This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
tetO-ALN
catalog :
43918
citations: 2
Reference |
---|
product information
Catalog Number :
43918
Product Name :
tetO-ALN
article :
doi | 10.1371/journal.pone.0028719 |
id | 6382 |
pubmed_id | 22174877 |
bacterial resistance :
Ampicillin
cloning :
backbone | FU-tetO-Gateway | ||||
backbone_mutation | |||||
backbone_origin | Addgene plasmid 43914 | ||||
backbone_size | 8600 | ||||
promoter | |||||
sequencing_primer_3 | |||||
sequencing_primer_5 | |||||
vector_types |
|
growth notes :
CTCTGCCAAG; ASCL1-REV: CATCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCACC GGATCCGAACCAGTTGGTGAAGTC; LMX1B-FWD: CTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCC GGGCCTATGTTGGACGGCATCAAG; LMX1B-REV: ACGTCACCGCATGTTAGAAGACTTCCTCTGCCCTCTCCGG ATCCGGAGGCGAAGTAGGAACT; NURR1-FWD: GAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGG CCCTATGCCTTGTGTTCAGGCG; B2-NURR1-REV: GGGGaccactttgtacaagaaagctgggt[A]GAAAGGTAAAGTGTCCAG (extra [A] added to maintain reading frame with C-terminal V5-tag). The 3 ORFs were then joined via recombinant PCR such that viral 2A peptide sequences separate the three genes, using B1-ASCL1-FWD and B2-NURR1-REV. A glycine-serine-glycine (GSG) linker was included upstream of each 2A sequence to facilitate protein cleavage. The ASCL1-P2A-LMX1B-T2A-NURR1(ALN) cassette was cloned into pDONR221, and subsequently cloned into FU-tetO-Gateway via Gateway recombination to produce the tetO-ALN vector. Cleavage at 2A sites was verified by performing in vitro transcription and translation using the TnT T7 Coupled Reticulocyte Lysate System (Promega L4610) in the presence of biotinylated lysine (Promega L5061). 5 L of each TnT-generated protein sample was resolved via PAGE, transferred to PVDF membrane, incubated with streptavidin-conjugated horseradish peroxidase (Cell Signaling Technology 3999, 1:2000), and detected with ECL Plus (GE Healthcare RPN2132).
GGGGacaagtttgtacaaaaaagcaggctACCATGGAAA
G
To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway (Addgene plasmid #43914). Open reading frames of human ASCL1, LMX1B, and NURR1 were purchased from Open Biosystems and amplified using the following PCR primers: B1-ASCL1-FWD:
GGGGacaagtttgtacaaaaaagcaggctACCATGGAAA
G
To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway (Addgene plasmid #43914). Open reading frames of human ASCL1, LMX1B, and NURR1 were purchased from Open Biosystems and amplified using the following PCR primers: B1-ASCL1-FWD:
growth temp :
Use recA cells, such as STBL3 (Invitrogen)
origin :
37
pi :
|
plasmid copy :
ASCL1, LMX1B, and NURR1 ORF cDNAs purchased from Open Biosystems (Now part of Thermo Scientific, Waltham, MA)
resistance markers :
1466 |
tags :
High Copy
terms :
Other |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments