates Active Stress Coping and Natural Reward. Eneuro. 2020;7: pubmed publisher
Shrestha P, Shan Z, Mamcarz M, Ruiz K, Zerihoun A, Juan C, et al. Amygdala inhibitory neurons as loci for translation in emotional memories. Nature. 2020;586:407-411 pubmed publisher
Jiang Y, Travagli R. Hypothalamic-vagal oxytocinergic neurocircuitry modulates gastric emptying and motility following stress. J Physiol. 2020;598:4941-4955 pubmed publisher
Liu Y, Jean Richard Dit Bressel P, Yau J, Willing A, Prasad A, Power J, et al. The Mesolimbic Dopamine Activity Signatures of Relapse to Alcohol-Seeking. J Neurosci. 2020;40:6409-6427 pubmed publisher
Yu X, Ba W, Zhao G, Ma Y, Harding E, Yin L, et al. Dysfunction of ventral tegmental area GABA neurons causes mania-like behavior. Mol Psychiatry. 2020;: pubmed publisher
Avila C, Kucinski A, Sarter M. Complex movement control in a rat model of Parkinsonian falls: bidirectional control by striatal cholinergic interneurons. J Neurosci. 2020;: pubmed publisher
Job M, Chojnacki M, Daiwile A, Cadet J. Chemogenetic Inhibition of Dopamine D1-expressing Neurons in the Dorsal Striatum does not alter Methamphetamine Intake in either Male or Female Long Evans Rats. Neurosci Lett. 2020;729:134987 pubmed publisher
Engeln M, Song Y, Chandra R, La A, Fox M, Evans B, et al. Individual differences in stereotypy and neuron subtype translatome with TrkB deletion. Mol Psychiatry. 2020;: pubmed publisher
Han Y, Zhang Y, Kim H, Grayson V, Jovasevic V, Ren W, et al. Excitatory VTA to DH projections provide a valence signal to memory circuits. Nat Commun. 2020;11:1466 pubmed publisher
Guerin K, Rego M, Bourges D, Ersing I, Haery L, Harten DeMaio K, et al. A Novel Next-Generation Sequencing and Analysis Platform to Assess the Identity of Recombinant Adeno-Associated Viral Preparations from Viral DNA Extracts. Hum Gene Ther. 2020;31:664-678 pubmed publisher
Garr E, Delamater A. Chemogenetic inhibition in the dorsal striatum reveals regional specificity of direct and indirect pathway control of action sequencing. Neurobiol Learn Mem. 2020;169:107169 pubmed publisher
Cheng W, Gonzalez I, Pan W, Tsang A, Adams J, Ndoka E, et al. Calcitonin Receptor Neurons in the Mouse Nucleus Tractus Solitarius Control Energy Balance via the Non-aversive Suppression of Feeding. Cell Metab. 2020;31:301-312.e5 pubmed publisher
Kim D, Jang S, Kim J, Park I, Ku K, Choi M, et al. Kisspeptin neuron-specific and self-sustained calcium oscillation in the hypothalamic arcuate nucleus of neonatal mice: Regulatory factors of its synchronization. Neuroendocrinology. 2020;: pubmed publisher
Prasad A, Xie C, Chaichim C, Nguyen J, McClusky H, Killcross S, et al. Complementary roles for ventral pallidum cell types and their projections in relapse. J Neurosci. 2019;: pubmed publisher
Botterill J, Lu Y, Lafrancois J, Bernstein H, Alcantara Gonzalez D, Jain S, et al. An Excitatory and Epileptogenic Effect of Dentate Gyrus Mossy Cells in a Mouse Model of Epilepsy. Cell Rep. 2019;29:2875-2889.e6 pubmed publisher
Wall N, Neumann P, BEIER K, Mokhtari A, Luo L, Malenka R. Complementary Genetic Targeting and Monosynaptic Input Mapping Reveal Recruitment and Refinement of Distributed Corticostriatal Ensembles by Cocaine. Neuron. 2019;104:916-930.e5 pubmed publisher
Bäck S, Dossat A, Parkkinen I, Koivula P, Airavaara M, Richie C, et al. Neuronal Activation Stimulates Cytomegalovirus Promoter-Driven Transgene Expression. Mol Ther Methods Clin Dev. 2019;14:180-188 pubmed publisher
Parker K, Pedersen C, Gomez A, Spangler S, Walicki M, Feng S, et al. A Paranigral VTA Nociceptin Circuit that Constrains Motivation for Reward. Cell. 2019;178:653-671.e19 pubmed publisher
Giannotti G, Heinsbroek J, Yue A, Deisseroth K, Peters J. Prefrontal cortex neuronal ensembles encoding fear drive fear expression during long-term memory retrieval. Sci Rep. 2019;9:10709 pubmed publisher
Quinn D, Kolar A, Harris S, Wigerius M, Fawcett J, Krueger S. The Stability of Glutamatergic Synapses Is Independent of Activity Level, but Predicted by Synapse Size. Front Cell Neurosci. 2019;13:291 pubmed publisher
Hao S, Yang H, Wang X, He Y, Xu H, Wu X, et al. The Lateral Hypothalamic and BNST GABAergic Projections to the Anterior Ventrolateral Periaqueductal Gray Regulate Feeding. Cell Rep. 2019;28:616-624.e5 pubmed publisher
Kwak S, Jung M. Distinct roles of striatal direct and indirect pathways in value-based decision making. elife. 2019;8: pubmed publisher
Bari B, Grossman C, Lubin E, Rajagopalan A, Cressy J, Cohen J. Stable Representations of Decision Variables for Flexible Behavior. Neuron. 2019;103:922-933.e7 pubmed publisher
Hardaway J, Halladay L, Mazzone C, Pati D, Bloodgood D, Kim M, et al. Central Amygdala Prepronociceptin-Expressing Neurons Mediate Palatable Food Consumption and Reward. Neuron. 2019;102:1037-1052.e7 pubmed publisher
Li M, Madara J, Steger J, Krashes M, Balthasar N, Campbell J, et al. The Paraventricular Hypothalamus Regulates Satiety and Prevents Obesity via Two Genetically Distinct Circuits. Neuron. 2019;102:653-667.e6 pubmed publisher
Golden S, Jin M, Heins C, Venniro M, Michaelides M, Shaham Y. Nucleus Accumbens Drd1-Expressing Neurons Control Aggression Self-Administration and Aggression Seeking in Mice. J Neurosci. 2019;39:2482-2496 pubmed publisher
Pardo Garcia T, García Keller C, Penaloza T, Richie C, Pickel J, Hope B, et al. Ventral Pallidum Is the Primary Target for Accumbens D1 Projections Driving Cocaine Seeking. J Neurosci. 2019;39:2041-2051 pubmed publisher
Li C, Navarrete J, Liang Guallpa J, Lu C, Funderburk S, Chang R, et al. Defined Paraventricular Hypothalamic Populations Exhibit Differential Responses to Food Contingent on Caloric State. Cell Metab. 2019;29:681-694.e5 pubmed publisher
Goldstein N, Levine B, Loy K, Duke W, Meyerson O, Jamnik A, et al. Hypothalamic Neurons that Regulate Feeding Can Influence Sleep/Wake States Based on Homeostatic Need. Curr Biol. 2018;: pubmed publisher
Wang Z, Maunze B, Wang Y, Tsoulfas P, Blackmore M. Global Connectivity and Function of Descending Spinal Input Revealed by 3D Microscopy and Retrograde Transduction. J Neurosci. 2018;38:10566-10581 pubmed publisher
Meira T, Leroy F, Buss E, Oliva A, Park J, Siegelbaum S. A hippocampal circuit linking dorsal CA2 to ventral CA1 critical for social memory dynamics. Nat Commun. 2018;9:4163 pubmed publisher
Alpar A, Zahola P, Hanics J, Hevesi Z, Korchynska S, Benevento M, et al. Hypothalamic CNTF volume transmission shapes cortical noradrenergic excitability upon acute stress. EMBO J. 2018;37: pubmed publisher
Zhang T, Deyama S, Domoto M, Wada S, Yanagida J, Sasase H, et al. Activation of GABAergic Neurons in the Nucleus Accumbens Mediates the Expression of Cocaine-Associated Memory. Biol Pharm Bull. 2018;41:1084-1088 pubmed publisher
Wong F, Bercsényi K, Sreenivasan V, Portalés A, Fernández Otero M, Marin O. Pyramidal cell regulation of interneuron survival sculpts cortical networks. Nature. 2018;557:668-673 pubmed publisher
Ueno M, Nakamura Y, Li J, Gu Z, Niehaus J, Maezawa M, et al. Corticospinal Circuits from the Sensory and Motor Cortices Differentially Regulate Skilled Movements through Distinct Spinal Interneurons. Cell Rep. 2018;23:1286-1300.e7 pubmed publisher
Cavaccini A, Gritti M, Giorgi A, Locarno A, Heck N, Migliarini S, et al. Serotonergic Signaling Controls Input-Specific Synaptic Plasticity at Striatal Circuits. Neuron. 2018;98:801-816.e7 pubmed publisher
Chiang M, Huang A, Wintzer M, Ohshima T, McHugh T. A role for CA3 in social recognition memory. Behav Brain Res. 2018;354:22-30 pubmed publisher
Morabito G, Giannelli S, Ordazzo G, Bido S, Castoldi V, Indrigo M, et al. AAV-PHP.B-Mediated Global-Scale Expression in the Mouse Nervous System Enables GBA1 Gene Therapy for Wide Protection from Synucleinopathy. Mol Ther. 2017;25:2727-2742 pubmed publisher
Knowland D, Lilascharoen V, Pacia C, Shin S, Wang E, Lim B. Distinct Ventral Pallidal Neural Populations Mediate Separate Symptoms of Depression. Cell. 2017;170:284-297.e18 pubmed publisher
Marron Fernandez de Velasco E, Zhang L, N Vo B, Tipps M, Farris S, Xia Z, et al. GIRK2 splice variants and neuronal G protein-gated K+ channels: implications for channel function and behavior. Sci Rep. 2017;7:1639 pubmed publisher
Boehringer R, Polygalov D, Huang A, Middleton S, Robert V, Wintzer M, et al. Chronic Loss of CA2 Transmission Leads to Hippocampal Hyperexcitability. Neuron. 2017;94:642-655.e9 pubmed publisher
Uygun D, Ye Z, Zecharia A, Harding E, Yu X, Yustos R, et al. Bottom-Up versus Top-Down Induction of Sleep by Zolpidem Acting on Histaminergic and Neocortex Neurons. J Neurosci. 2016;36:11171-11184 pubmed
Chen N, Sugihara H, Kim J, Fu Z, Barak B, Sur M, et al. Direct modulation of GFAP-expressing glia in the arcuate nucleus bi-directionally regulates feeding. elife. 2016;5: pubmed publisher
Krashes M, Koda S, Ye C, Rogan S, Adams A, Cusher D, et al. Rapid, reversible activation of AgRP neurons drives feeding behavior in mice. J Clin Invest. 2011;121:1424-8 pubmed publisher
product information
Catalog Number :
44362
Product Name :
pAAV-hSyn-DIO-hM4D(Gi)-mCherry
article :
doi10.1172/JCI46229
id6474
pubmed_id21364278
bacterial resistance :
Ampicillin
cloning :
backbonepAAV
backbone_mutation
backbone_origin
backbone_size4818
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
AAV
Other
Adeno Associated Viral Vector
growth notes :
These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
growth strain :
Double floxed Gi-coupled hM4D DREADD fused with mCherry under the control of human synapsin promoter.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3Nhe I
cloning_site_5Asc I
promoterhuman Synapsin 1
sequencing_primer_3GCATTAAAGCAGCGTATCCACATAGC
sequencing_primer_5tcgtgtcgtgcctgagagcg
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namehM4D(Gi)-mCherry
shRNA_sequence
size2175
species
9606
Homo sapiens
tags
locationC terminal on insert
tagmCherry
resistance markers :
1493
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA