This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pAAV-hSyn-DIO-hM3D(Gq)-mCherry
catalog :
44361
citations: 170
Reference
Li M, Yang G. A mesocortical glutamatergic pathway modulates neuropathic pain independent of dopamine co-release. Nat Commun. 2024;15:643 pubmed publisher
Medak K, Jeromson S, Bellucci A, Arbeau M, Wright D. Amylin receptor agonism enhances the effects of liraglutide in protecting against the acute metabolic side effects of olanzapine. iScience. 2024;27:108628 pubmed publisher
Zhang C, Wu H, Feng H, Zhang Y, Tu J. Grass carp reovirus VP56 and VP35 induce formation of viral inclusion bodies for replication. iScience. 2024;27:108684 pubmed publisher
Wang L, Cheng M, Wang Y, Chen J, Xie F, Huang L, et al. Fasting-activated ventrolateral medulla neurons regulate T cell homing and suppress autoimmune disease in mice. Nat Neurosci. 2024;: pubmed publisher
Narimatsu Y, Kato M, Iwakoshi Ukena E, Moriwaki S, Ogasawara A, Furumitsu M, et al. Neurosecretory Protein GM-Expressing Neurons Participate in Lipid Storage and Inflammation in Newly Developed Cre Driver Male Mice. Biomedicines. 2023;11: pubmed publisher
Markam P, Bourguignon C, Zhu L, Darvas M, Sabatini P, Kokoeva M, et al. The neurons that drive infradian sleep-wake and mania-like behavioral rhythms. bioRxiv. 2023;: pubmed publisher
Condon L, Yu Y, Park S, Cao F, Pauli J, Nelson T, et al. Parabrachial Calca neurons drive nociplasticity. bioRxiv. 2023;: pubmed publisher
Ding W, Yang L, Shi E, Kim B, Löw S, Hu K, et al. The endocannabinoid N-arachidonoyl dopamine is critical for hyperalgesia induced by chronic sleep disruption. Nat Commun. 2023;14:6696 pubmed publisher
de Miera C, Bellefontaine N, Allen S, Myers M, Elias C. Glutamate neurotransmission from leptin receptor cells is required for typical puberty and reproductive function in female mice. bioRxiv. 2023;: pubmed publisher
Xu L, Liu Y, Long J, He X, Xie F, Yin Q, et al. Loss of spines in the prelimbic cortex is detrimental to working memory in mice with early-life adversity. Mol Psychiatry. 2023;: pubmed publisher
Boyle K, Polgár E, Gutierrez Mecinas M, Dickie A, Cooper A, Bell A, et al. Neuropeptide Y-expressing dorsal horn inhibitory interneurons gate spinal pain and itch signalling. elife. 2023;12: pubmed publisher
Dorofeikova M, Stelly C, Duong A, Basavanhalli S, Bean E, Weissmuller K, et al. The role of genetically distinct central amygdala neurons in appetitive and aversive responding assayed with a novel dual valence operant conditioning paradigm. bioRxiv. 2023;: pubmed publisher
Kawano T, Zhou J, Anwar S, Salah H, Dayal A, Ishikawa Y, et al. T cell infiltration into the brain triggers pulmonary dysfunction in murine Cryptococcus-associated IRIS. Nat Commun. 2023;14:3831 pubmed publisher
Zhou X, Stine C, Prada P, Fusca D, Assoumou K, Dernic J, et al. Development of a genetically-encoded sensor for probing endogenous nociceptin opioid peptide release. bioRxiv. 2023;: pubmed publisher
Souza G, Stornetta D, Shi Y, Lim E, Berry F, Bayliss D, et al. Neuromedin B-Expressing Neurons in the Retrotrapezoid Nucleus Regulate Respiratory Homeostasis and Promote Stable Breathing in Adult Mice. J Neurosci. 2023;43:5501-5520 pubmed publisher
Tu L, Bean J, He Y, Liu H, Yu M, Liu H, et al. Anoctamin 4 channel currents activate glucose-inhibited neurons in the mouse ventromedial hypothalamus during hypoglycemia. J Clin Invest. 2023;133: pubmed publisher
de Araújo A, Braga I, Leme G, Singh A, McDougle M, Smith J, et al. Asymmetric control of food intake by left and right vagal sensory neurons. bioRxiv. 2023;: pubmed publisher
Smith C, Rendina D, Kingsbury M, Malacon K, Nguyen D, Tran J, et al. Microbial modulation via cross-fostering prevents the effects of pervasive environmental stressors on microglia and social behavior, but not the dopamine system. Mol Psychiatry. 2023;: pubmed publisher
Xu Y, Jiang Z, Li H, Cai J, Jiang Y, Otiz Guzman J, et al. Lateral septum as a melanocortin downstream site in obesity development. Cell Rep. 2023;42:112502 pubmed publisher
Liao Y, Sun L, Su Y, Yao W, Yu L. Medial and dorsal lateral septum involving social disruption stress-primed escalation in acid-induced writhes. Front Mol Neurosci. 2023;16:1158525 pubmed publisher
Varadarajan S, Wang F, Dhande O, Le P, Duan X, Huberman A. Postsynaptic neuronal activity promotes regeneration of retinal axons. Cell Rep. 2023;42:112476 pubmed publisher
Yang S, Yang E, Lee J, Kim J, Yoo H, Park H, et al. Neural mechanism of acute stress regulation by trace aminergic signalling in the lateral habenula in male mice. Nat Commun. 2023;14:2435 pubmed publisher
Madar J, Tiwari N, Smith C, Sharma D, Shen S, Elmahdi A, et al. Piezo2 regulates colonic mechanical sensitivity in a sex specific manner in mice. Nat Commun. 2023;14:2158 pubmed publisher
Inaba H, Li H, Kawatake Kuno A, Dewa K, Nagai J, Oishi N, et al. GPCR-mediated calcium and cAMP signaling determines psychosocial stress susceptibility and resiliency. Sci Adv. 2023;9:eade5397 pubmed publisher
Lal N, Le P, Aggarwal S, Zhang A, Wang K, Qi T, et al. Xiphoid nucleus of the midline thalamus controls cold-induced food seeking. bioRxiv. 2023;: pubmed publisher
Torres Rodriguez J, Wilson T, Singh S, Chaudhry S, Adke A, Becker J, et al. The parabrachial to central amygdala circuit is a key mediator of injury-induced pain sensitization. bioRxiv. 2023;: pubmed publisher
Gu X, Zhang Y, O Malley J, De Preter C, Penzo M, Hoon M. Neurons in the caudal ventrolateral medulla mediate descending pain control. Nat Neurosci. 2023;26:594-605 pubmed publisher
Sancho Balsells A, Borr xe0 s Pernas S, Brito V, Alberch J, Girault J, Giralt A. Cognitive and Emotional Symptoms Induced by Chronic Stress Are Regulated by EGR1 in a Subpopulation of Hippocampal Pyramidal Neurons. Int J Mol Sci. 2023;24: pubmed publisher
Petzold A, van den Munkhof H, Figge Schlensok R, Korotkova T. Complementary lateral hypothalamic populations resist hunger pressure to balance nutritional and social needs. Cell Metab. 2023;35:456-471.e6 pubmed publisher
BILBO S, Smith C, Rendina D, Kingsbury M, Malacon K, Nguyen D, et al. Microbial modulation prevents the effects of pervasive environmental stressors on microglia and social behavior, but not the dopamine system. Res Sq. 2023;: pubmed publisher
Russo S, Cathomas F, Lin H, CHAN K, Li L, Cuttoli R, et al. Peripheral immune-derived matrix metalloproteinase promotes stress susceptibility. Res Sq. 2023;: pubmed publisher
Vieillard J, Franck M, Hartung S, Jakobsson J, Ceder M, Welsh R, et al. Adult spinal Dmrt3 neurons receive direct somatosensory inputs from ipsi- and contralateral primary afferents and from brainstem motor nuclei. J Comp Neurol. 2023;531:5-24 pubmed publisher
Kyo S, Murata K, Kawatou M, Minatoya K, Sunagawa G, Masumoto H. Quiescence-inducing neurons-induced hypometabolism ameliorates acute kidney injury in a mouse model mimicking cardiovascular surgery requiring circulatory arrest. JTCVS Open. 2022;12:201-210 pubmed publisher
Nakamura Y, Yahiro T, Fukushima A, Kataoka N, Hioki H, Nakamura K. Prostaglandin EP3 receptor-expressing preoptic neurons bidirectionally control body temperature via tonic GABAergic signaling. Sci Adv. 2022;8:eadd5463 pubmed publisher
Yin T, Mittal A, Buscaglia P, Li W, Sebag J. Activation of Amygdala Prokineticin receptor 2 neurons drives the anorexigenic activity of the neuropeptide PK2. J Biol Chem. 2022;:102814 pubmed publisher
Chen D, Qi Y, Zhang J, Yang Y. Deconstruction of a hypothalamic astrocyte-white adipocyte sympathetic axis that regulates lipolysis in mice. Nat Commun. 2022;13:7536 pubmed publisher
Zhang Q, Tang Q, Purohit N, Davenport J, Brennan C, Patel R, et al. Food-induced dopamine signaling in AgRP neurons promotes feeding. Cell Rep. 2022;41:111718 pubmed publisher
Rodrigues D, Jacinto L, Falc xe3 o M, Castro A, Cruz A, Santa C, et al. Chronic stress causes striatal disinhibition mediated by SOM-interneurons in male mice. Nat Commun. 2022;13:7355 pubmed publisher
Morais Silva G, Campbell R, Nam H, Basu M, Pagliusi M, Fox M, et al. Molecular, circuit, and stress response characterization of Ventral Pallidum Npas1-neurons. J Neurosci. 2022;: pubmed publisher
Miranda J, Cruz E, Bessi xe8 res B, Alberini C. Hippocampal parvalbumin interneurons play a critical role in memory development. Cell Rep. 2022;41:111643 pubmed publisher
Zheng H, L xf3 pez Ferreras L, Krieger J, Fasul S, Cea Salazar V, Valderrama Pena N, et al. A Cre-driver rat model for anatomical and functional analysis of glucagon (Gcg)-expressing cells in the brain and periphery. Mol Metab. 2022;66:101631 pubmed publisher
Kathe C, Skinnider M, Hutson T, Regazzi N, Gautier M, Demesmaeker R, et al. The neurons that restore walking after paralysis. Nature. 2022;611:540-547 pubmed publisher
Li H, Sung H, Lau C. Activation of Somatostatin-Expressing Neurons in the Lateral Septum Improves Stress-Induced Depressive-like Behaviors in Mice. Pharmaceutics. 2022;14: pubmed publisher
Singh S, Wilson T, Valdivia S, Benowitz B, Chaudhry S, Ma J, et al. An inhibitory circuit from central amygdala to zona incerta drives pain-related behaviors in mice. elife. 2022;11: pubmed publisher
Jiang Z, Chen C, Weiss G, Fu X, Stelly C, Sweeten B, et al. Stress-induced glucocorticoid desensitizes adrenoreceptors to gate the neuroendocrine response to somatic stress in male mice. Cell Rep. 2022;41:111509 pubmed publisher
Belmer A, Depoortere R, Beecher K, Newman Tancredi A, Bartlett S. Neural serotonergic circuits for controlling long-term voluntary alcohol consumption in mice. Mol Psychiatry. 2022;27:4599-4610 pubmed publisher
Lewis J, Woodward O, Nuzzaci D, Smith C, Adriaenssens A, Billing L, et al. Relaxin/insulin-like family peptide receptor 4 (Rxfp4) expressing hypothalamic neurons modulate food intake and preference in mice. Mol Metab. 2022;66:101604 pubmed publisher
Broussot L, Contesse T, Costa Campos R, Glangetas C, Royon L, Fôfo H, et al. A non-canonical GABAergic pathway to the VTA promotes unconditioned freezing. Mol Psychiatry. 2022;27:4905-4917 pubmed publisher
Keller D, L xe1 ng T, Cserven xe1 k M, Puska G, Barna J, Csillag V, et al. A thalamo-preoptic pathway promotes social grooming in rodents. Curr Biol. 2022;32:4593-4606.e8 pubmed publisher
Travers S, Kalyanasundar B, Breza J, Houser G, Klimovich C, TRAVERS J. Characteristics and Impact of the rNST GABA Network on Neural and Behavioral Taste Responses. Eneuro. 2022;9: pubmed publisher
Li M, Zhou H, Teng S, Yang G. Activation of VIP interneurons in the prefrontal cortex ameliorates neuropathic pain aversiveness. Cell Rep. 2022;40:111333 pubmed publisher
Garrido D, Beretta S, Grabrucker S, Bauer H, Bayer D, Sala C, et al. Shank2/3 double knockout-based screening of cortical subregions links the retrosplenial area to the loss of social memory in autism spectrum disorders. Mol Psychiatry. 2022;27:4994-5006 pubmed publisher
Eisdorfer J, Sobotka Briner H, Schramfield S, Moukarzel G, Chen J, Campion T, et al. Chemogenetic modulation of sensory afferents induces locomotor changes and plasticity after spinal cord injury. Front Mol Neurosci. 2022;15:872634 pubmed publisher
Nishimura H, Yoshimura M, Shimizu M, Sanada K, Sonoda S, Nishimura K, et al. Endogenous oxytocin exerts anti-nociceptive and anti-inflammatory effects in rats. Commun Biol. 2022;5:907 pubmed publisher
Jowett G, Read E, Roberts L, Coman D, Vil xe0 Gonz xe1 lez M, Zabinski T, et al. Organoids capture tissue-specific innate lymphoid cell development in mice and humans. Cell Rep. 2022;40:111281 pubmed publisher
Claflin K, Sullivan A, Naber M, Flippo K, Morgan D, Neff T, et al. Pharmacological FGF21 signals to glutamatergic neurons to enhance leptin action and lower body weight during obesity. Mol Metab. 2022;64:101564 pubmed publisher
Kostin A, Alam M, Saevskiy A, McGinty D, Alam M. Activation of the Ventrolateral Preoptic Neurons Projecting to the Perifornical-Hypothalamic Area Promotes Sleep: DREADD Activation in Wild-Type Rats. Cells. 2022;11: pubmed publisher
Jiménez González M, Li R, Pomeranz L, Alvarsson A, Marongiu R, Hampton R, et al. Mapping and targeted viral activation of pancreatic nerves in mice reveal their roles in the regulation of glucose metabolism. Nat Biomed Eng. 2022;6:1298-1316 pubmed publisher
Tsai T, Fang Y, Hung Y, Hung L, Hsu K. A dorsal CA2 to ventral CA1 circuit contributes to oxytocinergic modulation of long-term social recognition memory. J Biomed Sci. 2022;29:50 pubmed publisher
Li L, Wyler S, León Mercado L, Xu B, Oh Y, Swati -, et al. Delineating a serotonin 1B receptor circuit for appetite suppression in mice. J Exp Med. 2022;219: pubmed publisher
Wong F, Selten M, Rosés Novella C, Sreenivasan V, Pallas Bazarra N, Serafeimidou Pouliou E, et al. Serotonergic regulation of bipolar cell survival in the developing cerebral cortex. Cell Rep. 2022;40:111037 pubmed publisher
Chang C, Otomo K, Kozawa Y, Ishii H, Yamasaki M, Watanabe M, et al. Single-scan volumetric imaging throughout thick tissue specimens by one-touch installable light-needle creating device. Sci Rep. 2022;12:10468 pubmed publisher
Ojima K, Kakegawa W, Yamasaki T, Miura Y, Itoh M, Michibata Y, et al. Coordination chemogenetics for activation of GPCR-type glutamate receptors in brain tissue. Nat Commun. 2022;13:3167 pubmed publisher
Weil T, Daly K, Yarur Castillo H, Thomsen M, Wang H, Mercau M, et al. Daily changes in light influence mood via inhibitory networks within the thalamic perihabenular nucleus. Sci Adv. 2022;8:eabn3567 pubmed publisher
Brito V, Montalban E, Sancho Balsells A, Pupak A, Flotta F, Masana M, et al. Hippocampal Egr1-Dependent Neuronal Ensembles Negatively Regulate Motor Learning. J Neurosci. 2022;42:5346-5360 pubmed publisher
Pascal M, Kazakov A, Chevalier G, Dubrule L, Deyrat J, Dupin A, et al. The neuropeptide VIP potentiates intestinal innate type 2 and type 3 immunity in response to feeding. Mucosal Immunol. 2022;15:629-641 pubmed publisher
Ambler M, Hitrec T, Wilson A, Cerri M, Pickering A. Neurons in the Dorsomedial Hypothalamus Promote, Prolong, and Deepen Torpor in the Mouse. J Neurosci. 2022;42:4267-4277 pubmed publisher
Jovanovic P, Wang Y, Vit J, Novinbakht E, Morones N, Hogg E, et al. Sustained chemogenetic activation of locus coeruleus norepinephrine neurons promotes dopaminergic neuron survival in synucleinopathy. PLoS ONE. 2022;17:e0263074 pubmed publisher
Baek S, Park J, Kim J, Yamamoto Y, Tanaka Yamamoto K. VTA-projecting cerebellar neurons mediate stress-dependent depression-like behaviors. elife. 2022;11: pubmed publisher
Georgescu T, Khant Aung Z, Grattan D, Brown R. Prolactin-mediated restraint of maternal aggression in lactation. Proc Natl Acad Sci U S A. 2022;119: pubmed publisher
Topilko T, Diaz S, Pacheco C, Verny F, Rousseau C, Kirst C, et al. Edinger-Westphal peptidergic neurons enable maternal preparatory nesting. Neuron. 2022;110:1385-1399.e8 pubmed publisher
Alhassen W, Kobayashi Y, Su J, Robbins B, Nguyen H, Myint T, et al. Regulation of Brain Primary Cilia Length by MCH Signaling: Evidence from Pharmacological, Genetic, Optogenetic, and Chemogenic Manipulations. Mol Neurobiol. 2022;59:245-265 pubmed publisher
Kearns A, Siemsen B, Hopkins J, Weber R, Scofield M, Peters J, et al. Chemogenetic inhibition of corticostriatal circuits reduces cued reinstatement of methamphetamine seeking. Addict Biol. 2022;27:e13097 pubmed publisher
Kosmidis S, Negrean A, Dranovsky A, Losonczy A, Kandel E. A fast, aqueous, reversible three-day tissue clearing method for adult and embryonic mouse brain and whole body. Cell Rep Methods. 2021;1:100090 pubmed publisher
Xing B, Mack N, Zhang Y, McEachern E, Gao W. Distinct roles for prefrontal dopamine D1 and D2 neurons in social hierarchy. J Neurosci. 2021;: pubmed publisher
Kim A, Knudsen J, Madara J, Benrick A, Hill T, Abdul Kadir L, et al. Arginine-vasopressin mediates counter-regulatory glucagon release and is diminished in type 1 diabetes. elife. 2021;10: pubmed publisher
Krause W, Rodriguez R, Gegenhuber B, Matharu N, Rodriguez A, Padilla Roger A, et al. Oestrogen engages brain MC4R signalling to drive physical activity in female mice. Nature. 2021;599:131-135 pubmed publisher
Kabahizi A, Wallace B, Lieu L, Chau D, Dong Y, Hwang E, et al. Glucagon-like peptide-1 (GLP-1) signalling in the brain: From neural circuits and metabolism to therapeutics. Br J Pharmacol. 2021;: pubmed publisher
Huang T, Guan F, Licinio J, Wong M, Yang Y. Activation of septal OXTr neurons induces anxiety- but not depressive-like behaviors. Mol Psychiatry. 2021;: pubmed publisher
Ibrahim L, Huang S, Fernández Otero M, Sherer M, Qiu Y, Vemuri S, et al. Bottom-up inputs are required for establishment of top-down connectivity onto cortical layer 1 neurogliaform cells. Neuron. 2021;109:3473-3485.e5 pubmed publisher
Smith A, Jonkman S, DiFeliceantonio A, O Connor R, Ghoshal S, Romano M, et al. Opposing roles for striatonigral and striatopallidal neurons in dorsolateral striatum in consolidating new instrumental actions. Nat Commun. 2021;12:5121 pubmed publisher
Siemian J, Arenivar M, Sarsfield S, Borja C, Russell C, Aponte Y. Lateral hypothalamic LEPR neurons drive appetitive but not consummatory behaviors. Cell Rep. 2021;36:109615 pubmed publisher
Heinsbroek J, Giannotti G, Mandel M, Josey M, Aston Jones G, James M, et al. A common limiter circuit for opioid choice and relapse identified in a rodent addiction model. Nat Commun. 2021;12:4788 pubmed publisher
Koralek A, Costa R. Dichotomous dopaminergic and noradrenergic neural states mediate distinct aspects of exploitative behavioral states. Sci Adv. 2021;7: pubmed publisher
Smit R, Campion T, Stingel R, Shah P, Chen J, Smith G. Targeting the Corticospinal Tract in Neonatal Rats with a Double-Viral Vector using Combined Brain and Spine Surgery. J Vis Exp. 2021;: pubmed publisher
Comeras L, Hörmer N, Mohan Bethuraj P, Tasan R. NPY Released From GABA Neurons of the Dentate Gyrus Specially Reduces Contextual Fear Without Affecting Cued or Trace Fear. Front Synaptic Neurosci. 2021;13:635726 pubmed publisher
Liu S, Kim D, Oh T, Pao G, Kim J, Palmiter R, et al. Neural basis of opioid-induced respiratory depression and its rescue. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Devienne G, Picaud S, Cohen I, Piquet J, Tricoire L, Testa D, et al. Regulation of perineuronal nets in the adult cortex by the activity of the cortical network. J Neurosci. 2021;: pubmed publisher
Siemian J, Arenivar M, Sarsfield S, Borja C, Erbaugh L, Eagle A, et al. An excitatory lateral hypothalamic circuit orchestrating pain behaviors in mice. elife. 2021;10: pubmed publisher
Cleary C, Milla B, Kuo F, James S, Flynn W, Robson P, et al. Somatostatin-expressing parafacial neurons are CO2/H+ sensitive and regulate baseline breathing. elife. 2021;10: pubmed publisher
Horii Hayashi N, Nishi M. Protocol for behavioral tests using chemogenetically manipulated mice. STAR Protoc. 2021;2:100418 pubmed publisher
Picard A, Metref S, Tarussio D, Dolci W, Berney X, Croizier S, et al. Fgf15 Neurons of the Dorsomedial Hypothalamus Control Glucagon Secretion and Hepatic Gluconeogenesis. Diabetes. 2021;70:1443-1457 pubmed publisher
Nagaoka K, Nagashima T, Asaoka N, Yamamoto H, Toda C, Kayanuma G, et al. Striatal TRPV1 activation by acetaminophen ameliorates dopamine D2 receptor antagonist-induced orofacial dyskinesia. JCI Insight. 2021;6: pubmed publisher
Chen J, Markowitz J, Lilascharoen V, Taylor S, Sheurpukdi P, Keller J, et al. Flexible scaling and persistence of social vocal communication. Nature. 2021;593:108-113 pubmed publisher
Achilly N, Wang W, Zoghbi H. Presymptomatic training mitigates functional deficits in a mouse model of Rett syndrome. Nature. 2021;592:596-600 pubmed publisher
Ding G, Li X, Hou X, Zhou W, Gong Y, Liu F, et al. REV-ERB in GABAergic neurons controls diurnal hepatic insulin sensitivity. Nature. 2021;592:763-767 pubmed publisher
Dieterich A, Floeder J, Stech K, Lee J, Srivastava P, Barker D, et al. Activation of Basolateral Amygdala to Nucleus Accumbens Projection Neurons Attenuates Chronic Corticosterone-Induced Behavioral Deficits in Male Mice. Front Behav Neurosci. 2021;15:643272 pubmed publisher
Wang R, Guo H, Jiang S, Liu Z, Qu W, Huang Z, et al. Control of wakefulness by lateral hypothalamic glutamatergic neurons in male mice. J Neurosci Res. 2021;99:1689-1703 pubmed publisher
Cai Y, Nielsen B, Boxer E, Aoto J, Ford C. Loss of nigral excitation of cholinergic interneurons contributes to parkinsonian motor impairments. Neuron. 2021;109:1137-1149.e5 pubmed publisher
Kato Y, Katsumata H, Inutsuka A, Yamanaka A, Onaka T, Minami S, et al. Involvement of MCH-oxytocin neural relay within the hypothalamus in murine nursing behavior. Sci Rep. 2021;11:3348 pubmed publisher
Eisdorfer J, Phelan M, Keefe K, Rollins M, Campion T, Rauscher K, et al. Addition of angled rungs to the horizontal ladder walking task for more sensitive probing of sensorimotor changes. PLoS ONE. 2021;16:e0246298 pubmed publisher
Brommer B, He M, Zhang Z, Yang Z, Page J, Su J, et al. Improving hindlimb locomotor function by Non-invasive AAV-mediated manipulations of propriospinal neurons in mice with complete spinal cord injury. Nat Commun. 2021;12:781 pubmed publisher
Botterill J, Vinod K, Gerencer K, Teixeira C, Lafrancois J, Scharfman H. Bidirectional regulation of cognitive and anxiety-like behaviors by dentate gyrus mossy cells in male and female mice. J Neurosci. 2021;: pubmed publisher
Houtz J, Liao G, An J, Xu B. Discrete TrkB-expressing neurons of the dorsomedial hypothalamus regulate feeding and thermogenesis. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Borodovitsyna O, Duffy B, Pickering A, Chandler D. Anatomically and functionally distinct locus coeruleus efferents mediate opposing effects on anxiety-like behavior. Neurobiol Stress. 2020;13:100284 pubmed publisher
Zhang Z, Reis F, He Y, Park J, DiVittorio J, Sivakumar N, et al. Estrogen-sensitive medial preoptic area neurons coordinate torpor in mice. Nat Commun. 2020;11:6378 pubmed publisher
Zhang J, Chen D, Sweeney P, Yang Y. An excitatory ventromedial hypothalamus to paraventricular thalamus circuit that suppresses food intake. Nat Commun. 2020;11:6326 pubmed publisher
Zhang C, Kaye J, Cai Z, Wang Y, Prescott S, Liberles S. Area Postrema Cell Types that Mediate Nausea-Associated Behaviors. Neuron. 2021;109:461-472.e5 pubmed publisher
Tabarean I. Activation of Preoptic Arginine Vasopressin Neurons Induces Hyperthermia in Male Mice. Endocrinology. 2021;162: pubmed publisher
Weera M, Shackett R, Kramer H, Middleton J, Gilpin N. Central Amygdala Projections to Lateral Hypothalamus Mediate Avoidance Behavior in Rats. J Neurosci. 2021;41:61-72 pubmed publisher
Strong C, Hagarty D, Brea Guerrero A, Schoepfer K, Cajuste S, Kabbaj M. Chemogenetic selective manipulation of nucleus accumbens medium spiny neurons bidirectionally controls alcohol intake in male and female rats. Sci Rep. 2020;10:19178 pubmed publisher
Sans Dublanc A, Razzauti A, Desikan S, Pascual M, Monyer H, Sindreu C. Septal GABAergic inputs to CA1 govern contextual memory retrieval. Sci Adv. 2020;6: pubmed publisher
Shrestha P, Shan Z, Mamcarz M, Ruiz K, Zerihoun A, Juan C, et al. Amygdala inhibitory neurons as loci for translation in emotional memories. Nature. 2020;586:407-411 pubmed publisher
Han L, Wu K, Kwan P, Chua O, Shum D, Chan Y. 5-HT1A receptor-mediated attenuation of synaptic transmission in rat medial vestibular nucleus impacts on vestibular-related motor function. J Physiol. 2021;599:253-267 pubmed publisher
Jiang Y, Travagli R. Hypothalamic-vagal oxytocinergic neurocircuitry modulates gastric emptying and motility following stress. J Physiol. 2020;598:4941-4955 pubmed publisher
Kim B, Im H. Chronic nicotine impairs sparse motor learning via striatal fast-spiking parvalbumin interneurons. Addict Biol. 2020;:e12956 pubmed publisher
Nahar L, Grant C, Hewett C, Cortes D, Reker A, Kang S, et al. Regulation of Pv-specific interneurons in the medial prefrontal cortex and reward-seeking behaviors. J Neurochem. 2021;156:212-224 pubmed publisher
Falcy B, Mohr M, Micevych P. Immunohistochemical amplification of mCherry fusion protein is necessary for proper visualization. MethodsX. 2020;7:100946 pubmed publisher
Yu X, Ba W, Zhao G, Ma Y, Harding E, Yin L, et al. Dysfunction of ventral tegmental area GABA neurons causes mania-like behavior. Mol Psychiatry. 2020;: pubmed publisher
Avila C, Kucinski A, Sarter M. Complex movement control in a rat model of Parkinsonian falls: bidirectional control by striatal cholinergic interneurons. J Neurosci. 2020;: pubmed publisher
Hrvatin S, Sun S, Wilcox O, Yao H, Lavin Peter A, Cicconet M, et al. Neurons that regulate mouse torpor. Nature. 2020;583:115-121 pubmed publisher
Poll S, Mittag M, Musacchio F, Justus L, Giovannetti E, Steffen J, et al. Memory trace interference impairs recall in a mouse model of Alzheimer's disease. Nat Neurosci. 2020;: pubmed publisher
Nagai Y, Takayama K, Nishitani N, Andoh C, Koda M, Shirakawa H, et al. The Role of Dorsal Raphe Serotonin Neurons in the Balance between Reward and Aversion. Int J Mol Sci. 2020;21: pubmed publisher
Guerin K, Rego M, Bourges D, Ersing I, Haery L, Harten DeMaio K, et al. A Novel Next-Generation Sequencing and Analysis Platform to Assess the Identity of Recombinant Adeno-Associated Viral Preparations from Viral DNA Extracts. Hum Gene Ther. 2020;31:664-678 pubmed publisher
Chang R, Hernandez J, Gastelum C, Guadagno K, Perez L, Wagner E. Pituitary Adenylate Cyclase Activating Polypeptide Excites Proopiomelanocortin Neurons: Implications for the Regulation of Energy Homeostasis. Neuroendocrinology. 2020;: pubmed publisher
Sharma P, Wells L, Rizzo G, Elson J, Passchier J, Rabiner E, et al. DREADD Activation of Pedunculopontine Cholinergic Neurons Reverses Motor Deficits and Restores Striatal Dopamine Signaling in Parkinsonian Rats. Neurotherapeutics. 2020;17:1120-1141 pubmed publisher
Lee Y, Han N, Kim W, Kim J, Lee I, Choi S, et al. Dynamic Changes in the Bridging Collaterals of the Basal Ganglia Circuitry Control Stress-Related Behaviors in Mice. Mol Cells. 2020;43:360-372 pubmed publisher
Kim D, Jang S, Kim J, Park I, Ku K, Choi M, et al. Kisspeptin neuron-specific and self-sustained calcium oscillation in the hypothalamic arcuate nucleus of neonatal mice: Regulatory factors of its synchronization. Neuroendocrinology. 2020;: pubmed publisher
Swiecicki J, Santana J, Imperiali B. A Strategic Approach for Fluorescence Imaging of Membrane Proteins in a Native-like Environment. Cell Chem Biol. 2019;: pubmed publisher
Botterill J, Lu Y, Lafrancois J, Bernstein H, Alcantara Gonzalez D, Jain S, et al. An Excitatory and Epileptogenic Effect of Dentate Gyrus Mossy Cells in a Mouse Model of Epilepsy. Cell Rep. 2019;29:2875-2889.e6 pubmed publisher
Hu F, Kamigaki T, Zhang Z, Zhang S, Dan U, Dan Y. Prefrontal Corticotectal Neurons Enhance Visual Processing through the Superior Colliculus and Pulvinar Thalamus. Neuron. 2019;104:1141-1152.e4 pubmed publisher
Souza G, Stornetta R, Stornetta D, Abbott S, Guyenet P. Contribution of the Retrotrapezoid Nucleus and Carotid Bodies to Hypercapnia- and Hypoxia-induced Arousal from Sleep. J Neurosci. 2019;39:9725-9737 pubmed publisher
Torre Muruzabal T, Devoght J, Van den Haute C, Brône B, Van der Perren A, Baekelandt V. Chronic nigral neuromodulation aggravates behavioral deficits and synaptic changes in an α-synuclein based rat model for Parkinson's disease. Acta Neuropathol Commun. 2019;7:160 pubmed publisher
Liu Y, Ying Y, Li Y, Eyo U, Chen T, Zheng J, et al. Neuronal network activity controls microglial process surveillance in awake mice via norepinephrine signaling. Nat Neurosci. 2019;22:1771-1781 pubmed publisher
Bonaventura J, Eldridge M, Hu F, Gomez J, Sánchez Soto M, Abramyan A, et al. High-potency ligands for DREADD imaging and activation in rodents and monkeys. Nat Commun. 2019;10:4627 pubmed publisher
Kayyal H, Yiannakas A, Kolatt Chandran S, Khamaisy M, Sharma V, Rosenblum K. Activity of Insula to Basolateral Amygdala Projecting Neurons is Necessary and Sufficient for Taste Valence Representation. J Neurosci. 2019;39:9369-9382 pubmed publisher
Pomrenze M, Giovanetti S, Maiya R, Gordon A, Kreeger L, Messing R. Dissecting the Roles of GABA and Neuropeptides from Rat Central Amygdala CRF Neurons in Anxiety and Fear Learning. Cell Rep. 2019;29:13-21.e4 pubmed publisher
Bavley C, Fetcho R, Burgdorf C, Walsh A, Fischer D, Hall B, et al. Cocaine- and stress-primed reinstatement of drug-associated memories elicit differential behavioral and frontostriatal circuit activity patterns via recruitment of L-type Ca2+ channels. Mol Psychiatry. 2019;: pubmed publisher
Adriaenssens A, Biggs E, Darwish T, Tadross J, Sukthankar T, Girish M, et al. Glucose-Dependent Insulinotropic Polypeptide Receptor-Expressing Cells in the Hypothalamus Regulate Food Intake. Cell Metab. 2019;30:987-996.e6 pubmed publisher
Bäck S, Dossat A, Parkkinen I, Koivula P, Airavaara M, Richie C, et al. Neuronal Activation Stimulates Cytomegalovirus Promoter-Driven Transgene Expression. Mol Ther Methods Clin Dev. 2019;14:180-188 pubmed publisher
Parker K, Pedersen C, Gomez A, Spangler S, Walicki M, Feng S, et al. A Paranigral VTA Nociceptin Circuit that Constrains Motivation for Reward. Cell. 2019;178:653-671.e19 pubmed publisher
Hao S, Yang H, Wang X, He Y, Xu H, Wu X, et al. The Lateral Hypothalamic and BNST GABAergic Projections to the Anterior Ventrolateral Periaqueductal Gray Regulate Feeding. Cell Rep. 2019;28:616-624.e5 pubmed publisher
Tschida K, Michael V, Takato J, Han B, Zhao S, Sakurai K, et al. A Specialized Neural Circuit Gates Social Vocalizations in the Mouse. Neuron. 2019;: pubmed publisher
Ip C, Zhang L, Farzi A, Qi Y, Clarke I, Reed F, et al. Amygdala NPY Circuits Promote the Development of Accelerated Obesity under Chronic Stress Conditions. Cell Metab. 2019;: pubmed publisher
Li M, Madara J, Steger J, Krashes M, Balthasar N, Campbell J, et al. The Paraventricular Hypothalamus Regulates Satiety and Prevents Obesity via Two Genetically Distinct Circuits. Neuron. 2019;102:653-667.e6 pubmed publisher
Fergani C, Leon S, Padilla S, Verstegen A, Palmiter R, Navarro V. NKB signaling in the posterodorsal medial amygdala stimulates gonadotropin release in a kisspeptin-independent manner in female mice. elife. 2018;7: pubmed publisher
Li C, Navarrete J, Liang Guallpa J, Lu C, Funderburk S, Chang R, et al. Defined Paraventricular Hypothalamic Populations Exhibit Differential Responses to Food Contingent on Caloric State. Cell Metab. 2019;29:681-694.e5 pubmed publisher
Goldstein N, Levine B, Loy K, Duke W, Meyerson O, Jamnik A, et al. Hypothalamic Neurons that Regulate Feeding Can Influence Sleep/Wake States Based on Homeostatic Need. Curr Biol. 2018;: pubmed publisher
Chen J, Campos C, Jarvie B, Palmiter R. Parabrachial CGRP Neurons Establish and Sustain Aversive Taste Memories. Neuron. 2018;100:891-899.e5 pubmed publisher
Călin A, Stancu M, Zagrean A, Jefferys J, Ilie A, Akerman C. Chemogenetic Recruitment of Specific Interneurons Suppresses Seizure Activity. Front Cell Neurosci. 2018;12:293 pubmed publisher
Alpar A, Zahola P, Hanics J, Hevesi Z, Korchynska S, Benevento M, et al. Hypothalamic CNTF volume transmission shapes cortical noradrenergic excitability upon acute stress. EMBO J. 2018;37: pubmed publisher
Wang L, Chen S, Ma H, Chen H, Hittelman W, Pan H. Regulating nociceptive transmission by VGluT2-expressing spinal dorsal horn neurons. J Neurochem. 2018;147:526-540 pubmed publisher
Farzi A, Lau J, Ip C, Qi Y, Shi Y, Zhang L, et al. Arcuate nucleus and lateral hypothalamic CART neurons in the mouse brain exert opposing effects on energy expenditure. elife. 2018;7: pubmed publisher
Harding E, Yu X, Miao A, Andrews N, Ma Y, Ye Z, et al. A Neuronal Hub Binding Sleep Initiation and Body Cooling in Response to a Warm External Stimulus. Curr Biol. 2018;28:2263-2273.e4 pubmed publisher
Tanner L, Goglia A, Wei M, Sehgal T, Parsons L, Park J, et al. Four Key Steps Control Glycolytic Flux in Mammalian Cells. Cell Syst. 2018;7:49-62.e8 pubmed publisher
Noble E, Hahn J, Konanur V, Hsu T, Page S, Cortella A, et al. Control of Feeding Behavior by Cerebral Ventricular Volume Transmission of Melanin-Concentrating Hormone. Cell Metab. 2018;28:55-68.e7 pubmed publisher
Wong F, Bercsényi K, Sreenivasan V, Portalés A, Fernández Otero M, Marin O. Pyramidal cell regulation of interneuron survival sculpts cortical networks. Nature. 2018;557:668-673 pubmed publisher
Haenraets K, Albisetti G, Foster E, Wildner H. Adeno-associated Virus-mediated Transgene Expression in Genetically Defined Neurons of the Spinal Cord. J Vis Exp. 2018;: pubmed publisher
Johnson B, Vanblargan L, Xu W, White J, Shan C, Shi P, et al. Human IFIT3 Modulates IFIT1 RNA Binding Specificity and Protein Stability. Immunity. 2018;48:487-499.e5 pubmed publisher
Gelegen C, Miracca G, Ran M, Harding E, Ye Z, Yu X, et al. Excitatory Pathways from the Lateral Habenula Enable Propofol-Induced Sedation. Curr Biol. 2018;28:580-587.e5 pubmed publisher
Yoshimura M, Nishimura K, Nishimura H, Sonoda S, Ueno H, Motojima Y, et al. Activation of endogenous arginine vasopressin neurons inhibit food intake: by using a novel transgenic rat line with DREADDs system. Sci Rep. 2017;7:15728 pubmed publisher
Resch J, Fenselau H, Madara J, Wu C, Campbell J, Lyubetskaya A, et al. Aldosterone-Sensing Neurons in the NTS Exhibit State-Dependent Pacemaker Activity and Drive Sodium Appetite via Synergy with Angiotensin II Signaling. Neuron. 2017;96:190-206.e7 pubmed publisher
Essner R, Smith A, Jamnik A, Ryba A, Trutner Z, CARTER M. AgRP Neurons Can Increase Food Intake during Conditions of Appetite Suppression and Inhibit Anorexigenic Parabrachial Neurons. J Neurosci. 2017;37:8678-8687 pubmed publisher
Ahmadiantehrani S, London S. A reliable and flexible gene manipulation strategy in posthatch zebra finch brain. Sci Rep. 2017;7:43244 pubmed publisher
Dimidschstein J, Chen Q, Tremblay R, Rogers S, Saldi G, Guo L, et al. A viral strategy for targeting and manipulating interneurons across vertebrate species. Nat Neurosci. 2016;19:1743-1749 pubmed publisher
Inutsuka A, Yamashita A, Chowdhury S, Nakai J, Ohkura M, Taguchi T, et al. The integrative role of orexin/hypocretin neurons in nociceptive perception and analgesic regulation. Sci Rep. 2016;6:29480 pubmed publisher
Yu X, Ye Z, Houston C, Zecharia A, Ma Y, Zhang Z, et al. Wakefulness Is Governed by GABA and Histamine Cotransmission. Neuron. 2015;87:164-78 pubmed publisher
Zhang Z, Ferretti V, Güntan Ä, Moro A, Steinberg E, Ye Z, et al. Neuronal ensembles sufficient for recovery sleep and the sedative actions of α2 adrenergic agonists. Nat Neurosci. 2015;18:553-561 pubmed publisher
Inutsuka A, Inui A, Tabuchi S, Tsunematsu T, Lazarus M, Yamanaka A. Concurrent and robust regulation of feeding behaviors and metabolism by orexin neurons. Neuropharmacology. 2014;85:451-60 pubmed publisher
Krashes M, Koda S, Ye C, Rogan S, Adams A, Cusher D, et al. Rapid, reversible activation of AgRP neurons drives feeding behavior in mice. J Clin Invest. 2011;121:1424-8 pubmed publisher
product information
Catalog Number :
44361
Product Name :
pAAV-hSyn-DIO-hM3D(Gq)-mCherry
article :
doi10.1172/JCI46229
id6474
pubmed_id21364278
bacterial resistance :
Ampicillin
cloning :
backbonepAAV
backbone_mutation
backbone_origin
backbone_size4824
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
AAV
Other
Adeno Associated Viral Vector
growth notes :
These plasmids were generated as part of the Illuminating the Druggable Genome (IDG) program sponsored by the NIH Common Fund. The goal of this program is to identify, gather, and distribute information and resources for proteins that currently are not well-studied yet belong to commonly drug-targeted protein families: protein kinases, non-olfactory G-protein coupled receptors (GPCRs), and ion channels. The IDG program is designed to develop fundamental research tools for understudied proteins, elucidate their function, and disseminate the IDG-related resources and data to the greater scientific community.
growth strain :
Double floxed Gq-coupled hM3D DREADD fused with mCherry under the control of human synapsin promoter.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3Nhe I
cloning_site_5Asc I
promoterhuman Synapsin 1
sequencing_primer_3GCATTAAAGCAGCGTATCCACATAGC
sequencing_primer_5tcgtgtcgtgcctgagagcg
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namehM3D(Gq)-mCherry
shRNA_sequence
size2502
species
9606
Homo sapiens
tags
locationC terminal on insert
tagmCherry
resistance markers :
1493
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA