This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pX330-U6-Chimeric_BB-CBh-hSpCas9
catalog :
42230
citations: 1358
Reference
Feng Y, Zhao M, Wang L, Li L, Lei J, Zhou J, et al. The heterogeneity of signaling pathways and drug responses in intrahepatic cholangiocarcinoma with distinct genetic mutations. Cell Death Dis. 2024;15:34 pubmed publisher
Yu C, Yeung T, Fu W, Poon R. BCL-XL regulates the timing of mitotic apoptosis independently of BCL2 and MCL1 compensation. Cell Death Dis. 2024;15:2 pubmed publisher
Inklaar M, de Jong R, Bekkering E, Nagaoka H, Fennemann F, Teelen K, et al. Pfs230 Domain 7 is targeted by a potent malaria transmission-blocking monoclonal antibody. NPJ Vaccines. 2023;8:186 pubmed publisher
Nakade K, Tsukamoto S, Nakashima K, An Y, Sato I, Li J, et al. Efficient selection of knocked-in pluripotent stem cells using a dual cassette cellular elimination system. Cell Rep Methods. 2023;3:100662 pubmed publisher
Ali R, Alhaj Sulaiman A, Memon B, Pradhan S, Algethami M, Aouida M, et al. Altered Regulation of the Glucose Transporter GLUT3 in PRDX1 Null Cells Caused Hypersensitivity to Arsenite. Cells. 2023;12: pubmed publisher
Ando R, Shimozono S, Ago H, Takagi M, Sugiyama M, Kurokawa H, et al. StayGold variants for molecular fusion and membrane-targeting applications. Nat Methods. 2023;: pubmed publisher
Lai F, Li L, Hu X, Liu B, Zhu Z, Liu L, et al. NR5A2 connects zygotic genome activation to the first lineage segregation in totipotent embryos. Cell Res. 2023;33:952-966 pubmed publisher
Zhang W, Golynker I, Brosh R, Fajardo A, Zhu Y, Wudzinska A, et al. Mouse genome rewriting and tailoring of three important disease loci. Nature. 2023;623:423-431 pubmed publisher
Meyer K, Lammers N, Bugaj L, Garcia H, Weiner O. Optogenetic control of YAP reveals a dynamic communication code for stem cell fate and proliferation. Nat Commun. 2023;14:6929 pubmed publisher
Velusamy T, Singh N, Croft S, Smith S, Tscharke D. The expression and function of HSV ICP47 and its promoter in mice. J Virol. 2023;97:e0110723 pubmed publisher
Zhao Z, D Oliveira Albanus R, Taylor H, Tang X, Han Y, Orchard P, et al. An integrative single-cell multi-omics profiling of human pancreatic islets identifies T1D associated genes and regulatory signals. Res Sq. 2023;: pubmed publisher
Kefala Stavridi A, Gontier A, Morin V, Frit P, Ropars V, Barboule N, et al. Structural and functional basis of inositol hexaphosphate stimulation of NHEJ through stabilization of Ku-XLF interaction. Nucleic Acids Res. 2023;51:11732-11747 pubmed publisher
Harris M, Marr M. The intrinsically disordered region of eIF5B stimulates IRES usage and nucleates biological granule formation. Cell Rep. 2023;42:113283 pubmed publisher
P xe1 nek J, Roithov xe1 A, Radivojevi x107 N, S xfd kora M, Prusty A, Huston N, et al. The SMN complex drives structural changes in human snRNAs to enable snRNP assembly. Nat Commun. 2023;14:6580 pubmed publisher
Martin de Fourchambault E, Callens N, Saliou J, Fourcot M, Delos O, Barois N, et al. Hepatitis C virus alters the morphology and function of peroxisomes. Front Microbiol. 2023;14:1254728 pubmed publisher
Yang X, Forr xf3 C, Li T, Miura Y, Zaluska T, Tsai C, et al. Kirigami electronics for long-term electrophysiological recording of human neural organoids and assembloids. bioRxiv. 2023;: pubmed publisher
Meng X, Yao D, Imaizumi K, Chen X, Kelley K, Reis N, et al. Assembloid CRISPR screens reveal impact of disease genes in human neurodevelopment. Nature. 2023;622:359-366 pubmed publisher
Serrano Lorenzo P, Gobelli D, Garrido Moraga R, Esteban Amo M, L xf3 pez L xf3 pez J, Ordu xf1 a A, et al. Development of a novel in vitro model to study the modulatory role of the respiratory complex I in macrophage effector functions. PLoS ONE. 2023;18:e0291442 pubmed publisher
Kulcs xe1 r P, T xe1 las A, Ligeti Z, T xf3 th E, Rakv xe1 cs Z, Bartos Z, et al. A cleavage rule for selection of increased-fidelity SpCas9 variants with high efficiency and no detectable off-targets. Nat Commun. 2023;14:5746 pubmed publisher
Tomita A, Sasanuma H, Owa T, Nakazawa Y, Shimada M, Fukuoka T, et al. Inducing multiple nicks promotes interhomolog homologous recombination to correct heterozygous mutations in somatic cells. Nat Commun. 2023;14:5607 pubmed publisher
Maresca M, van den Brand T, Li H, Teunissen H, Davies J, de Wit E. Pioneer activity distinguishes activating from non-activating SOX2 binding sites. EMBO J. 2023;42:e113150 pubmed publisher
Chen Y, Saito D, Suzuki T, Takemoto T. An inducible germ cell ablation chicken model for high-grade germline chimeras. Development. 2023;150: pubmed publisher
Lv X, Xiao W, Lai Y, Zhang Z, Zhang H, Qiu C, et al. The non-redundant functions of PIWI family proteins in gametogenesis in golden hamsters. Nat Commun. 2023;14:5267 pubmed publisher
Nguyen L, Xu Y, Nair M, Bordey A. The mTOR pathway genes mTOR, Rheb, Depdc5, Pten, and Tsc1 have convergent and divergent impacts on cortical neuron development and function. bioRxiv. 2023;: pubmed publisher
Scaramuzza S, Jones R, Sadurni M, Reynolds Winczura A, Poovathumkadavil D, Farrell A, et al. TRAIP resolves DNA replication-transcription conflicts during the S-phase of unperturbed cells. Nat Commun. 2023;14:5071 pubmed publisher
Cao F, Deliz Aguirre R, Gerpott F, Ziska E, Taylor M. Myddosome clustering in IL-1 receptor signaling regulates the formation of an NF-kB activating signalosome. EMBO Rep. 2023;24:e57233 pubmed publisher
Zou K, Wang F, Zhang Z, Zhou Y, Li P, Wang D, et al. Optimized CRISPR/Cas9 system for gene knockout in chicken DF1 cells. Poult Sci. 2023;102:102970 pubmed publisher
Li X, Chen P, Ji J, Duan Q, Cao J, Huang R, et al. Rhox6 regulates the expression of distinct target genes to mediate mouse PGCLC formation and ESC self-renewal. Cell Biosci. 2023;13:145 pubmed publisher
Rakotomamonjy J, Rylaarsdam L, Fares Taie L, McDermott S, Davies D, Yang G, et al. PCDH12 loss results in premature neuronal differentiation and impeded migration in a cortical organoid model. Cell Rep. 2023;42:112845 pubmed publisher
Schubert L, Le A, Hinz T, Navarro A, Nelson Taylor S, Nemenoff R, et al. A Functional sgRNA-CRISPR screening method for generating murine RET and NTRK1 rearranged oncogenes. Biol Open. 2023;: pubmed publisher
Ji S, Chen F, Stein P, Wang J, Zhou Z, Wang L, et al. OBOX regulates murine zygotic genome activation and early development. Nature. 2023;: pubmed publisher
Ohkawa Y, Kanto N, Nakano M, Fujinawa R, Kizuka Y, Johnson E, et al. Involvement of langerin in the protective function of a keratan sulfate-based disaccharide in an emphysema mouse model. J Biol Chem. 2023;:105052 pubmed publisher
Liu X, Zhuang Y, Huang W, Wu Z, Chen Y, Shan Q, et al. Interventional hydrogel microsphere vaccine as an immune amplifier for activated antitumour immunity after ablation therapy. Nat Commun. 2023;14:4106 pubmed publisher
Coppola V, Marino I, Warnken U, Falchi M, Pasquini L, Biffoni M, et al. The autophagic protein FYCO1 controls TNFRSF10/TRAIL receptor induced apoptosis and is inactivated by CASP8 (caspase 8). Autophagy. 2023;:1-19 pubmed publisher
Tanaka Y, Morozumi A, Hirokawa N. Nodal flow transfers polycystin to determine mouse left-right asymmetry. Dev Cell. 2023;: pubmed publisher
Griffin M, Thompson J, Xiao Y, Sweredoski M, Aksenfeld R, Jensen E, et al. Functional glycoproteomics by integrated network assembly and partitioning. bioRxiv. 2023;: pubmed publisher
Schmolka N, Karemaker I, Cardoso da Silva R, Recchia D, Spegg V, Bhaskaran J, et al. Dissecting the roles of MBD2 isoforms and domains in regulating NuRD complex function during cellular differentiation. Nat Commun. 2023;14:3848 pubmed publisher
Shih J, Sarmashghi S, Zhakula Kostadinova N, Zhang S, Georgis Y, Hoyt S, et al. Cancer aneuploidies are shaped primarily by effects on tumour fitness. Nature. 2023;619:793-800 pubmed publisher
Streb P, Kowarz E, Benz T, Reis J, Marschalek R. How chromosomal translocations arise to cause cancer: Gene proximity, trans-splicing, and DNA end joining. iScience. 2023;26:106900 pubmed publisher
Cuevas Oca xf1 a S, Yang J, Aushev M, Schlossmacher G, Bear C, Hannan N, et al. A Cell-Based Optimised Approach for Rapid and Efficient Gene Editing of Human Pluripotent Stem Cells. Int J Mol Sci. 2023;24: pubmed publisher
Steinberger S, Adler J, Shaul Y. Method of Monitoring 26S Proteasome in Cells Revealed the Crucial Role of PSMA3 C-Terminus in 26S Integrity. Biomolecules. 2023;13: pubmed publisher
Ohira T, Yoshimura K, Kugoh H. Human artificial chromosome carrying 3p21.3-p22.2 region suppresses hTERT transcription in oral cancer cells. Chromosome Res. 2023;31:17 pubmed publisher
Guo L, Salian S, Xue J, Rath N, Rousseau J, Kim H, et al. Null and missense mutations of ERI1 cause a recessive phenotypic dichotomy in humans. Am J Hum Genet. 2023;110:1068-1085 pubmed publisher
Zhang K, Chen L, Wang B, Chen D, Ye X, Han X, et al. Mitochondrial supercomplex assembly regulates metabolic features and glutamine dependency in mammalian cells. Theranostics. 2023;13:3165-3187 pubmed publisher
Matsuzaki H, Takahashi T, Kuramochi D, Hirakawa K, Tanimoto K. Five nucleotides found in RCTG motifs are essential for post-fertilization methylation imprinting of the H19 ICR in YAC transgenic mice. Nucleic Acids Res. 2023;: pubmed publisher
Zhu C, Soto Feliciano Y, Morris J, Huang C, Koche R, Ho Y, et al. MLL3 regulates the CDKN2A tumor suppressor locus in liver cancer. elife. 2023;12: pubmed publisher
Couto J, Vulin M, Jehanno C, Coissieux M, Hamelin B, Schmidt A, et al. Nicotinamide N-methyltransferase sustains a core epigenetic program that promotes metastatic colonization in breast cancer. EMBO J. 2023;42:e112559 pubmed publisher
Kong N, Chan Y. Protocol for biallelic tagging of an endogenous gene using CRISPR-Cas9 in human cells. STAR Protoc. 2023;4:102286 pubmed publisher
Branch M, Hsu C, Ohnishi K, Shen W, Lee E, Meisenhelder J, et al. MAP4K3 inhibits Sirtuin-1 to repress the LKB1-AMPK pathway to promote amino acid-dependent activation of the mTORC1 complex. Life Sci Alliance. 2023;6: pubmed publisher
Ali T, Rogala S, Krause N, Bains J, Melissari M, W xe4 hrisch S, et al. Fendrr synergizes with Wnt signalling to regulate fibrosis related genes during lung development via its RNA:dsDNA triplex element. Nucleic Acids Res. 2023;51:6227-6237 pubmed publisher
Mao Z, Nakamura F. Interaction of LARP4 to filamin A mechanosensing domain regulates cell migrations. Front Cell Dev Biol. 2023;11:1152109 pubmed publisher
Lyu M, Li F, Wang X, Xu K, Sun S. miR-145 Modulates Fatty Acid Metabolism by Targeting FOXO1 to Affect SERBP1 Activity in Bovine Mammary Epithelial Cells. J Agric Food Chem. 2023;71:7440-7450 pubmed publisher
Dailey Krempel B, Martin A, Jo H, Junge H, Chen Z. A tug of war between DCC and ROBO1 signaling during commissural axon guidance. Cell Rep. 2023;42:112455 pubmed publisher
Yi J, Lei X, Guo F, Chen Q, Chen X, Zhao K, et al. Co-delivery of Cas9 mRNA and guide RNAs edits hepatitis B virus episomal and integration DNA in mouse and tree shrew models. Antiviral Res. 2023;215:105618 pubmed publisher
Ide A, Deluca K, Wiggan O, Markus S, DeLuca J. The role of kinetochore dynein in checkpoint silencing is restricted to disassembly of the corona. Mol Biol Cell. 2023;34:ar76 pubmed publisher
Muranaka M, Takamatsu S, Ouchida T, Kanazawa Y, Kondo J, Nakagawa T, et al. Vesicular Integral-Membrane Protein 36 Is Involved in the Selective Secretion of Fucosylated Proteins into Bile Duct-like Structures in HepG2 Cells. Int J Mol Sci. 2023;24: pubmed publisher
Okuyama K, Nomura A, Nishino K, Tanaka H, Harly C, Chihara R, et al. The Majority of the Serine/Threonine Phosphorylation Sites in Bcl11b Protein Are Dispensable for the Differentiation of T Cells. J Immunol. 2023;210:1728-1739 pubmed publisher
Schubert L, Le A, Hinz T, Navarro A, Nelson Taylor S, Nemenoff R, et al. A Rapid, Functional sgRNA Screening Method for Generating Murine RET and NTRK1 Fusion Oncogenes. bioRxiv. 2023;: pubmed publisher
Cherney R, Mills C, Herring L, Braceros A, Calabrese J. A monoclonal antibody raised against human EZH2 cross-reacts with the RNA-binding protein SAFB. bioRxiv. 2023;: pubmed publisher
Ma H, Hu T, Tao W, Tong J, Han Z, Herndler Brandstetter D, et al. A lncRNA from an inflammatory bowel disease risk locus maintains intestinal host-commensal homeostasis. Cell Res. 2023;33:372-388 pubmed publisher
Jia J, Tang S, Yue X, Jing S, Zhu L, Tan C, et al. An A-kinase anchoring protein (ACBD3) coordinates traffic-induced PKA activation at the Golgi. J Biol Chem. 2023;299:104696 pubmed publisher
Ochoa M, Sanchez Gregorio S, de Andrea C, Garasa S, Alvarez M, Olivera I, et al. Synergistic effects of combined immunotherapy strategies in a model of multifocal hepatocellular carcinoma. Cell Rep Med. 2023;4:101009 pubmed publisher
Xu L, Xiang Y, Hu J. Molecular basis of Climp63-mediated ER lumen spacing. J Cell Sci. 2023;136: pubmed publisher
Sa R, Ma J, Yang J, Li D, Du J, Jia J, et al. High TXNIP expression accelerates the migration and invasion of the GDM placenta trophoblast. BMC Pregnancy Childbirth. 2023;23:235 pubmed publisher
Barghouth P, Melemenidis S, Montay Gruel P, Ollivier J, Viswanathan V, Jorge P, et al. FLASH-RT does not affect chromosome translocations and junction structures beyond that of CONV-RT dose-rates. bioRxiv. 2023;: pubmed publisher
Xu C, Zhang C, Liu Y, Ma H, Wu F, Jia Y, et al. Amniogenesis in Human Amniotic Sac Embryoids after Exposures to Organophosphate Flame Retardants. Environ Health Perspect. 2023;131:47007 pubmed publisher
Gehlen Breitbach S, Schmid T, Fr xf6 b F, Rodrian G, Weider M, Wegner M, et al. The Tip60/Ep400 chromatin remodeling complex impacts basic cellular functions in cranial neural crest-derived tissue during early orofacial development. Int J Oral Sci. 2023;15:16 pubmed publisher
Ping W, Sheng Y, Hu G, Zhong H, Li Y, Liu Y, et al. RBBP4 is an epigenetic barrier for the induced transition of pluripotent stem cells into totipotent 2C-like cells. Nucleic Acids Res. 2023;51:5414-5431 pubmed publisher
Krausov xe1 M, Kreplov xe1 M, Banik P, Cva x10d kov xe1 Z, Kubov x10d iak J, Modr xe1 k M, et al. Retinitis pigmentosa-associated mutations in mouse Prpf8 cause misexpression of circRNAs and degeneration of cerebellar granule cells. Life Sci Alliance. 2023;6: pubmed publisher
Suk T, Nguyen T, Fisk Z, Mitkovski M, Geertsma H, Parmasad J, et al. Characterizing the differential distribution and targets of Sumo1 and Sumo2 in the mouse brain. iScience. 2023;26:106350 pubmed publisher
Ruminski K, Celis Gutierrez J, Jarmuzynski N, Maturin E, Audebert S, Malissen M, et al. Mapping the SLP76 interactome in T cells lacking each of the GRB2-family adaptors reveals molecular plasticity of the TCR signaling pathway. Front Immunol. 2023;14:1139123 pubmed publisher
Watanabe K, Oka T, Takagi H, Anisimov S, Yamashita S, Katsuragi Y, et al. Myeloid-associated differentiation marker is an essential host factor for human parechovirus PeV-A3 entry. Nat Commun. 2023;14:1817 pubmed publisher
Gleneadie H, Fernández Ruiz B, Sardini A, Van de Pette M, Dimond A, Prinjha R, et al. Endogenous bioluminescent reporters reveal a sustained increase in utrophin gene expression upon EZH2 and ERK1/2 inhibition. Commun Biol. 2023;6:318 pubmed publisher
Guo X, Geng L, Jiang C, Yao W, Jin J, Liu Z, et al. Multiplexed genome engineering for porcine fetal fibroblasts with gRNA-tRNA arrays based on CRISPR/Cas9. Anim Biotechnol. 2023;:1-10 pubmed publisher
Kawano S, Araki K, Bai J, Furukawa I, Tateishi K, Yoshinobu K, et al. A gain-of-function mutation in microRNA 142 is sufficient to cause the development of T-cell leukemia in mice. Cancer Sci. 2023;114:2821-2834 pubmed publisher
Choong C, Aguirre C, Kakuda K, Beck G, Nakanishi H, Kimura Y, et al. Phosphatidylinositol-3,4,5-trisphosphate interacts with alpha-synuclein and initiates its aggregation and formation of Parkinson's disease-related fibril polymorphism. Acta Neuropathol. 2023;145:573-595 pubmed publisher
Pedrazzoli E, Bianchi A, Umbach A, Amistadi S, Brusson M, Frati G, et al. An optimized SpCas9 high-fidelity variant for direct protein delivery. Mol Ther. 2023;31:2257-2265 pubmed publisher
Kim H, Park H, Schulz E, Azuma Y, Azuma M. EWSR1 prevents the induction of aneuploidy through direct regulation of Aurora B. Front Cell Dev Biol. 2023;11:987153 pubmed publisher
Walter M, Mayr F, Hanna B, Cookson V, Mortusewicz O, Helleday T, et al. NUDT22 promotes cancer growth through pyrimidine salvage. Oncogene. 2023;42:1282-1293 pubmed publisher
Sakashita A, Kitano T, Ishizu H, Guo Y, Masuda H, Ariura M, et al. Transcription of MERVL retrotransposons is required for preimplantation embryo development. Nat Genet. 2023;55:484-495 pubmed publisher
Erbs V, Lorentz R, Eisenman B, Schaeffer L, Luppi L, Lindner L, et al. Increased On-Target Rate and Risk of Concatemerization after CRISPR-Enhanced Targeting in ES Cells. Genes (Basel). 2023;14: pubmed publisher
Walsh R, Giacomelli E, Ciceri G, Rittenhouse C, Galimberti M, Wu Y, et al. Generation of human cerebral organoids with a structured outer subventricular zone. bioRxiv. 2023;: pubmed publisher
Shono M, Kishimoto K, Hikabe O, Hayashi M, Semi K, Takashima Y, et al. Induction of primordial germ cell-like cells from common marmoset embryonic stem cells by inhibition of WNT and retinoic acid signaling. Sci Rep. 2023;13:3186 pubmed publisher
Pierson Smela M, Kramme C, Fortuna P, Adams J, Su R, Dong E, et al. Directed differentiation of human iPSCs to functional ovarian granulosa-like cells via transcription factor overexpression. elife. 2023;12: pubmed publisher
Tsukita K, Kitamata M, Kashihara H, Yano T, Fujiwara I, Day T, et al. Phase separation of an actin nucleator by junctional microtubules regulates epithelial function. Sci Adv. 2023;9:eadf6358 pubmed publisher
Johnson T, Fettweis G, Wagh K, Almeida Prieto B, Krishnamurthy M, Upadhyaya A, et al. The Glucocorticoid Receptor is Required for Efficient Aldosterone-Induced Transcription by the Mineralocorticoid Receptor. bioRxiv. 2023;: pubmed publisher
Jin D, Chen X, Liu Y, Williams C, Pedersen L, Stafford D, et al. A genome-wide CRISPR-Cas9 knockout screen identifies FSP1 as the warfarin-resistant vitamin K reductase. Nat Commun. 2023;14:828 pubmed publisher
Wu W, Barwacz S, Bhowmick R, Lundgaard K, Gon xe7 alves Dinis M, Clausen M, et al. Mitotic DNA synthesis in response to replication stress requires the sequential action of DNA polymerases zeta and delta in human cells. Nat Commun. 2023;14:706 pubmed publisher
Kim J, Kwon C, Nakamura K, Muromachi N, Mori H, Muroi S, et al. Increased angiotensin II coupled with decreased Adra1a expression enhances cardiac hypertrophy in pregnancy-associated hypertensive mice. J Biol Chem. 2023;299:102964 pubmed publisher
Li Y, Lian D, Wang J, Zhao Y, Li Y, Liu G, et al. MDM2 antagonists promote CRISPR/Cas9-mediated precise genome editing in sheep primary cells. Mol Ther Nucleic Acids. 2023;31:309-323 pubmed publisher
Badenes M, Burbridge E, Oikonomidi I, Amin A, de Carvalho x, Kosack L, et al. The ADAM17 sheddase complex regulator iTAP/Frmd8 modulates inflammation and tumor growth. Life Sci Alliance. 2023;6: pubmed publisher
Kong N, Liu Z, Chan Y. RIF1 suppresses the formation of single-stranded ultrafine anaphase bridges via protein phosphatase 1. Cell Rep. 2023;42:112032 pubmed publisher
Ng L, Ma H, Poon R. Cyclin A-CDK1 suppresses the expression of the CDK1 activator CDC25A to safeguard timely mitotic entry. J Biol Chem. 2023;299:102957 pubmed publisher
Rakotomamonjy J, Rylaarsdam L, Fares Taie L, McDermott S, Davies D, Yang G, et al. Impaired migration and premature differentiation underlie the neurological phenotype associated with PCDH12 loss of function. bioRxiv. 2023;: pubmed publisher
Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Mol Biotechnol. 2023;: pubmed publisher
Itah Z, Chaudhry S, Raju Ponny S, Aydemir O, Lee A, Cavanagh Kyros J, et al. HER2-driven breast cancer suppression by the JNK signaling pathway. Proc Natl Acad Sci U S A. 2023;120:e2218373120 pubmed publisher
Mattis K, Krentz N, Metzendorf C, Abaitua F, Spigelman A, Sun H, et al. Loss of RREB1 in pancreatic beta cells reduces cellular insulin content and affects endocrine cell gene expression. Diabetologia. 2023;66:674-694 pubmed publisher
Lambing S, Tan Y, Vasileiadou P, Holdenrieder S, M xfc ller P, Hagen C, et al. RIG-I immunotherapy overcomes radioresistance in p53-positive malignant melanoma. J Mol Cell Biol. 2023;: pubmed publisher
Li J, Dong J, Wang W, Yu D, Fan X, Hui Y, et al. The human pre-replication complex is an open complex. Cell. 2023;186:98-111.e21 pubmed publisher
Schmidt K, Leisegang M, Kloetzel P. ERAP2 supports TCR recognition of three immunotherapy targeted tumor epitopes. Mol Immunol. 2023;154:61-68 pubmed publisher
Chung H, Lee J, Kim T, Kim S, Park K, Kim M, et al. ZNF212 promotes genomic integrity through direct interaction with TRAIP. Nucleic Acids Res. 2023;51:631-649 pubmed publisher
Mahadevan J, Jha A, Rudolph J, Bowerman S, Narducci D, Hansen A, et al. Dynamics of endogenous PARP1 and PARP2 during DNA damage revealed by live-cell single-molecule imaging. iScience. 2023;26:105779 pubmed publisher
Liu C, Imai M, Edahiro Y, Mano S, Takei H, Nudejima M, et al. Establishment of isogenic induced pluripotent stem cells with or without pathogenic mutation for understanding the pathogenesis of myeloproliferative neoplasms. Exp Hematol. 2023;118:12-20 pubmed publisher
Clava xed n L, Fern xe1 ndez Pisonero I, Movilla N, Lorenzo Mart xed n L, Nieto B, Abad A, et al. Characterization of mutant versions of the R-RAS2/TC21 GTPase found in tumors. Oncogene. 2023;42:389-405 pubmed publisher
Fiesel F, Fri x10d ov xe1 D, Hayes C, Coban M, Hudec R, Bredenberg J, et al. Substitution of PINK1 Gly411 modulates substrate receptivity and turnover. Autophagy. 2023;19:1711-1732 pubmed publisher
Zhang Z, Venditti R, Ran L, Liu Z, Vivot K, Sch xfc rmann A, et al. Distinct changes in endosomal composition promote NLRP3 inflammasome activation. Nat Immunol. 2023;24:30-41 pubmed publisher
Watanabe T, Sanada Y, Hattori Y, Suzuki M. Correlation between the expression of LAT1 in cancer cells and the potential efficacy of boron neutron capture therapy. J Radiat Res. 2023;64:91-98 pubmed publisher
Liu Z, Zhang M, Huang P, Ji Z, Qi C, Jiao S, et al. Generation of APN-chimeric gene-edited pigs by CRISPR/Cas9-mediated knock-in strategy. Gene. 2023;851:147007 pubmed publisher
Leong E, Khaing N, Cadot B, Hong W, Kozlov S, Werner H, et al. Nesprin-1 LINC complexes recruit microtubule cytoskeleton proteins and drive pathology in Lmna-mutant striated muscle. Hum Mol Genet. 2023;32:177-191 pubmed publisher
S xf6 llner J, Sake H, Frenzel A, Lechler R, Herrmann D, Fuchs W, et al. In vitro genome editing activity of Cas9 in somatic cells after random and transposon-based genomic Cas9 integration. PLoS ONE. 2022;17:e0279123 pubmed publisher
Ishimura R, El Gowily A, Noshiro D, Komatsu Hirota S, Ono Y, Shindo M, et al. The UFM1 system regulates ER-phagy through the ufmylation of CYB5R3. Nat Commun. 2022;13:7857 pubmed publisher
Chen X, Tang A, Tober J, Yang J, Leu N, Sterling S, et al. Mouse placenta fetal macrophages arise from endothelial cells outside the placenta. Dev Cell. 2022;57:2652-2660.e3 pubmed publisher
Tiyaboonchai A, Vonada A, Posey J, Pelz C, Wakefield L, Grompe M. Self-cleaving guide RNAs enable pharmacological selection of precise gene editing events in vivo. Nat Commun. 2022;13:7391 pubmed publisher
Iyer A, Hosamani I, Nguyen J, Cai T, Singh S, McGovern M, et al. Cellular reprogramming with ATOH1, GFI1, and POU4F3 implicate epigenetic changes and cell-cell signaling as obstacles to hair cell regeneration in mature mammals. elife. 2022;11: pubmed publisher
He X, Zhang Z, Xue J, Wang Y, Zhang S, Wei J, et al. Low-dose AAV-CRISPR-mediated liver-specific knock-in restored hemostasis in neonatal hemophilia B mice with subtle antibody response. Nat Commun. 2022;13:7275 pubmed publisher
Yang Y, Li D, Wan F, Chen B, Wu G, Li F, et al. Identification and Analysis of Small Molecule Inhibitors of CRISPR-Cas9 in Human Cells. Cells. 2022;11: pubmed publisher
Dong B, Hiasa M, Higa Y, Ohnishi Y, Endo I, Kondo T, et al. Osteoblast/osteocyte-derived interleukin-11 regulates osteogenesis and systemic adipogenesis. Nat Commun. 2022;13:7194 pubmed publisher
Lim D, Zhou Q, Cox K, Law B, Lee M, Kokkonda P, et al. A general approach to identify cell-permeable and synthetic anti-CRISPR small molecules. Nat Cell Biol. 2022;24:1766-1775 pubmed publisher
Zou X, Ouyang H, Lin F, Zhang H, Yang Y, Pang D, et al. MYBPC3 deficiency in cardiac fibroblasts drives their activation and contributes to fibrosis. Cell Death Dis. 2022;13:948 pubmed publisher
Hu S, Metcalf E, Mahat D, Chan L, Sohal N, Chakraborty M, et al. Transcription factor antagonism regulates heterogeneity in embryonic stem cell states. Mol Cell. 2022;82:4410-4427.e12 pubmed publisher
Zou X, Yang Y, Lin F, Chen J, Zhang H, Li L, et al. Lactate facilitates classical swine fever virus replication by enhancing cholesterol biosynthesis. iScience. 2022;25:105353 pubmed publisher
Li Z, Fang F, Long Y, Zhao Q, Wang X, Ye Z, et al. The balance between NANOG and SOX17 mediated by TET proteins regulates specification of human primordial germ cell fate. Cell Biosci. 2022;12:181 pubmed publisher
Wang Y, Poon R. MARCH5 regulates mitotic apoptosis through MCL1-dependent and independent mechanisms. Cell Death Differ. 2022;: pubmed publisher
Tabata H, Sasaki M, Agetsuma M, Sano H, Hirota Y, Miyajima M, et al. Erratic and blood vessel-guided migration of astrocyte progenitors in the cerebral cortex. Nat Commun. 2022;13:6571 pubmed publisher
Xu Y, Kuppe C, Perales Pat xf3 n J, Hayat S, Kranz J, Abdallah A, et al. Adult human kidney organoids originate from CD24+ cells and represent an advanced model for adult polycystic kidney disease. Nat Genet. 2022;54:1690-1701 pubmed publisher
Li M, Zhong A, Wu Y, Sidharta M, Beaury M, Zhao X, et al. Transient inhibition of p53 enhances prime editing and cytosine base-editing efficiencies in human pluripotent stem cells. Nat Commun. 2022;13:6354 pubmed publisher
Br xfc ggenthies J, Fiore A, Russier M, Bitsina C, Br xf6 tzmann J, Kordes S, et al. A cell-based chemical-genetic screen for amino acid stress response inhibitors reveals torins reverse stress kinase GCN2 signaling. J Biol Chem. 2022;298:102629 pubmed publisher
Ishibashi R, Maki R, Kitano S, Miyachi H, Toyoshima F. Development of an in vivo cleavable donor plasmid for targeted transgene integration by CRISPR-Cas9 and CRISPR-Cas12a. Sci Rep. 2022;12:17775 pubmed publisher
Chen W, Gaidukov L, Lai Y, Wu M, Cao J, Gutbrod M, et al. A synthetic transcription platform for programmable gene expression in mammalian cells. Nat Commun. 2022;13:6167 pubmed publisher
Levesque S, Mayorga D, Fiset J, Goupil C, Duringer A, Loiselle A, et al. Marker-free co-selection for successive rounds of prime editing in human cells. Nat Commun. 2022;13:5909 pubmed publisher
Han Y, Tan L, Zhou T, Yang L, Carrau L, Lacko L, et al. A human iPSC-array-based GWAS identifies a virus susceptibility locus in the NDUFA4 gene and functional variants. Cell Stem Cell. 2022;29:1475-1490.e6 pubmed publisher
Merle N, Elmsh xe4 user S, Strassheimer F, Wanzel M, K xf6 nig A, Funk J, et al. Monitoring autochthonous lung tumors induced by somatic CRISPR gene editing in mice using a secreted luciferase. Mol Cancer. 2022;21:191 pubmed publisher
Javaid N, Choi S. An Alternate Approach to Generate Induced Pluripotent Stem Cells with Precise CRISPR/Cas9 Tool. Stem Cells Int. 2022;2022:4537335 pubmed publisher
Grimm E, van der Hoeven F, Sardella D, Willig K, Engel U, Veits N, et al. A Clathrin light chain A reporter mouse for in vivo imaging of endocytosis. PLoS ONE. 2022;17:e0273660 pubmed publisher
Mori H, Connell J, Donahue C, Boytz R, Nguyen Y, Leung D, et al. CAPG Is Required for Ebola Virus Infection by Controlling Virus Egress from Infected Cells. Viruses. 2022;14: pubmed publisher
Umbach A, Maule G, Kheir E, Cutarelli A, Foglia M, Guarrera L, et al. Generation of corrected hiPSC clones from a Cornelia de Lange Syndrome (CdLS) patient through CRISPR-Cas-based technology. Stem Cell Res Ther. 2022;13:440 pubmed publisher
Mahoney Sanchez L, Bouchaoui H, Boussaad I, Jonneaux A, Timmerman K, Berdeaux O, et al. Alpha synuclein determines ferroptosis sensitivity in dopaminergic neurons via modulation of ether-phospholipid membrane composition. Cell Rep. 2022;40:111231 pubmed publisher
Rodrigues A, Slembrouck Brec A, Nanteau C, Terray A, Tymoshenko Y, Zagar Y, et al. Modeling PRPF31 retinitis pigmentosa using retinal pigment epithelium and organoids combined with gene augmentation rescue. NPJ Regen Med. 2022;7:39 pubmed publisher
van Elsas M, van der Schoot J, Bartels A, Steuten K, van Dalen D, Wijfjes Z, et al. Regulatory T Cell Depletion Using a CRISPR Fc-Optimized CD25 Antibody. Int J Mol Sci. 2022;23: pubmed publisher
Patron M, Tarasenko D, Nolte H, Kroczek L, Ghosh M, Ohba Y, et al. Regulation of mitochondrial proteostasis by the proton gradient. EMBO J. 2022;41:e110476 pubmed publisher
Zou X, Lin F, Yang Y, Chen J, Zhang H, Li L, et al. Cholesterol Biosynthesis Modulates CSFV Replication. Viruses. 2022;14: pubmed publisher
Garc xed a Fern xe1 ndez A, Vivo Llorca G, Sancho M, Garc xed a Jare xf1 o A, Ram xed rez Jim xe9 nez L, Barber Cano E, et al. Nanodevices for the Efficient Codelivery of CRISPR-Cas9 Editing Machinery and an Entrapped Cargo: A Proposal for Dual Anti-Inflammatory Therapy. Pharmaceutics. 2022;14: pubmed publisher
Liu X, Dong J, Liao J, Tian L, Qiu H, Wu T, et al. Establishment of CRISPR/Cas9 Genome-Editing System Based on Dual sgRNAs in Flammulina filiformis. J Fungi (Basel). 2022;8: pubmed publisher
Kozhukhar N, Spadafora D, Rodriguez Y, Alexeyev M. A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Cells. 2022;11: pubmed publisher
Arguello A, Li A, Sun X, Eggert T, Mairhofer E, Kleiner R. Reactivity-dependent profiling of RNA 5-methylcytidine dioxygenases. Nat Commun. 2022;13:4176 pubmed publisher
So K, Huang Y, Zhang S, Qiao Y, He L, Li Y, et al. seRNA PAM controls skeletal muscle satellite cell proliferation and aging through trans regulation of Timp2 expression synergistically with Ddx5. Aging Cell. 2022;21:e13673 pubmed publisher
Liu L, Zou L, Li K, Hou H, Hu Q, Liu S, et al. Template-independent genome editing in the Pcdh15av-3j mouse, a model of human DFNB23 nonsyndromic deafness. Cell Rep. 2022;40:111061 pubmed publisher
Lin X, Swedlund B, Ton M, Ghazanfar S, Guibentif C, Paulissen C, et al. Mesp1 controls the chromatin and enhancer landscapes essential for spatiotemporal patterning of early cardiovascular progenitors. Nat Cell Biol. 2022;24:1114-1128 pubmed publisher
Gao Z, Ravendran S, Mikkelsen N, Haldrup J, Cai H, Ding X, et al. A truncated reverse transcriptase enhances prime editing by split AAV vectors. Mol Ther. 2022;: pubmed publisher
Kim P, Park J, Lee D, Mizuno S, Shinohara M, Hong C, et al. Mast4 determines the cell fate of MSCs for bone and cartilage development. Nat Commun. 2022;13:3960 pubmed publisher
Li J, Wu X, Ke J, Lee M, Lan Q, Li J, et al. TET1 dioxygenase is required for FOXA2-associated chromatin remodeling in pancreatic beta-cell differentiation. Nat Commun. 2022;13:3907 pubmed publisher
Kragness S, Clark Z, Mullin A, Guidry J, Earls L. An Rtn4/Nogo-A-interacting micropeptide modulates synaptic plasticity with age. PLoS ONE. 2022;17:e0269404 pubmed publisher
Hoye M, Calviello L, Poff A, Ejimogu N, Newman C, Montgomery M, et al. Aberrant cortical development is driven by impaired cell cycle and translational control in a DDX3X syndrome model. elife. 2022;11: pubmed publisher
Cisneros Aguirre M, Lopezcolorado F, Tsai L, Bhargava R, Stark J. The importance of DNAPKcs for blunt DNA end joining is magnified when XLF is weakened. Nat Commun. 2022;13:3662 pubmed publisher
Lau C, Huang S, Lam R, Tin C. PAM-flexible dual base editor-mediated random mutagenesis and self-activation strategies to improve CRISPRa potency. Mol Ther Methods Clin Dev. 2022;26:26-37 pubmed publisher
Lainšček D, Forstnerič V, Mikolič V, Malenšek Š, Pečan P, Bencina M, et al. Coiled-coil heterodimer-based recruitment of an exonuclease to CRISPR/Cas for enhanced gene editing. Nat Commun. 2022;13:3604 pubmed publisher
Li Z, Bowers E, Zhu J, Yu H, Hardij J, Bagchi D, et al. Lipolysis of bone marrow adipocytes is required to fuel bone and the marrow niche during energy deficits. elife. 2022;11: pubmed publisher
Huang Y, Wu C, Chang C, Huang S, Kuo H, Shih H. Reciprocal regulation of Daxx and PIK3CA promotes colorectal cancer cell growth. Cell Mol Life Sci. 2022;79:367 pubmed publisher
BOLT C, Lopez Delisle L, Hintermann A, Mascrez B, Rauseo A, Andrey G, et al. Context-dependent enhancer function revealed by targeted inter-TAD relocation. Nat Commun. 2022;13:3488 pubmed publisher
Yang H, Wei Y, Zhang Q, Yang Y, Bi X, Yang L, et al. CRISPR/Cas9‑induced saturated mutagenesis identifies Rad51 haplotype as a marker of PARP inhibitor sensitivity in breast cancer. Mol Med Rep. 2022;26: pubmed publisher
Li Y, Li J, Wang J, Zhang S, Giles K, Prakash T, et al. Premature transcription termination at the expanded GAA repeats and aberrant alternative polyadenylation contributes to the Frataxin transcriptional deficit in Friedreich's ataxia. Hum Mol Genet. 2022;: pubmed publisher
Liu J, Verma P. Generating a Heat-Tolerance Mouse Model. Methods Mol Biol. 2022;2495:259-272 pubmed publisher
Gerlach P, Garland W, Lingaraju M, Salerno Kochan A, Bonneau F, Basquin J, et al. Structure and regulation of the nuclear exosome targeting complex guides RNA substrates to the exosome. Mol Cell. 2022;82:2505-2518.e7 pubmed publisher
Xiong Y, Zhuang R, Zhao G, Liu Y, Su Y, Wang W, et al. Identification of the CKM Gene as a Potential Muscle-Specific Safe Harbor Locus in Pig Genome. Genes (Basel). 2022;13: pubmed publisher
Wilson E, Mao T, Zhong H. Labeling Endogenous Proteins Using CRISPR-mediated Insertion of Exon (CRISPIE). Bio Protoc. 2022;12:e4343 pubmed publisher
Thomas A, Rehfeld F, Zhang H, Chang T, Goodarzi M, Gillet F, et al. RBM33 directs the nuclear export of transcripts containing GC-rich elements. Genes Dev. 2022;36:550-565 pubmed publisher
Suzuki T, Tatsukawa T, Sudo G, Delandre C, Pai Y, Miyamoto H, et al. CUX2 deficiency causes facilitation of excitatory synaptic transmission onto hippocampus and increased seizure susceptibility to kainate. Sci Rep. 2022;12:6505 pubmed publisher
Ye J, Xi H, Chen Y, Chen Q, Lu X, Lv J, et al. Can SpRY recognize any PAM in human cells?. J Zhejiang Univ Sci B. 2022;23:382-391 pubmed publisher
Kojima S, Shiochi N, Sato K, Yamaura M, Ito T, Yamamura N, et al. Epigenome editing reveals core DNA methylation for imprinting control in the Dlk1-Dio3 imprinted domain. Nucleic Acids Res. 2022;50:5080-5094 pubmed publisher
Kasu Y, Arva A, Johnson J, Sajan C, Manzano J, Hennes A, et al. BAG6 prevents the aggregation of neurodegeneration-associated fragments of TDP43. iScience. 2022;25:104273 pubmed publisher
Marzano F, Liccardo D, Elia A, Mucio I, de Lucia C, Lucchese A, et al. Genetic Catalytic Inactivation of GRK5 Impairs Cardiac Function in Mice Via Dysregulated P53 Levels. JACC Basic Transl Sci. 2022;7:366-380 pubmed publisher
Bodai Z, Bishop A, Gantz V, Komor A. Targeting double-strand break indel byproducts with secondary guide RNAs improves Cas9 HDR-mediated genome editing efficiencies. Nat Commun. 2022;13:2351 pubmed publisher
Taylor J, Walton J, McCann K, Norvelle A, Liu Q, Vander Velden J, et al. CRISPR-Cas9 editing of the arginine-vasopressin V1a receptor produces paradoxical changes in social behavior in Syrian hamsters. Proc Natl Acad Sci U S A. 2022;119:e2121037119 pubmed publisher
Ford M, Yamanaka Y. Reprogramming Mouse Oviduct Epithelial Cells Using In Vivo Electroporation and CRISPR/Cas9-Mediated Genetic Manipulation. Methods Mol Biol. 2022;2429:367-377 pubmed publisher
Matsuo M, Ueno T, Monde K, Sugata K, Tan B, Rahman A, et al. Identification and characterization of a novel enhancer in the HTLV-1 proviral genome. Nat Commun. 2022;13:2405 pubmed publisher
Yi Z, Arvola R, Myers S, Dilsavor C, Abu Alhasan R, Carter B, et al. Mammalian UPF3A and UPF3B can activate nonsense-mediated mRNA decay independently of their exon junction complex binding. EMBO J. 2022;41:e109202 pubmed publisher
Nelson J, Thin M, Evan T, Howell S, Wu M, Almeida B, et al. USP25 promotes pathological HIF-1-driven metabolic reprogramming and is a potential therapeutic target in pancreatic cancer. Nat Commun. 2022;13:2070 pubmed publisher
Balasubramanian S, Andreani M, Andrade J, Saha T, Sundaravinayagam D, Garz xf3 n J, et al. Protection of nascent DNA at stalled replication forks is mediated by phosphorylation of RIF1 intrinsically disordered region. elife. 2022;11: pubmed publisher
Huguet F, Gokan E, Foster H, Amin H, Vagnarelli P. Repo-Man/protein phosphatase 1 SUMOylation mediates binding to lamin A and serine 22 dephosphorylation. Open Biol. 2022;12:220017 pubmed publisher
Aksenova V, Arnaoutov A, Dasso M. Analysis of Nucleoporin Function Using Inducible Degron Techniques. Methods Mol Biol. 2022;2502:129-150 pubmed publisher
Fessler E, Krumwiede L, Jae L. DELE1 tracks perturbed protein import and processing in human mitochondria. Nat Commun. 2022;13:1853 pubmed publisher
Scheller S, Rashad Y, Saleh F, Willingham K, Reilich A, Lin D, et al. Biallelic, Selectable, Knock-in Targeting of CCR5 via CRISPR-Cas9 Mediated Homology Directed Repair Inhibits HIV-1 Replication. Front Immunol. 2022;13:821190 pubmed publisher
Shalaby K, Aouida M, Gupta V, Ghanem S, El Agnaf O. Rapid Assessment of CRISPR Transfection Efficiency and Enrichment of CRISPR Induced Mutations Using a Dual-Fluorescent Stable Reporter System. Front Genome Ed. 2022;4:854866 pubmed publisher
Klugmann M, Kalotay E, Delerue F, Ittner L, Bongers A, Yu J, et al. Developmental delay and late onset HBSL pathology in hypomorphic Dars1M256L mice. Neurochem Res. 2022;47:1972-1984 pubmed publisher
Basello D, Matera A, Stanek D. A point mutation in human coilin prevents Cajal body formation. J Cell Sci. 2022;135: pubmed publisher
Thumberger T, Tavhelidse Suck T, Gutierrez Triana J, Cornean A, Medert R, Welz B, et al. Boosting targeted genome editing using the hei-tag. elife. 2022;11: pubmed publisher
Higa T, Okita Y, Matsumoto A, Nakayama S, Oka T, Sugahara O, et al. Spatiotemporal reprogramming of differentiated cells underlies regeneration and neoplasia in the intestinal epithelium. Nat Commun. 2022;13:1500 pubmed publisher
Aouida M, Aljogol D, Ali R, Ramotar D. A simple protocol to isolate a single human cell PRDX1 knockout generated by CRISPR-Cas9 system. STAR Protoc. 2022;3:101216 pubmed publisher
Yin J, Lu R, Xin C, Wang Y, Ling X, Li D, et al. Cas9 exo-endonuclease eliminates chromosomal translocations during genome editing. Nat Commun. 2022;13:1204 pubmed publisher
Wei Y, Yang C, Zhao Z. Viable offspring derived from single unfertilized mammalian oocytes. Proc Natl Acad Sci U S A. 2022;119:e2115248119 pubmed publisher
Ishihara S, Sato T, Fujikado N, Miyazaki H, Yoshimoto T, Yamamoto H, et al. Rap1 prevents colitogenic Th17 cell expansion and facilitates Treg cell differentiation and distal TCR signaling. Commun Biol. 2022;5:206 pubmed publisher
Tang Z, Hegde S, Zhao J, Zhu S, Johnson K, Lorson C, et al. CRISPR-Mediated Enzyme Fragment Complementation Assay for Quantification of the Stability of Splice Isoforms. Chembiochem. 2022;23:e202200012 pubmed publisher
Donovan E, Avila C, Klausner S, Parikh V, Fenollar Ferrer C, Blakely R, et al. Disrupted Choline Clearance and Sustained Acetylcholine Release In Vivo by a Common Choline Transporter Coding Variant Associated with Poor Attentional Control in Humans. J Neurosci. 2022;42:3426-3444 pubmed publisher
Liu Y, Yang Y, Suo Y, Li C, Chen M, Zheng S, et al. Inducible caspase-9 suicide gene under control of endogenous oct4 to safeguard mouse and human pluripotent stem cell therapy. Mol Ther Methods Clin Dev. 2022;24:332-341 pubmed publisher
Miller H, Tam T, Ralston K. Entamoeba histolytica Develops Resistance to Complement Deposition and Lysis after Acquisition of Human Complement-Regulatory Proteins through Trogocytosis. MBio. 2022;13:e0316321 pubmed publisher
Wu B, Yee M, Goldstein R, Kinchington P. Antiviral Targeting of Varicella Zoster Virus Replication and Neuronal Reactivation Using CRISPR/Cas9 Cleavage of the Duplicated Open Reading Frames 62/71. Viruses. 2022;14: pubmed publisher
Chen Y, Jiang Y, Lao J, Zhou Y, Su L, Huang X. Characterization and Functional Study of FAM49B Reveals Its Effect on Cell Proliferation in HEK293T Cells. Genes (Basel). 2022;13: pubmed publisher
Jiao S, Bai C, Qi C, Wu H, Hu L, Li F, et al. Identification and Functional Analysis of the Regulatory Elements in the pHSPA6 Promoter. Genes (Basel). 2022;13: pubmed publisher
Li Z, Kanazashi H, Tokashiki Y, Fujikawa R, Okagaki A, Katoh S, et al. TTR exon-humanized mouse optimal for verifying new therapies for FAP. Biochem Biophys Res Commun. 2022;599:69-74 pubmed publisher
Takenoshita Y, Hara M, Fukagawa T. Recruitment of two Ndc80 complexes via the CENP-T pathway is sufficient for kinetochore functions. Nat Commun. 2022;13:851 pubmed publisher
LaForce G, Farr J, Liu J, Akesson C, Gumus E, Pinkard O, et al. Suppression of premature transcription termination leads to reduced mRNA isoform diversity and neurodegeneration. Neuron. 2022;110:1340-1357.e7 pubmed publisher
Siladi A, Wang J, Florian A, Thomas L, Creighton J, Matlock B, et al. WIN site inhibition disrupts a subset of WDR5 function. Sci Rep. 2022;12:1848 pubmed publisher
Czarnek M, Stalinska K, Sarad K, Bereta J. shRNAs targeting mouse Adam10 diminish cell response to proinflammatory stimuli independently of Adam10 silencing. Biol Open. 2022;11: pubmed publisher
Elfrink S, ter Beest M, Janssen L, Baltissen M, Jansen P, Kenyon A, et al. IRF8 is a transcriptional activator of CD37 expression in diffuse large B-cell lymphoma. Blood Adv. 2022;6:2254-2266 pubmed publisher
Hota S, Rao K, Blair A, Khalilimeybodi A, Hu K, Thomas R, et al. Brahma safeguards canalization of cardiac mesoderm differentiation. Nature. 2022;602:129-134 pubmed publisher
Hindul N, Jhita A, Oprea D, Hussain T, Gonchar O, Campillo M, et al. Construction of a human hTERT RPE-1 cell line with inducible Cre for editing of endogenous genes. Biol Open. 2022;11: pubmed publisher
Cao H, Vu G, Gailing O. From Genome Sequencing to CRISPR-Based Genome Editing for Climate-Resilient Forest Trees. Int J Mol Sci. 2022;23: pubmed publisher
Zhang J, Li Y, Liu H, Zhang J, Wang J, Xia J, et al. Genome-wide CRISPR/Cas9 library screen identifies PCMT1 as a critical driver of ovarian cancer metastasis. J Exp Clin Cancer Res. 2022;41:24 pubmed publisher
Kolbrink B, Riebeling T, Teiwes N, Steinem C, Kalbacher H, Kunzendorf U, et al. TAT-RHIM: a more complex issue than expected. Biochem J. 2022;: pubmed publisher
Das S, Kuzin V, Cameron D, Sanford S, Jha R, Nie Z, et al. MYC assembles and stimulates topoisomerases 1 and 2 in a "topoisome". Mol Cell. 2022;82:140-158.e12 pubmed publisher
Chang L, Masada M, Kojima M, Yamamoto N. Involvement of Denervated Midbrain-Derived Factors in the Formation of Ectopic Cortico-Mesencephalic Projection after Hemispherectomy. J Neurosci. 2022;42:749-761 pubmed publisher
Tanaka K, Kandori S, Sakka S, Nitta S, Tanuma K, Shiga M, et al. ELOVL2 promotes cancer progression by inhibiting cell apoptosis in renal cell carcinoma. Oncol Rep. 2022;47: pubmed publisher
Francis C, Wroblewska L, Pegman P, Amiji M. Systemic biodistribution and hepatocyte-specific gene editing with CRISPR/Cas9 using hyaluronic acid-based nanoparticles. Nanomedicine. 2022;40:102488 pubmed publisher
Ou T, He W, Quinlan B, Guo Y, Tran M, Karunadharma P, et al. Reprogramming of the heavy-chain CDR3 regions of a human antibody repertoire. Mol Ther. 2022;30:184-197 pubmed publisher
Klanova M, Kazantsev D, Pokorna E, Zikmund T, Karolova J, Behounek M, et al. Anti-apoptotic MCL1 Protein Represents Critical Survival Molecule for Most Burkitt Lymphomas and BCL2-negative Diffuse Large B-cell Lymphomas. Mol Cancer Ther. 2022;21:89-99 pubmed publisher
Nishimura K, Fukagawa T. A Simple Method that Combines CRISPR and AID to Quickly Generate Conditional Knockouts for Essential Genes in Various Vertebrate Cell Lines. Methods Mol Biol. 2022;2377:109-122 pubmed publisher
Leon F, Seshacharyulu P, Nimmakayala R, Chugh S, Karmakar S, Nallasamy P, et al. Reduction in O-glycome induces differentially glycosylated CD44 to promote stemness and metastasis in pancreatic cancer. Oncogene. 2022;41:57-71 pubmed publisher
Rogava M, Braun A, van der Sluis T, Shridhar N, Tüting T, Gaffal E. Tumor cell intrinsic Toll-like receptor 4 signaling promotes melanoma progression and metastatic dissemination. Int J Cancer. 2022;150:142-151 pubmed publisher
Chang L, Li M, Shao S, Li C, Ai S, Xue B, et al. Nuclear peripheral chromatin-lamin B1 interaction is required for global integrity of chromatin architecture and dynamics in human cells. Protein Cell. 2022;13:258-280 pubmed publisher
Wang C, Xia Q, Zhang Q, Qu Y, Su S, Cheng J, et al. CRISPR-Cas12a System With Synergistic Phage Recombination Proteins for Multiplex Precision Editing in Human Cells. Front Cell Dev Biol. 2021;9:719705 pubmed publisher
Lu X, Oh Hora M, Takeda K, Yamasaki S. Selective suppression of IL-10 transcription by calcineurin in dendritic cells through inactivation of CREB. Int Immunol. 2021;: pubmed publisher
Głów D, Maire C, Schwarze L, Lamszus K, Fehse B. CRISPR-to-Kill (C2K)-Employing the Bacterial Immune System to Kill Cancer Cells. Cancers (Basel). 2021;13: pubmed publisher
Lee R, Kang M, Kim Y, Yang B, Shim H, Kim S, et al. CTCF-mediated chromatin looping provides a topological framework for the formation of phase-separated transcriptional condensates. Nucleic Acids Res. 2021;: pubmed publisher
Umer N, Arévalo L, Phadke S, Lohanadan K, Kirfel G, Sons D, et al. Loss of Profilin3 Impairs Spermiogenesis by Affecting Acrosome Biogenesis, Autophagy, Manchette Development and Mitochondrial Organization. Front Cell Dev Biol. 2021;9:749559 pubmed publisher
Douglas C, Maciulyte V, Zohren J, Snell D, Mahadevaiah S, Ojarikre O, et al. CRISPR-Cas9 effectors facilitate generation of single-sex litters and sex-specific phenotypes. Nat Commun. 2021;12:6926 pubmed publisher
Duan N, Tang S, Zeng B, Hu Z, Hu Q, Wu L, et al. An Episomal CRISPR/Cas12a System for Mediating Efficient Gene Editing. Life (Basel). 2021;11: pubmed publisher
Hung K, Yost K, Xie L, Shi Q, Helmsauer K, Luebeck J, et al. ecDNA hubs drive cooperative intermolecular oncogene expression. Nature. 2021;600:731-736 pubmed publisher
Morgan M, Popova I, Vaidya A, Burg J, Marunde M, Rendleman E, et al. A trivalent nucleosome interaction by PHIP/BRWD2 is disrupted in neurodevelopmental disorders and cancer. Genes Dev. 2021;35:1642-1656 pubmed publisher
Zhao M, Quan Y, Zeng J, Lyu X, Wang H, Lei J, et al. Cullin3 deficiency shapes tumor microenvironment and promotes cholangiocarcinoma in liver-specific Smad4/Pten mutant mice. Int J Biol Sci. 2021;17:4176-4191 pubmed publisher
Hogan A, Sathyan K, Willis A, Khurana S, Srivastava S, Zasadzińska E, et al. UBR7 acts as a histone chaperone for post-nucleosomal histone H3. EMBO J. 2021;40:e108307 pubmed publisher
Riddy D, Kammoun H, Murphy A, Bosnyak Gladovic S, De la Fuente Gonzalez R, Merlin J, et al. Deletion of GPR21 improves glucose homeostasis and inhibits the CCL2-CCR2 axis by divergent mechanisms. BMJ Open Diabetes Res Care. 2021;9: pubmed publisher
Belluti S, Semeghini V, Rigillo G, Ronzio M, Benati D, Torricelli F, et al. Alternative splicing of NF-YA promotes prostate cancer aggressiveness and represents a new molecular marker for clinical stratification of patients. J Exp Clin Cancer Res. 2021;40:362 pubmed publisher
Faruk M, Ichimura Y, Kageyama S, Komatsu Hirota S, El Gowily A, Sou Y, et al. Phase-separated protein droplets of amyotrophic lateral sclerosis-associated p62/SQSTM1 mutants show reduced inner fluidity. J Biol Chem. 2021;297:101405 pubmed publisher
Song A, Hazlett Z, Abeykoon D, Dortch J, Dillon A, Curtiss J, et al. Branched ubiquitin chain binding and deubiquitination by UCH37 facilitate proteasome clearance of stress-induced inclusions. elife. 2021;10: pubmed publisher
Aronson B, Scourzic L, Shah V, Swanzey E, Kloetgen A, Polyzos A, et al. A bipartite element with allele-specific functions safeguards DNA methylation imprints at the Dlk1-Dio3 locus. Dev Cell. 2021;56:3052-3065.e5 pubmed publisher
Desai V, Chouaref J, Wu H, Pastor W, Kan R, Oey H, et al. The role of MORC3 in silencing transposable elements in mouse embryonic stem cells. Epigenetics Chromatin. 2021;14:49 pubmed publisher
Yu C, Zhong H, Yang X, Li G, Wu Z, Yang H. Establishment of a pig CRISPR/Cas9 knockout library for functional gene screening in pig cells. Biotechnol J. 2021;:e2100408 pubmed publisher
Miedzybrodzka E, Foreman R, Lu V, George A, Smith C, Larraufie P, et al. Stimulation of motilin secretion by bile, free fatty acids, and acidification in human duodenal organoids. Mol Metab. 2021;54:101356 pubmed publisher
Akaki K, Ogata K, Yamauchi Y, Iwai N, Tse K, Hia F, et al. IRAK1-dependent Regnase-1-14-3-3 complex formation controls Regnase-1-mediated mRNA decay. elife. 2021;10: pubmed publisher
Larsen L, van den Boogert M, Rios Ocampo W, Jansen J, Conlon D, Chong P, et al. Defective Lipid Droplet-Lysosome Interaction Causes Fatty Liver Disease as Evidenced by Human Mutations in TMEM199 and CCDC115. Cell Mol Gastroenterol Hepatol. 2021;13:583-597 pubmed publisher
Shibata M, Pattabiraman K, Muchnik S, Kaur N, Morozov Y, Cheng X, et al. Hominini-specific regulation of CBLN2 increases prefrontal spinogenesis. Nature. 2021;598:489-494 pubmed publisher
Shibata M, Pattabiraman K, Lorente Galdos B, Andrijevic D, Kim S, Kaur N, et al. Regulation of prefrontal patterning and connectivity by retinoic acid. Nature. 2021;598:483-488 pubmed publisher
Vega Sendino M, Olbrich T, Tillo D, Tran A, Domingo C, Franco M, et al. The ETS transcription factor ERF controls the exit from the naïve pluripotent state in a MAPK-dependent manner. Sci Adv. 2021;7:eabg8306 pubmed publisher
Sehgal P, Lanauze C, Wang X, Hayer K, Torres Diz M, Leu N, et al. MYC Hyperactivates Wnt Signaling in APC/CTNNB1-Mutated Colorectal Cancer Cells through miR-92a-Dependent Repression of DKK3. Mol Cancer Res. 2021;19:2003-2014 pubmed publisher
Harada A, Matsumoto S, Yasumizu Y, Shojima K, Akama T, Eguchi H, et al. Localization of KRAS downstream target ARL4C to invasive pseudopods accelerates pancreatic cancer cell invasion. elife. 2021;10: pubmed publisher
Labbe K, Mookerjee S, Le Vasseur M, Gibbs E, Lerner C, Nunnari J. The modified mitochondrial outer membrane carrier MTCH2 links mitochondrial fusion to lipogenesis. J Cell Biol. 2021;220: pubmed publisher
Baidya S, Nishimoto Y, Sato S, Shimada Y, Sakurai N, Nonaka H, et al. Dual Effect of Organogermanium Compound THGP on RIG-I-Mediated Viral Sensing and Viral Replication during Influenza a Virus Infection. Viruses. 2021;13: pubmed publisher
Shiura H, Ono R, Tachibana S, Kohda T, Kaneko ishino T, Ishino F. PEG10 viral aspartic protease domain is essential for the maintenance of fetal capillary structure in the mouse placenta. Development. 2021;148: pubmed publisher
Dai W, Li A, Yu N, Nguyen T, Leach R, Wühr M, et al. Activity-based RNA-modifying enzyme probing reveals DUS3L-mediated dihydrouridylation. Nat Chem Biol. 2021;17:1178-1187 pubmed publisher
Saha L, Murai Y, Saha S, Jo U, Tsuda M, Takeda S, et al. Replication-dependent cytotoxicity and Spartan-mediated repair of trapped PARP1-DNA complexes. Nucleic Acids Res. 2021;49:10493-10506 pubmed publisher
Hung Y, Huang K, Chen P, Li J, Lu S, Chang J, et al. UQCRC1 engages cytochrome c for neuronal apoptotic cell death. Cell Rep. 2021;36:109729 pubmed publisher
Wittig K, Sansam C, Noble T, Goins D, Sansam C. The CRL4DTL E3 ligase induces degradation of the DNA replication initiation factor TICRR/TRESLIN specifically during S phase. Nucleic Acids Res. 2021;49:10507-10523 pubmed publisher
de Krijger I, Föhr B, Pérez S, Vincendeau E, Serrat J, Thouin A, et al. MAD2L2 dimerization and TRIP13 control shieldin activity in DNA repair. Nat Commun. 2021;12:5421 pubmed publisher
Arai D, Nakao Y. Efficient biallelic knock-in in mouse embryonic stem cells by in vivo-linearization of donor and transient inhibition of DNA polymerase θ/DNA-PK. Sci Rep. 2021;11:18132 pubmed publisher
Castells Roca L, Gutierrez Enriquez S, Bonache S, Bogliolo M, Carrasco E, Aza Carmona M, et al. Clinical consequences of BRCA2 hypomorphism. NPJ Breast Cancer. 2021;7:117 pubmed publisher
Yue X, Qian Y, Zhu L, Gim B, Bao M, Jia J, et al. ACBD3 modulates KDEL receptor interaction with PKA for its trafficking via tubulovesicular carrier. BMC Biol. 2021;19:194 pubmed publisher
Kobayashi Y, Tomoshige S, Imakado K, Sekino Y, Koganezawa N, Shirao T, et al. Ciliary GPCR-based transcriptome as a key regulator of cilia length control. FASEB Bioadv. 2021;3:744-767 pubmed publisher
Głów D, Meyer S, García Roldán I, Akingunsade L, Riecken K, Fehse B. LATE-a novel sensitive cell-based assay for the study of CRISPR/Cas9-related long-term adverse treatment effects. Mol Ther Methods Clin Dev. 2021;22:249-262 pubmed publisher
Luo S, Li Z, Dai X, Zhang R, Liang Z, Li W, et al. CRISPR/Cas9-Mediated in vivo Genetic Correction in a Mouse Model of Hemophilia A. Front Cell Dev Biol. 2021;9:672564 pubmed publisher
Jo S, Kim J, Noh H, Kim H, Kim J, Park H. Generation of an ACTA2-EGFP reporter human induced pluripotent stem cell line, KITi001-C-41, using CRISPR/Cas9-mediated homologous recombination. Stem Cell Res. 2021;56:102524 pubmed publisher
Dewulf J, Paquay S, Marbaix E, Achouri Y, van Schaftingen E, Bommer G. ECHDC1 knockout mice accumulate ethyl-branched lipids and excrete abnormal intermediates of branched-chain fatty acid metabolism. J Biol Chem. 2021;297:101083 pubmed publisher
Jensen T, Mikkelsen N, Gao Z, Foßelteder J, Pabst G, Axelgaard E, et al. Targeted regulation of transcription in primary cells using CRISPRa and CRISPRi. Genome Res. 2021;31:2120-2130 pubmed publisher
Nami F, Ramezankhani R, Vandenabeele M, Vervliet T, Vogels K, Urano F, et al. Fast and Efficient Generation of Isogenic Induced Pluripotent Stem Cell Lines Using Adenine Base Editing. CRISPR J. 2021;4:502-518 pubmed publisher
Ichikawa K, Motoe Y, Ezaki R, Matsuzaki M, Horiuchi H. Knock-in of the duck retinoic acid-inducible gene I (RIG-I) into the Mx gene in DF-1 cells enables both stable and immune response-dependent RIG-I expression. Biochem Biophys Rep. 2021;27:101084 pubmed publisher
Olbrich T, Vega Sendino M, Tillo D, Wu W, Zolnerowich N, Pavani R, et al. CTCF is a barrier for 2C-like reprogramming. Nat Commun. 2021;12:4856 pubmed publisher
Schwarz L, Casadei N, Fitzgerald J. Generation of R272Q, S156A and K572R RHOT1/Miro1 point mutations in iPSCs from a healthy individual using FACS-assisted CRISPR/Cas9 genome editing. Stem Cell Res. 2021;55:102469 pubmed publisher
Li X, Guo M, Hou B, Zheng B, Wang Z, Huang M, et al. CRISPR/Cas9 nanoeditor of double knockout large fragments of E6 and E7 oncogenes for reversing drugs resistance in cervical cancer. J Nanobiotechnology. 2021;19:231 pubmed publisher
Ciampricotti M, Karakousi T, Richards A, Quintanal Villalonga Á, Karatza A, Caeser R, et al. Rlf-Mycl gene fusion drives tumorigenesis and metastasis in a mouse model of small cell lung cancer. Cancer Discov. 2021;: pubmed publisher
Gong Q, Wang X, Dou Z, Zhang K, Liu X, Gao J, et al. A novel mouse line with epididymal initial segment-specific expression of Cre recombinase driven by the endogenous Lcn9 promoter. PLoS ONE. 2021;16:e0254802 pubmed publisher
Teng K, Ford M, Harwalkar K, Li Y, Pacis A, Farnell D, et al. Modeling High-grade serous ovarian carcinoma using a combination of in vivo fallopian tube electroporation and CRISPR-Cas9-mediated genome editing. Cancer Res. 2021;: pubmed publisher
Sherstyuk V, Zakian S. Generation of Transgenic Rat Embryonic Stem Cells Using the CRISPR/Cpf1 System for Inducible Gene Knockout. Biochemistry (Mosc). 2021;86:843-851 pubmed publisher
Sanada Y, Takata T, Tanaka H, Sakurai Y, Watanabe T, Suzuki M, et al. HIF-1α affects sensitivity of murine squamous cell carcinoma to boron neutron capture therapy with BPA. Int J Radiat Biol. 2021;:1-9 pubmed publisher
Peng H, Zhang J, Ya A, Ma W, Villa S, Sukenik S, et al. Myomegalin regulates Hedgehog pathway by controlling PDE4D at the centrosome. Mol Biol Cell. 2021;32:1807-1817 pubmed publisher
Johnson A, Wei J, Rosser J, Künkele A, Chang C, Reid A, et al. Rationally Designed Transgene-Encoded Cell-Surface Polypeptide Tag for Multiplexed Programming of CAR T-cell Synthetic Outputs. Cancer Immunol Res. 2021;: pubmed publisher
Otabe T, Nihongaki Y, Sato M. Optical Control of Genome Editing by Photoactivatable Cas9. Methods Mol Biol. 2021;2312:225-233 pubmed publisher
Yoshida Y, Asahina M, Murakami A, Kawawaki J, Yoshida M, Fujinawa R, et al. Loss of peptide:N-glycanase causes proteasome dysfunction mediated by a sugar-recognizing ubiquitin ligase. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Berthelsen M, Riedel M, Cai H, Skaarup S, Alstrup A, Dagnæs Hansen F, et al. The CRISPR/Cas9 Minipig-A Transgenic Minipig to Produce Specific Mutations in Designated Tissues. Cancers (Basel). 2021;13: pubmed publisher
Cavdarli S, Schröter L, Albers M, Baumann A, Vicogne D, Le Doussal J, et al. Role of Sialyl-O-Acetyltransferase CASD1 on GD2 Ganglioside O-Acetylation in Breast Cancer Cells. Cells. 2021;10: pubmed publisher
Zhang P, Wang Y, Li C, Ma X, Ma L, Zhu X. Simplified All-In-One CRISPR-Cas9 Construction for Efficient Genome Editing in Cryptococcus Species. J Fungi (Basel). 2021;7: pubmed publisher
Ludwig K, Schmithausen R, Li D, Jacobs M, Hollstein R, Blumenstock K, et al. LAMP-Seq enables sensitive, multiplexed COVID-19 diagnostics using molecular barcoding. Nat Biotechnol. 2021;: pubmed publisher
Craig A, García Lezana T, Ruiz de Galarreta M, Villacorta Martin C, Kozlova E, Martins Filho S, et al. Transcriptomic characterization of cancer-testis antigens identifies MAGEA3 as a driver of tumor progression in hepatocellular carcinoma. PLoS Genet. 2021;17:e1009589 pubmed publisher
Li P, Walsh J, Lopez K, Isidan A, Zhang W, Chen A, et al. Genetic engineering of porcine endothelial cell lines for evaluation of human-to-pig xenoreactive immune responses. Sci Rep. 2021;11:13131 pubmed publisher
Damhofer H, Radzisheuskaya A, Helin K. Generation of locus-specific degradable tag knock-ins in mouse and human cell lines. STAR Protoc. 2021;2:100575 pubmed publisher
Martens Y, Xu S, Tait R, Li G, Zhao X, Lu W, et al. Generation and validation of APOE knockout human iPSC-derived cerebral organoids. STAR Protoc. 2021;2:100571 pubmed publisher
Akiyama M, Ueki R, Yanagawa M, Abe M, Hiroshima M, Sako Y, et al. DNA-Based Synthetic Growth Factor Surrogates with Fine-Tuned Agonism*. Angew Chem Int Ed Engl. 2021;: pubmed publisher
Debackere K, Marcelis L, Demeyer S, Vanden Bempt M, Mentens N, Gielen O, et al. Fusion transcripts FYN-TRAF3IP2 and KHDRBS1-LCK hijack T cell receptor signaling in peripheral T-cell lymphoma, not otherwise specified. Nat Commun. 2021;12:3705 pubmed publisher
Yu H, Wang J, Lackford B, Bennett B, Li J, Hu G. INO80 promotes H2A.Z occupancy to regulate cell fate transition in pluripotent stem cells. Nucleic Acids Res. 2021;49:6739-6755 pubmed publisher
Liu W, Völse K, Senft D, Jeremias I. A reporter system for enriching CRISPR/Cas9 knockout cells in technically challenging settings like patient models. Sci Rep. 2021;11:12649 pubmed publisher
Amen T, Kaganovich D. Stress granules inhibit fatty acid oxidation by modulating mitochondrial permeability. Cell Rep. 2021;35:109237 pubmed publisher
Zhang W, Yin J, Zhang Ding Z, Xin C, Liu M, Wang Y, et al. In-depth assessment of the PAM compatibility and editing activities of Cas9 variants. Nucleic Acids Res. 2021;: pubmed publisher
Kawatani K, Nambara T, Nawa N, Yoshimatsu H, Kusakabe H, Hirata K, et al. A human isogenic iPSC-derived cell line panel identifies major regulators of aberrant astrocyte proliferation in Down syndrome. Commun Biol. 2021;4:730 pubmed publisher
Elguindy M, Mendell J. NORAD-induced Pumilio phase separation is required for genome stability. Nature. 2021;595:303-308 pubmed publisher
Vonada A, Tiyaboonchai A, Nygaard S, Posey J, Peters A, Winn S, et al. Therapeutic liver repopulation by transient acetaminophen selection of gene-modified hepatocytes. Sci Transl Med. 2021;13: pubmed publisher
Uehara H, Zhang X, Pereira F, Narendran S, Choi S, Bhuvanagiri S, et al. Start codon disruption with CRISPR/Cas9 prevents murine Fuchs' endothelial corneal dystrophy. elife. 2021;10: pubmed publisher
Zhong H, Ceballos C, Massengill C, Muniak M, Ma L, Qin M, et al. High-fidelity, efficient, and reversible labeling of endogenous proteins using CRISPR-based designer exon insertion. elife. 2021;10: pubmed publisher
Koldaeva A, Zhang C, Huang Y, Reinert J, Mizuno S, Sugiyama F, et al. Generation and Characterization of a Cell Type-Specific, Inducible Cre-Driver Line to Study Olfactory Processing. J Neurosci. 2021;41:6449-6467 pubmed publisher
Yao J, Wang Y, Cao C, Song R, Bi D, Zhang H, et al. CRISPR/Cas9-mediated correction of MITF homozygous point mutation in a Waardenburg syndrome 2A pig model. Mol Ther Nucleic Acids. 2021;24:986-999 pubmed publisher
Ye L, Yu Y, Wang Y, Huang Y, Yu M, Lei W, et al. Establishment and characterization of a human embryonic stem cell line carrying a heterozygous GATA4T280M mutation. Stem Cell Res. 2021;53:102393 pubmed publisher
Tsukamoto S, Nakade K, Wakabayashi T, Nakashima K, Takami M, Hemmi Y, et al. Generation of two ISL1-tdTomato reporter human induced pluripotent stem cell lines using CRISPR-Cas9 genome editing. Stem Cell Res. 2021;53:102363 pubmed publisher
Matsumoto H, Kawashima N, Yamamoto T, Nakama M, Otsuka H, Ago Y, et al. In vitro functional analysis of four variants of human asparagine synthetase. J Inherit Metab Dis. 2021;: pubmed publisher
Inomata Y, Abe T, Tsuda M, Takeda S, Hirota K. Division of labor of Y-family polymerases in translesion-DNA synthesis for distinct types of DNA damage. PLoS ONE. 2021;16:e0252587 pubmed publisher
Davis L, Bright N, Edgar J, Parkinson M, Wartosch L, Mantell J, et al. Organelle tethering, pore formation and SNARE compensation in the late endocytic pathway. J Cell Sci. 2021;134: pubmed publisher
Liu B, Chen S, Xu Y, Lyu Y, Wang J, Du Y, et al. Chemically defined and xeno-free culture condition for human extended pluripotent stem cells. Nat Commun. 2021;12:3017 pubmed publisher
Fu X, An Y, Wang H, Li P, Lin J, Yuan J, et al. Deficiency of Klc2 Induces Low-Frequency Sensorineural Hearing Loss in C57BL/6 J Mice and Human. Mol Neurobiol. 2021;: pubmed publisher
Huang J, Qin Y, Lin C, Huang X, Zhang F. MTHFD2 facilitates breast cancer cell proliferation via the AKT signaling pathway. Exp Ther Med. 2021;22:703 pubmed publisher
Li Y, Adur M, Wang W, Schultz R, Hale B, Wierson W, et al. Effect of ARTEMIS (DCLRE1C) deficiency and microinjection timing on editing efficiency during somatic cell nuclear transfer and in vitro fertilization using the CRISPR/Cas9 system. Theriogenology. 2021;170:107-116 pubmed publisher
Jacq A, Becquet D, Bello Goutierrez M, Boyer B, Guillen S, Franc J, et al. Genome-wide screening of circadian and non-circadian impact of Neat1 genetic deletion. Comput Struct Biotechnol J. 2021;19:2121-2132 pubmed publisher
Wen J, Cao T, Wu J, Chen Y, Zhi S, Huang Y, et al. Single AAV-mediated CRISPR/Nme2Cas9 efficiently reduces mutant hTTR expression in a transgenic mouse model of transthyretin amyloidosis. Mol Ther. 2021;: pubmed publisher
Iemura K, Natsume T, Maehara K, Kanemaki M, Tanaka K. Chromosome oscillation promotes Aurora A-dependent Hec1 phosphorylation and mitotic fidelity. J Cell Biol. 2021;220: pubmed publisher
Ravi A, Palamiuc L, Loughran R, Triscott J, Arora G, Kumar A, et al. PI5P4Ks drive metabolic homeostasis through peroxisome-mitochondria interplay. Dev Cell. 2021;56:1661-1676.e10 pubmed publisher
Yeung T, Lau H, Ma H, Poon R. One-step multiplex toolkit for efficient generation of conditional gene silencing human cell lines. Mol Biol Cell. 2021;32:1320-1330 pubmed publisher
Shen H, Zhang W, Huang Y, He Y, Hu G, Wang L, et al. The Dual Function of KDM5C in Both Gene Transcriptional Activation and Repression Promotes Breast Cancer Cell Growth and Tumorigenesis. Adv Sci (Weinh). 2021;8:2004635 pubmed publisher
Ju M, Shin K, Lee J, Khim K, A Lee E, Ra J, et al. NSMF promotes the replication stress-induced DNA damage response for genome maintenance. Nucleic Acids Res. 2021;49:5605-5622 pubmed publisher
Cao X, Zhou Z, Tian Y, Liu Z, Cheng K, Chen X, et al. Opposing roles of E3 ligases TRIM23 and TRIM21 in regulation of ion channel ANO1 protein levels. J Biol Chem. 2021;296:100738 pubmed publisher
Deliz Aguirre R, Cao F, Gerpott F, Auevechanichkul N, Chupanova M, Mun Y, et al. MyD88 oligomer size functions as a physical threshold to trigger IL1R Myddosome signaling. J Cell Biol. 2021;220: pubmed publisher
Silva Pinheiro P, Pardo Hernández C, Reyes A, Tilokani L, Mishra A, Cerutti R, et al. DNA polymerase gamma mutations that impair holoenzyme stability cause catalytic subunit depletion. Nucleic Acids Res. 2021;49:5230-5248 pubmed publisher
Dinh T, Iseki H, Mizuno S, Iijima Mizuno S, Tanimoto Y, Daitoku Y, et al. Disruption of entire Cables2 locus leads to embryonic lethality by diminished Rps21 gene expression and enhanced p53 pathway. elife. 2021;10: pubmed publisher
Malik N, Yan H, Yang H, Ayaz G, DuBois W, Tseng Y, et al. CBFB cooperates with p53 to maintain TAp73 expression and suppress breast cancer. PLoS Genet. 2021;17:e1009553 pubmed publisher
Simanov G, Dang I, Fokin A, Oguievetskaia K, Campanacci V, Cherfils J, et al. Arpin Regulates Migration Persistence by Interacting with Both Tankyrases and the Arp2/3 Complex. Int J Mol Sci. 2021;22: pubmed publisher
Estell C, Davidson L, Steketee P, Monier A, West S. ZC3H4 restricts non-coding transcription in human cells. elife. 2021;10: pubmed publisher
Iguchi T, Oka Y, Yasumura M, Omi M, Kuroda K, Yagi H, et al. Mutually Repulsive EphA7-EfnA5 Organize Region-to-Region Corticopontine Projection by Inhibiting Collateral Extension. J Neurosci. 2021;41:4795-4808 pubmed publisher
Liu H, Hua Z, Jin Z. Modeling human retinoblastoma using embryonic stem cell-derived retinal organoids. STAR Protoc. 2021;2:100444 pubmed publisher
Li Y, Deng W, Jin Z. Modeling retinitis pigmentosa through patient-derived retinal organoids. STAR Protoc. 2021;2:100438 pubmed publisher
Arveseth C, Happ J, Hedeen D, Zhu J, Capener J, Klatt Shaw D, et al. Smoothened transduces Hedgehog signals via activity-dependent sequestration of PKA catalytic subunits. PLoS Biol. 2021;19:e3001191 pubmed publisher
Li P, Lin Z, An Y, Lin J, Zhang A, Wang S, et al. Piccolo is essential for the maintenance of mouse retina but not cochlear hair cell function. Aging (Albany NY). 2021;13:11678-11695 pubmed publisher
Gray D, Villegas I, Long J, Santos J, Keir A, Abele A, et al. Optimizing Integration and Expression of Transgenic Bruton's Tyrosine Kinase for CRISPR-Cas9-Mediated Gene Editing of X-Linked Agammaglobulinemia. CRISPR J. 2021;4:191-206 pubmed publisher
Lamsfus Calle A, Daniel Moreno A, Ureña Bailén G, Rottenberger J, Raju J, Epting T, et al. Universal Gene Correction Approaches for β-hemoglobinopathies Using CRISPR-Cas9 and Adeno-Associated Virus Serotype 6 Donor Templates. CRISPR J. 2021;4:207-222 pubmed publisher
Zhang X, Zhao L, Jin R, Li M, Li M, Li R, et al. CRISPR/Cas9-Mediated α-ENaC Knockout in a Murine Pancreatic β-Cell Line. Front Genet. 2021;12:664799 pubmed publisher
Majumder P, Lee J, Barwick B, Patterson D, Bally A, Scharer C, et al. The Murine MHC Class II Super Enhancer IA/IE-SE Contains a Functionally Redundant CTCF-Binding Component and a Novel Element Critical for Maximal Expression. J Immunol. 2021;206:2221-2232 pubmed publisher
Franken G, Seker M, Bos C, Siemons L, van der Eerden B, Christ A, et al. Cyclin M2 (CNNM2) knockout mice show mild hypomagnesaemia and developmental defects. Sci Rep. 2021;11:8217 pubmed publisher
Shinoda K, Zong D, Callen E, Wu W, Dumitrache L, Belinky F, et al. The dystonia gene THAP1 controls DNA double-strand break repair choice. Mol Cell. 2021;81:2611-2624.e10 pubmed publisher
Miura H, Imafuku J, Kurosaki A, Sato M, Ma Y, Zhang G, et al. Novel reporter mouse models useful for evaluating in vivo gene editing and for optimization of methods of delivering genome editing tools. Mol Ther Nucleic Acids. 2021;24:325-336 pubmed publisher
Meinke C, Quinlan M, Paffenroth K, Harrison F, Fenollar Ferrer C, Katamish R, et al. Serotonin Transporter Ala276 Mouse: Novel Model to Assess the Neurochemical and Behavioral Impact of Thr276 Phosphorylation In Vivo. Neurochem Res. 2021;: pubmed publisher
Niu G, Bak A, Nusselt M, Zhang Y, Pausch H, Flisikowska T, et al. Allelic Expression Imbalance Analysis Identified YAP1 Amplification in p53- Dependent Osteosarcoma. Cancers (Basel). 2021;13: pubmed publisher
Murtazina R, Zhukov I, Korenkova O, Popova E, Kuvarzin S, Efimova E, et al. Genetic Deletion of Trace-Amine Associated Receptor 9 (TAAR9) in Rats Leads to Decreased Blood Cholesterol Levels. Int J Mol Sci. 2021;22: pubmed publisher
Xiao X, Chen Y, Peng L, Zhang T. Generation of a homozygous ALX1 knockout human embryonic stem cell line (WAe001-A-060) by a CRISPR/Cas9 system. Stem Cell Res. 2021;53:102309 pubmed publisher
Lu H, Liu J, Feng T, Guo Z, Yin Y, Gao F, et al. A HIT-trapping strategy for rapid generation of reversible and conditional alleles using a universal donor. Genome Res. 2021;31:900-909 pubmed publisher
Giebel N, de Jaime Soguero A, García Del Arco A, Landry J, Tietje M, Villacorta L, et al. USP42 protects ZNRF3/RNF43 from R-spondin-dependent clearance and inhibits Wnt signalling. EMBO Rep. 2021;22:e51415 pubmed publisher
Chang H, Tao R, Tan C, Wu Y, Bay B, Yu V. The BAX-binding protein MOAP1 associates with LC3 and promotes closure of the phagophore. Autophagy. 2021;:1-15 pubmed publisher
Tavernier N, Thomas Y, Vigneron S, Maisonneuve P, Orlicky S, Mader P, et al. Bora phosphorylation substitutes in trans for T-loop phosphorylation in Aurora A to promote mitotic entry. Nat Commun. 2021;12:1899 pubmed publisher
Ohira M, Yokoo H, Ogawa K, Fukai M, Kamiyama T, Sakamoto N, et al. Serum fatty acid-binding protein 5 is a significant factor in hepatocellular carcinoma progression independent of tissue expression level. Carcinogenesis. 2021;42:794-803 pubmed publisher
Li Y, Li J, Zhou T, Pan G, Huang K. Generation of PARP1 gene knockout human embryonic stem cell line using CRISPR/Cas9. Stem Cell Res. 2021;53:102288 pubmed publisher
Tran M, Park H, Nobles C, Karunadharma P, Pan L, Zhong G, et al. A more efficient CRISPR-Cas12a variant derived from Lachnospiraceae bacterium MA2020. Mol Ther Nucleic Acids. 2021;24:40-53 pubmed publisher
Brandao R, Kwa M, Yarden Y, Brakebusch C. ACK1 is dispensable for development, skin tumor formation, and breast cancer cell proliferation. FEBS Open Bio. 2021;11:1579-1592 pubmed publisher
Haring N, van Bree E, Jordaan W, Roels J, Sotomayor G, Hey T, et al. ZNF91 deletion in human embryonic stem cells leads to ectopic activation of SVA retrotransposons and up-regulation of KRAB zinc finger gene clusters. Genome Res. 2021;31:551-563 pubmed publisher
Fang H, Bygrave A, Roth R, Johnson R, Huganir R. An optimized CRISPR/Cas9 approach for precise genome editing in neurons. elife. 2021;10: pubmed publisher
Di Stazio M, Foschi N, Athanasakis E, Gasparini P, d Adamo A. Systematic analysis of factors that improve homologous direct repair (HDR) efficiency in CRISPR/Cas9 technique. PLoS ONE. 2021;16:e0247603 pubmed publisher
Kobayashi T, Goto T, Oikawa M, Sanbo M, Yoshida F, Terada R, et al. Blastocyst complementation using Prdm14-deficient rats enables efficient germline transmission and generation of functional mouse spermatids in rats. Nat Commun. 2021;12:1328 pubmed publisher
Kar N, Ferguson D, Zhang N, Waldorff E, Ryaby J, DiDonato J. Pulsed-electromagnetic-field induced osteoblast differentiation requires activation of genes downstream of adenosine receptors A2A and A3. PLoS ONE. 2021;16:e0247659 pubmed publisher
Wang C, Cheng J, Zhang Q, Hughes N, Xia Q, Winslow M, et al. Microbial single-strand annealing proteins enable CRISPR gene-editing tools with improved knock-in efficiencies and reduced off-target effects. Nucleic Acids Res. 2021;49:e36 pubmed publisher
Huang Y, Wu H, Han X, Wu J, Yu M, Zhao Z, et al. Generation of an EFNB2-2A-mCherry reporter human embryonic stem cell line using CRISPR/Cas9-mediated site-specific homologous recombination. Stem Cell Res. 2021;52:102241 pubmed publisher
Mattar P, Jolicoeur C, Dang T, Shah S, Clark B, Cayouette M. A Casz1-NuRD complex regulates temporal identity transitions in neural progenitors. Sci Rep. 2021;11:3858 pubmed publisher
Srivastava S, Sahu U, Zhou Y, Hogan A, Sathyan K, Bodner J, et al. NOTCH1-driven UBR7 stimulates nucleotide biosynthesis to promote T cell acute lymphoblastic leukemia. Sci Adv. 2021;7: pubmed publisher
Ichijo R, Kabata M, Kidoya H, Muramatsu F, Ishibashi R, Abe K, et al. Vasculature-driven stem cell population coordinates tissue scaling in dynamic organs. Sci Adv. 2021;7: pubmed publisher
Olofsen P, Bosch D, Roovers O, van Strien P, de Looper H, Hoogenboezem R, et al. PML-controlled responses in severe congenital neutropenia with ELANE-misfolding mutations. Blood Adv. 2021;5:775-786 pubmed publisher
Iwasaki K, Fujiyama T, Nakata S, Park M, Miyoshi C, Hotta Hirashima N, et al. Induction of Mutant Sik3Sleepy Allele in Neurons in Late Infancy Increases Sleep Need. J Neurosci. 2021;41:2733-2746 pubmed publisher
Wang G, Li C, He S, Liu Z. Mosaic CRISPR-stop enables rapid phenotyping of nonsense mutations in essential genes. Development. 2021;: pubmed publisher
Huang B, Jiao Y, Zhu Y, Ning Z, Ye Z, Li Q, et al. Mdfi Promotes C2C12 Cell Differentiation and Positively Modulates Fast-to-Slow-Twitch Muscle Fiber Transformation. Front Cell Dev Biol. 2021;9:605875 pubmed publisher
Kadowaki S, Hashimoto K, Nishimura T, Kashimada K, Kadowaki T, Kawamoto N, et al. Functional analysis of novel A20 variants in patients with atypical inflammatory diseases. Arthritis Res Ther. 2021;23:52 pubmed publisher
Taniguchi R, Utani K, Thakur B, Ishine K, Aladjem M, Shimizu N. SIRT1 stabilizes extrachromosomal gene amplification and contributes to repeat-induced gene silencing. J Biol Chem. 2021;:100356 pubmed publisher
Zhang H, Hanson A, Scherf de Almeida T, Emfinger C, McClenaghan C, Harter T, et al. Complex consequences of Cantu Syndrome SUR2 variant R1154Q in genetically modified mice. JCI Insight. 2021;: pubmed publisher
Mu A, Hira A, Niwa A, Osawa M, Yoshida K, Mori M, et al. Analysis of disease model iPSCs derived from patients with a novel Fanconi anemia-like IBMFS ADH5/ALDH2 deficiency. Blood. 2021;137:2021-2032 pubmed publisher
Patrizi C, Llado M, Benati D, Iodice C, Marrocco E, Guarascio R, et al. Allele-specific editing ameliorates dominant retinitis pigmentosa in a transgenic mouse model. Am J Hum Genet. 2021;108:295-308 pubmed publisher
Galat Y, Gu H, Perepitchka M, Taylor R, Yoon J, Glukhova X, et al. Crispr editing of the gli1 first intron abrogates gli1 expression and differentially alters lineage commitment. Stem Cells. 2021;: pubmed publisher
Ghassemi B, Jamalkhah M, Shokri G, Kehtari M, Soleimani M, Shamsara M, et al. Improved efficiency of genome editing by constitutive expression of Cas9 endonuclease in genetically-modified mice. 3 Biotech. 2021;11:56 pubmed publisher
Condon K, Orozco J, Adelmann C, Spinelli J, van der Helm P, Roberts J, et al. Genome-wide CRISPR screens reveal multitiered mechanisms through which mTORC1 senses mitochondrial dysfunction. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Lee M, Meyerson M. Antigen identification for HLA class I- and HLA class II-restricted T cell receptors using cytokine-capturing antigen-presenting cells. Sci Immunol. 2021;6: pubmed publisher
Murakami K, Terakado Y, Saito K, Jomen Y, Takeda H, Oshima M, et al. A genome-scale CRISPR screen reveals factors regulating Wnt-dependent renewal of mouse gastric epithelial cells. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Le Gall C, van der Schoot J, Ramos Tomillero I, Khalily M, van Dalen F, Wijfjes Z, et al. Dual Site-Specific Chemoenzymatic Antibody Fragment Conjugation Using CRISPR-Based Hybridoma Engineering. Bioconjug Chem. 2021;32:301-310 pubmed publisher
Maslova E, Orishchenko K, Posukh O. Functional Evaluation of a Rare Variant c.516G>C (p.Trp172Cys) in the GJB2 (Connexin 26) Gene Associated with Nonsyndromic Hearing Loss. Biomolecules. 2021;11: pubmed publisher
Zheng B, Aoi Y, Shah A, Iwanaszko M, Das S, Rendleman E, et al. Acute perturbation strategies in interrogating RNA polymerase II elongation factor function in gene expression. Genes Dev. 2021;35:273-285 pubmed publisher
Murillo Pineda M, Valente L, Dumont M, Mata J, Fachinetti D, Jansen L. Induction of spontaneous human neocentromere formation and long-term maturation. J Cell Biol. 2021;220: pubmed publisher
Kurtz S, Lucas Hahn A, Schlegelberger B, Göhring G, Niemann H, Mettenleiter T, et al. Knockout of the HMG domain of the porcine SRY gene causes sex reversal in gene-edited pigs. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Zhang X, Yoon H, Chapdelaine Williams A, Kyritsis N, Alt F. Physiological role of the 3'IgH CBEs super-anchor in antibody class switching. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Peng D, Lin B, Xie M, Zhang P, Guo Q, Li Q, et al. Histone demethylase KDM5A promotes tumorigenesis of osteosarcoma tumor. Cell Death Discov. 2021;7:9 pubmed publisher
Chen D, Suzuki T, Itoh Y, Maeda Y, Hirano J, Haga S, et al. Deneddylation by SENP8 Restricts Hepatitis B Virus Propagation. Microbiol Immunol. 2021;: pubmed publisher
Shoshani O, Brunner S, Yaeger R, Ly P, Nechemia Arbely Y, Kim D, et al. Chromothripsis drives the evolution of gene amplification in cancer. Nature. 2020;: pubmed publisher
Reé D, Borsy A, Fóthi Á, Orban T, Várady G, Erdei Z, et al. Establishing a human embryonic stem cell clone with a heterozygous mutation in the DGCR8 gene. Stem Cell Res. 2020;50:102134 pubmed publisher
Flor A, Wolfgeher D, Li J, HANAKAHI L, Kron S. Lipid-derived electrophiles mediate the effects of chemotherapeutic topoisomerase I poisons. Cell Chem Biol. 2020;: pubmed publisher
Youmans D, Gooding A, Dowell R, Cech T. Competition between PRC2.1 and 2.2 subcomplexes regulates PRC2 chromatin occupancy in human stem cells. Mol Cell. 2021;81:488-501.e9 pubmed publisher
Kunii M, Noguchi Y, Yoshimura S, Kanda S, Iwano T, Avriyanti E, et al. SNAP23 deficiency causes severe brain dysplasia through the loss of radial glial cell polarity. J Cell Biol. 2021;220: pubmed publisher
Hamazaki N, Kyogoku H, Araki H, Miura F, Horikawa C, Hamada N, et al. Reconstitution of the oocyte transcriptional network with transcription factors. Nature. 2021;589:264-269 pubmed publisher
Iwata S, Morikawa M, Takei Y, Hirokawa N. An activity-dependent local transport regulation via degradation and synthesis of KIF17 underlying cognitive flexibility. Sci Adv. 2020;6: pubmed publisher
Yamazaki T, Hirose T. CRISPR-Mediated Mutagenesis of Long Noncoding RNAs. Methods Mol Biol. 2021;2254:283-303 pubmed publisher
Kathiriya I, Rao K, Iacono G, Devine W, Blair A, Hota S, et al. Modeling Human TBX5 Haploinsufficiency Predicts Regulatory Networks for Congenital Heart Disease. Dev Cell. 2021;56:292-309.e9 pubmed publisher
Liu N, Maresca M, van den Brand T, Braccioli L, Schijns M, Teunissen H, et al. WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Nat Genet. 2021;53:100-109 pubmed publisher
Hamann M, Ehmele P, Verdikt R, Bialek Waldmann J, Virdi S, Gunther T, et al. Transcriptional behavior of the HIV-1 promoter in context of the BACH2 prominent proviral integration gene. Virus Res. 2021;293:198260 pubmed publisher
Sreenivasan L, Wang H, Yap S, Leclair P, Tam A, Lim C. Autocrine IL-6/STAT3 signaling aids development of acquired drug resistance in Group 3 medulloblastoma. Cell Death Dis. 2020;11:1035 pubmed publisher
Miura Y, Li M, Birey F, Ikeda K, Revah O, Thete M, et al. Generation of human striatal organoids and cortico-striatal assembloids from human pluripotent stem cells. Nat Biotechnol. 2020;38:1421-1430 pubmed publisher
Li Y, Que L, Fukano K, Koura M, Kitamura K, Zheng X, et al. MCPIP1 reduces HBV-RNA by targeting its epsilon structure. Sci Rep. 2020;10:20763 pubmed publisher
Gryzik M, Asperti M, Denardo A, Arosio P, Poli M. NCOA4-mediated ferritinophagy promotes ferroptosis induced by erastin, but not by RSL3 in HeLa cells. Biochim Biophys Acta Mol Cell Res. 2021;1868:118913 pubmed publisher
Sever N, Miličić G, Bodnar N, Wu X, Rapoport T. Mechanism of Lamellar Body Formation by Lung Surfactant Protein B. Mol Cell. 2021;81:49-66.e8 pubmed publisher
Lee S, Park J, Lee D, Otsu K, Kim P, Mizuno S, et al. Mast4 knockout shows the regulation of spermatogonial stem cell self-renewal via the FGF2/ERM pathway. Cell Death Differ. 2021;28:1441-1454 pubmed publisher
Doray B, Liu L, Lee W, Jennings B, Kornfeld S. Inactivation of the three GGA genes in HeLa cells partially compromises lysosomal enzyme sorting. FEBS Open Bio. 2020;: pubmed publisher
Zhang Z, Yuan S, Xu S, Guo D, Chen L, Hou W, et al. Suppression of HIV-1 Integration by Targeting HIV-1 Integrase for Degradation with A Chimeric Ubiquitin Ligase. Virol Sin. 2021;36:424-437 pubmed publisher
Lawlor K, Marqués Torrejón M, Dharmalingham G, El Azhar Y, Schneider M, Pollard S, et al. Glioblastoma stem cells induce quiescence in surrounding neural stem cells via Notch signaling. Genes Dev. 2020;34:1599-1604 pubmed publisher
Ali M, Patro C, Zhu J, Dampier C, Plummer S, Kuscu C, et al. A functional variant on 20q13.33 related to glioma risk alters enhancer activity and modulates expression of multiple genes. Hum Mutat. 2020;: pubmed publisher
Kruse R, Legras X, Barzi M. Cre/LoxP-HBV plasmids generating recombinant covalently closed circular DNA genome upon transfection. Virus Res. 2021;292:198224 pubmed publisher
Bieging Rolett K, Kaiser A, Morgens D, Boutelle A, Seoane J, Van Nostrand E, et al. Zmat3 Is a Key Splicing Regulator in the p53 Tumor Suppression Program. Mol Cell. 2020;80:452-469.e9 pubmed publisher
Wang J, Lin Z, Li L, Zhang S, Li W, Liu W, et al. SUMOylation of the ubiquitin ligase IDOL decreases LDL receptor levels and is reversed by SENP1. J Biol Chem. 2021;296:100032 pubmed publisher
Li J, Li Y, Pawlik K, Napierala J, Napierala M. A CRISPR-Cas9, Cre-lox, and Flp-FRT Cascade Strategy for the Precise and Efficient Integration of Exogenous DNA into Cellular Genomes. CRISPR J. 2020;3:470-486 pubmed publisher
Hanss Z, Larsen S, Antony P, Mencke P, Massart F, Jarazo J, et al. Mitochondrial and Clearance Impairment in p.D620N VPS35 Patient-Derived Neurons. Mov Disord. 2020;: pubmed publisher
Watts L, Natsume T, Saito Y, Garzón J, Dong Q, Boteva L, et al. The RIF1-long splice variant promotes G1 phase 53BP1 nuclear bodies to protect against replication stress. elife. 2020;9: pubmed publisher
Watzlawik J, Hou X, Fricova D, Ramnarine C, Barodia S, Gendron T, et al. Sensitive ELISA-based detection method for the mitophagy marker p-S65-Ub in human cells, autopsy brain, and blood samples. Autophagy. 2021;17:2613-2628 pubmed publisher
Yang Q, Hughes T, Kelkar A, Yu X, Cheng K, Park S, et al. Inhibition of SARS-CoV-2 viral entry upon blocking N- and O-glycan elaboration. elife. 2020;9: pubmed publisher
Bashir S, Dang T, Rossius J, Wolf J, Kühn R. Enhancement of CRISPR-Cas9 induced precise gene editing by targeting histone H2A-K15 ubiquitination. BMC Biotechnol. 2020;20:57 pubmed publisher
Zhong A, Li M, Zhou T. Protocol for the Generation of Human Pluripotent Reporter Cell Lines Using CRISPR/Cas9. STAR Protoc. 2020;1: pubmed publisher
Koppes E, Redel B, Johnson M, Skvorak K, Ghaloul Gonzalez L, Yates M, et al. A porcine model of phenylketonuria generated by CRISPR/Cas9 genome editing. JCI Insight. 2020;5: pubmed publisher
Ide S, Imai R, Ochi H, Maeshima K. Transcriptional suppression of ribosomal DNA with phase separation. Sci Adv. 2020;6: pubmed publisher
Holzerland J, F xe9 n xe9 ant L, Banadyga L, H xf6 lper J, Knittler M, Groseth A. BH3-only sensors Bad, Noxa and Puma are Key Regulators of Tacaribe virus-induced Apoptosis. PLoS Pathog. 2020;16:e1008948 pubmed publisher
Sleiman Y, Souidi M, Kumar R, Yang E, Jaffré F, Zhou T, et al. Modeling polymorphic ventricular tachycardia at rest using patient-specific induced pluripotent stem cell-derived cardiomyocytes. EBioMedicine. 2020;60:103024 pubmed publisher
Bindschedler A, Wacker R, Egli J, Eickel N, Schmuckli Maurer J, Franke Fayard B, et al. Plasmodium berghei sporozoites in nonreplicative vacuole are eliminated by a PI3P-mediated autophagy-independent pathway. Cell Microbiol. 2021;23:e13271 pubmed publisher
Nishimura K, Yamada R, Hagihara S, Iwasaki R, Uchida N, Kamura T, et al. A super-sensitive auxin-inducible degron system with an engineered auxin-TIR1 pair. Nucleic Acids Res. 2020;48:e108 pubmed publisher
Barbuti P, Antony P, Santos B, Massart F, Cruciani G, Dording C, et al. Using High-Content Screening to Generate Single-Cell Gene-Corrected Patient-Derived iPS Clones Reveals Excess Alpha-Synuclein with Familial Parkinson's Disease Point Mutation A30P. Cells. 2020;9: pubmed publisher
Ferry Q, Fulga T. Controlling the Activity of CRISPR Transcriptional Regulators with Inducible sgRNAs. Methods Mol Biol. 2021;2162:153-184 pubmed publisher
Jin S, Mwimanzi F, Mann J, Bwana M, Lee G, Brumme C, et al. Variation in HIV-1 Nef function within and among viral subtypes reveals genetically separable antagonism of SERINC3 and SERINC5. PLoS Pathog. 2020;16:e1008813 pubmed publisher
Aksenova V, Smith A, Lee H, Bhat P, Esnault C, Chen S, et al. Nucleoporin TPR is an integral component of the TREX-2 mRNA export pathway. Nat Commun. 2020;11:4577 pubmed publisher
Rogerson C, Ogden S, Britton E, Ang Y, Sharrocks A. Repurposing of KLF5 activates a cell cycle signature during the progression from a precursor state to oesophageal adenocarcinoma. elife. 2020;9: pubmed publisher
Takeda Y, Yamazaki K, Hashimoto K, Watanabe K, Chinen T, Kitagawa D. The centriole protein CEP76 negatively regulates PLK1 activity in the cytoplasm for proper mitotic progression. J Cell Sci. 2020;133: pubmed publisher
Hassebroek V, Park H, Pandey N, Lerbakken B, Aksenova V, Arnaoutov A, et al. PICH regulates the abundance and localization of SUMOylated proteins on mitotic chromosomes. Mol Biol Cell. 2020;31:2537-2556 pubmed publisher
Xu K, Zhou Y, Mu Y, Liu Z, Hou S, Xiong Y, et al. CD163 and pAPN double-knockout pigs are resistant to PRRSV and TGEV and exhibit decreased susceptibility to PDCoV while maintaining normal production performance. elife. 2020;9: pubmed publisher
Suzuki T, Yashiro Y, Kikuchi I, Ishigami Y, Saito H, Matsuzawa I, et al. Complete chemical structures of human mitochondrial tRNAs. Nat Commun. 2020;11:4269 pubmed publisher
Ishibashi R, Abe K, Ido N, Kitano S, Miyachi H, Toyoshima F. Genome editing with the donor plasmid equipped with synthetic crRNA-target sequence. Sci Rep. 2020;10:14120 pubmed publisher
Ubels J, Diegel C, Foxa G, Ethen N, Lensing J, Madaj Z, et al. Low-Density Lipoprotein Receptor-Related Protein 5-Deficient Rats Have Reduced Bone Mass and Abnormal Development of the Retinal Vasculature. CRISPR J. 2020;3:284-298 pubmed publisher
Zhang M, Lai Y, Krupalnik V, Guo P, Guo X, Zhou J, et al. β-Catenin safeguards the ground state of mousepluripotency by strengthening the robustness of the transcriptional apparatus. Sci Adv. 2020;6:eaba1593 pubmed publisher
Fok E, Fanucchi S, Bystricky K, Mhlanga M. Visualization of Chromatin Dynamics by Live Cell Microscopy Using CRISPR/Cas9 Gene Editing and ANCHOR Labeling. Methods Mol Biol. 2021;2157:197-212 pubmed publisher
Wiggan O, DeLuca J, Stasevich T, Bamburg J. Lamin A/C deficiency enables increased myosin-II bipolar filament ensembles that promote divergent actomyosin network anomalies through self-organization. Mol Biol Cell. 2020;31:2363-2378 pubmed publisher
Ikegami K, Nakajima M, Minami Y, Nagano M, Masubuchi S, Shigeyoshi Y. cAMP response element induces Per1 in vivo. Biochem Biophys Res Commun. 2020;531:515-521 pubmed publisher
Chien J, Tabet E, Pinkham K, da Hora C, Chang J, Lin S, et al. A multiplexed bioluminescent reporter for sensitive and non-invasive tracking of DNA double strand break repair dynamics in vitro and in vivo. Nucleic Acids Res. 2020;48:e100 pubmed publisher
Mengoni M, Braun A, Gaffal E, Tüting T. The aryl hydrocarbon receptor promotes inflammation-induced dedifferentiation and systemic metastatic spread of melanoma cells. Int J Cancer. 2020;147:2902-2913 pubmed publisher
Pittis A, Goh V, Cebrian Serrano A, Wettmarshausen J, Perocchi F, Gabaldón T. Discovery of EMRE in fungi resolves the true evolutionary history of the mitochondrial calcium uniporter. Nat Commun. 2020;11:4031 pubmed publisher
Dai H, Liang Z, Chang A, Chapdelaine Williams A, Alvarado B, Pollen A, et al. Direct analysis of brain phenotypes via neural blastocyst complementation. Nat Protoc. 2020;15:3154-3181 pubmed publisher
Zhu Z, Zhang Y, Wang X, Wang X, Ye S. Inhibition of protein kinase D by CID755673 promotes maintenance of the pluripotency of embryonic stem cells. Development. 2020;147: pubmed publisher
Liu G, Ruan Y, Zhang J, Wang X, Wu W, He P, et al. ABHD11 Is Critical for Embryonic Stem Cell Expansion, Differentiation and Lipid Metabolic Homeostasis. Front Cell Dev Biol. 2020;8:570 pubmed publisher
Wang Y, Zhao P, Song Z, Du X, Huo X, Lu J, et al. Generation of Gene-Knockout Mongolian Gerbils via CRISPR/Cas9 System. Front Bioeng Biotechnol. 2020;8:780 pubmed publisher
Zhang Q, Tiyaboonchai A, Nygaard S, Baradar K, Major A, Balaji N, et al. Induced Liver Regeneration Enhances CRISPR/Cas9-Mediated Gene Repair in Tyrosinemia Type 1. Hum Gene Ther. 2021;32:294-301 pubmed publisher
Ittner A, Asih P, Tan A, Prikas E, Bertz J, Stefanoska K, et al. Reduction of advanced tau-mediated memory deficits by the MAP kinase p38γ. Acta Neuropathol. 2020;140:279-294 pubmed publisher
Ba Z, Lou J, Ye A, Dai H, Dring E, Lin S, et al. CTCF orchestrates long-range cohesin-driven V(D)J recombinational scanning. Nature. 2020;586:305-310 pubmed publisher
Wen Z, Zhu H, Zhang A, Lin J, Zhang G, Liu D, et al. Cdc14a has a role in spermatogenesis, sperm maturation and male fertility. Exp Cell Res. 2020;:112178 pubmed publisher
Yamamoto M, Suwa Y, Sugiyama K, Okashita N, Kawaguchi M, Tani N, et al. PRDM14-CtBP1/2-PRC2 complex regulates transcriptional repression during transition from primed to naïve pluripotency. J Cell Sci. 2020;: pubmed publisher
Ganesh K, Basnet H, Kaygusuz Y, Laughney A, He L, Sharma R, et al. L1CAM defines the regenerative origin of metastasis-initiating cells in colorectal cancer. Nat Cancer. 2020;1:28-45 pubmed publisher
Nada S, Okada M. Genetic dissection of Ragulator structure and function in amino acid-dependent regulation of mTORC1. J Biochem. 2020;: pubmed publisher
Cieślar Pobuda A, Ahrens T, Caglayan S, Behringer S, Hannibal L, Staerk J. DNMT3B deficiency alters mitochondrial biogenesis and α-ketoglutarate levels in human embryonic stem cells. Stem Cells. 2020;: pubmed publisher
Hong C, Tang A, Detter M, Choi J, Wang R, Yang X, et al. Cerebral cavernous malformations are driven by ADAMTS5 proteolysis of versican. J Exp Med. 2020;217: pubmed publisher
Hanrahan A, SYLVESTER B, Chang M, Elzein A, Gao J, Han W, et al. Leveraging systematic functional analysis to benchmark an in silico framework distinguishes driver from passenger MEK mutants in cancer. Cancer Res. 2020;: pubmed publisher
Long Y, Hwang T, Gooding A, Goodrich K, Rinn J, Cech T. RNA is essential for PRC2 chromatin occupancy and function in human pluripotent stem cells. Nat Genet. 2020;: pubmed publisher
Chan C, Lonfat N, Zhao R, Davis A, Li L, Wu M, et al. Cell type- and stage-specific expression of Otx2 is regulated by multiple transcription factors and cis-regulatory modules in the retina. Development. 2020;: pubmed publisher
Delgado Benito V, Berruezo Llacuna M, Altwasser R, Winkler W, Sundaravinayagam D, Balasubramanian S, et al. PDGFA-associated protein 1 protects mature B lymphocytes from stress-induced cell death and promotes antibody gene diversification. J Exp Med. 2020;217: pubmed publisher
Yau K, Arnaoutov A, Aksenova V, Kaufhold R, Chen S, Dasso M. RanBP1 controls the Ran pathway in mammalian cells through regulation of mitotic RCC1 dynamics. Cell Cycle. 2020;:1-18 pubmed publisher
Kim S, Wie M, Park S, Kim T, Park J, Kim S, et al. ATAD5 suppresses centrosome over-duplication by regulating UAF1 and ID1. Cell Cycle. 2020;:1-17 pubmed publisher
van der Wel T, Hilhorst R, den Dulk H, van den Hooven T, Prins N, Wijnakker J, et al. Chemical genetics strategy to profile kinase target engagement reveals role of FES in neutrophil phagocytosis. Nat Commun. 2020;11:3216 pubmed publisher
Yi J, Perla S, Enyenihi L, Bennett A. Tyrosyl phosphorylation of PZR promotes hypertrophic cardiomyopathy in PTPN11-associated Noonan syndrome with multiple lentigines. JCI Insight. 2020;5: pubmed publisher
Panicker N, Coutman M, Lawlor O Neill C, Kahl R, Roselli S, Verrills N. Ppp2r2a Knockout Mice Reveal That Protein Phosphatase 2A Regulatory Subunit, PP2A-B55α, Is an Essential Regulator of Neuronal and Epidermal Embryonic Development. Front Cell Dev Biol. 2020;8:358 pubmed publisher
Renema P, Kozhukhar N, Pastukh V, Spadafora D, Subedi Paudel S, Tambe D, et al. Exoenzyme Y induces extracellular active caspase-7 accumulation independent from apoptosis: Modulation of transmissible cytotoxicity. Am J Physiol Lung Cell Mol Physiol. 2020;: pubmed publisher
Lamsfus Calle A, Daniel Moreno A, Antony J, Epting T, Heumos L, Baskaran P, et al. Comparative targeting analysis of KLF1, BCL11A, and HBG1/2 in CD34+ HSPCs by CRISPR/Cas9 for the induction of fetal hemoglobin. Sci Rep. 2020;10:10133 pubmed publisher
Yamakawa T, Okamatsu N, Ishikawa K, Kiyohara S, Handa K, Hayashi E, et al. Novel gene Merlot inhibits differentiation and promotes apoptosis of osteoclasts. Bone. 2020;138:115494 pubmed publisher
Moutal A, Cai S, Yu J, Stratton H, Chefdeville A, Gomez K, et al. Studies on CRMP2 SUMOylation-deficient transgenic mice identify sex-specific NaV1.7 regulation in the pathogenesis of chronic neuropathic pain. Pain. 2020;: pubmed publisher
Stephan T, Brüser C, Deckers M, Steyer A, Balzarotti F, Barbot M, et al. MICOS assembly controls mitochondrial inner membrane remodeling and crista junction redistribution to mediate cristae formation. EMBO J. 2020;39:e104105 pubmed publisher
Park S, Shimada K, Fujihara Y, Xu Z, Shimada K, Larasati T, et al. CRISPR/Cas9-mediated genome-edited mice reveal 10 testis-enriched genes are dispensable for male fecundity. Biol Reprod. 2020;: pubmed publisher
Li G, Zhang X, Wang H, Liu D, Li Z, Wu Z, et al. Increasing CRISPR/Cas9-mediated homology-directed DNA repair by histone deacetylase inhibitors. Int J Biochem Cell Biol. 2020;125:105790 pubmed publisher
Suzuki T, Suzuki T, Raveau M, Miyake N, Sudo G, Tsurusaki Y, et al. A recurrent PJA1 variant in trigonocephaly and neurodevelopmental disorders. Ann Clin Transl Neurol. 2020;7:1117-1131 pubmed publisher
Larasati T, Noda T, Fujihara Y, Shimada K, Tobita T, Yu Z, et al. Tmprss12 is required for sperm motility and uterotubal junction migration in mice†. Biol Reprod. 2020;: pubmed publisher
Huang R, Shih H, Lai M, Chang Y, Lin S. Enhanced NK-92 Cytotoxicity by CRISPR Genome Engineering Using Cas9 Ribonucleoproteins. Front Immunol. 2020;11:1008 pubmed publisher
Li J, Li Y, Wang J, Gonzalez T, Asokan A, Napierala J, et al. Defining Transcription Regulatory Elements in the Human Frataxin Gene: Implications for Gene Therapy. Hum Gene Ther. 2020;: pubmed publisher
Zhu X, Cong J, Lin Z, Sun J, Yang B, Li A. Inhibition of HMGB1 Overcomes Resistance to Radiation and Chemotherapy in Nasopharyngeal Carcinoma. Onco Targets Ther. 2020;13:4189-4199 pubmed publisher
Bae B, Gruner H, Lynch M, Feng T, So K, Oliver D, et al. Elimination of Calm1 long 3' UTR mRNA isoform by CRISPR-Cas9 gene editing impairs dorsal root ganglion development and hippocampal neuron activation in mice. RNA. 2020;: pubmed publisher
Kamimoto K, Nakano Y, Kaneko K, Miyajima A, Itoh T. Multidimensional imaging of liver injury repair in mice reveals fundamental role of the ductular reaction. Commun Biol. 2020;3:289 pubmed publisher
Yang D, Sun Y, Chen J, Zhang Y, Fan S, Huang M, et al. REV7 is required for processing AID initiated DNA lesions in activated B cells. Nat Commun. 2020;11:2812 pubmed publisher
Li X, Pritykin Y, Concepcion C, Lu Y, La Rocca G, Zhang M, et al. High-Resolution In Vivo Identification of miRNA Targets by Halo-Enhanced Ago2 Pull-Down. Mol Cell. 2020;79:167-179.e11 pubmed publisher
Mullally G, van Aelst K, Naqvi M, Diffin F, Karvelis T, Gasiunas G, et al. 5' modifications to CRISPR-Cas9 gRNA can change the dynamics and size of R-loops and inhibit DNA cleavage. Nucleic Acids Res. 2020;48:6811-6823 pubmed publisher
Takagi M. Generation of an antibody recognizing a set of acetylated proteins, including subunits of BAF complexes. Biochem Biophys Rep. 2020;22:100720 pubmed publisher
Sun T, Kwok W, Chua K, Lo T, Potter J, Yew W, et al. Development of a Proline-Based Selection System for Reliable Genetic Engineering in Chinese Hamster Ovary Cells. ACS Synth Biol. 2020;9:1864-1872 pubmed publisher
Kataoka Y, Iimori M, Fujisawa R, Morikawa Ichinose T, Niimi S, Wakasa T, et al. DNA replication stress induced by trifluridine determines tumor cell fate according to p53 status. Mol Cancer Res. 2020;: pubmed publisher
Zhang B, Wang C, Zhang Y, Jiang Y, Qin Y, Pang D, et al. A CRISPR-engineered swine model of COL2A1 deficiency recapitulates altered early skeletal developmental defects in humans. Bone. 2020;137:115450 pubmed publisher
Yamagata T, Raveau M, Kobayashi K, Miyamoto H, Tatsukawa T, Ogiwara I, et al. CRISPR/dCas9-based Scn1a gene activation in inhibitory neurons ameliorates epileptic and behavioral phenotypes of Dravet syndrome model mice. Neurobiol Dis. 2020;141:104954 pubmed publisher
Tsai L, Lopezcolorado F, Bhargava R, Mendez Dorantes C, Jahanshir E, Stark J. RNF8 has both KU-dependent and independent roles in chromosomal break repair. Nucleic Acids Res. 2020;48:6032-6052 pubmed publisher
Yukimoto H, Miyamoto T, Kiyono T, Wang S, Matsuura S, Mizoguchi A, et al. A novel CDK-independent function of p27Kip1 in preciliary vesicle trafficking during ciliogenesis. Biochem Biophys Res Commun. 2020;527:716-722 pubmed publisher
Wang Z, Wang Y, Wang S, Gorzalski A, McSwiggin H, Yu T, et al. Efficient genome editing by CRISPR-Mb3Cas12a in mice. J Cell Sci. 2020;133: pubmed publisher
Vilardo E, Amman F, Toth U, Kötter A, Helm M, Rossmanith W. Functional characterization of the human tRNA methyltransferases TRMT10A and TRMT10B. Nucleic Acids Res. 2020;48:6157-6169 pubmed publisher
Leibold J, Ruscetti M, Cao Z, Ho Y, Baslan T, Zou M, et al. Somatic Tissue Engineering in Mouse Models Reveals an Actionable Role for WNT Pathway Alterations in Prostate Cancer Metastasis. Cancer Discov. 2020;10:1038-1057 pubmed publisher
Tian R, Pan Y, Etheridge T, Deshmukh H, Gulick D, Gibson G, et al. Pitfalls in Single Clone CRISPR-Cas9 Mutagenesis to Fine-map Regulatory Intervals. Genes (Basel). 2020;11: pubmed publisher
Miyamoto T, Hosoba K, Itabashi T, Iwane A, Akutsu S, Ochiai H, et al. Insufficiency of ciliary cholesterol in hereditary Zellweger syndrome. EMBO J. 2020;39:e103499 pubmed publisher
Avitan Hersh E, Feng Y, Oknin Vaisman A, Abu Ahmad Y, Zohar Y, Zhang T, et al. Regulation of eIF2α by RNF4 Promotes Melanoma Tumorigenesis and Therapy Resistance. J Invest Dermatol. 2020;: pubmed publisher
Gisler S, Maia A, Chandrasekaran G, Kopparam J, Van Lohuizen M. A genome-wide enrichment screen identifies NUMA1-loss as a resistance mechanism against mitotic cell-death induced by BMI1 inhibition. PLoS ONE. 2020;15:e0227592 pubmed publisher
Heigwer J, Kutzner J, Haeussler M, Burkhalter M, Draebing T, Juergensen L, et al. miR-103/107 regulates left-right asymmetry in zebrafish by modulating Kupffer's vesicle development and ciliogenesis. Biochem Biophys Res Commun. 2020;527:432-439 pubmed publisher
Mizuno Iijima S, Ayabe S, Kato K, Matoba S, Ikeda Y, Dinh T, et al. Efficient production of large deletion and gene fragment knock-in mice mediated by genome editing with Cas9-mouse Cdt1 in mouse zygotes. Methods. 2020;: pubmed publisher
Felce S, Anderson A, Maguire S, Gascoyne D, Armstrong R, Wong K, et al. CRISPR/Cas9-Mediated Foxp1 Silencing Restores Immune Surveillance in an Immunocompetent A20 Lymphoma Model. Front Oncol. 2020;10:448 pubmed publisher
Gao Q, Ouyang W, Kang B, Han X, Xiong Y, Ding R, et al. Selective targeting of the oncogenic KRAS G12S mutant allele by CRISPR/Cas9 induces efficient tumor regression. Theranostics. 2020;10:5137-5153 pubmed publisher
Negoro R, Kawai K, Ichikawa M, Deguchi S, Takayama K, Mizuguchi H. Establishment of MDR1-knockout human induced pluripotent stem cell line. Drug Metab Pharmacokinet. 2020;35:288-296 pubmed publisher
Amândio A, Lopez Delisle L, BOLT C, Mascrez B, Duboule D. A complex regulatory landscape involved in the development of mammalian external genitals. elife. 2020;9: pubmed publisher
Lee E, Hwang I, Lee J, Park J, Kim K, Kim I, et al. Hepatic stellate cell-specific knockout of transcriptional intermediary factor 1γ aggravates liver fibrosis. J Exp Med. 2020;217: pubmed publisher
He X, Chen W, Liu Z, Yu G, Chen Y, Cai Y, et al. Efficient and risk-reduced genome editing using double nicks enhanced by bacterial recombination factors in multiple species. Nucleic Acids Res. 2020;48:e57 pubmed publisher
Molenaar T, Pagès Gallego M, Meyn V, van Leeuwen F. Application of Recombination -Induced Tag Exchange (RITE) to study histone dynamics in human cells. Epigenetics. 2020;:1-13 pubmed publisher
Atchison D, O Connor C, Menon R, Otto E, Ganesh S, Wiggins R, et al. Hypertension induces glomerulosclerosis in phospholipase C-ε1 deficiency. Am J Physiol Renal Physiol. 2020;318:F1177-F1187 pubmed publisher
Loe T, Li J, Zhang Y, Azeroglu B, BODDY M, Denchi E. Telomere length heterogeneity in ALT cells is maintained by PML-dependent localization of the BTR complex to telomeres. Genes Dev. 2020;34:650-662 pubmed publisher
Dinh Q, Vinh A, Kim H, Saini N, Broughton B, Chrissobolis S, et al. Aldosterone-Induced Hypertension is Sex-Dependent, Mediated by T Cells and Sensitive to GPER Activation. Cardiovasc Res. 2020;: pubmed publisher
Zhong H, Ren Z, Wang X, Miao K, Ni W, Meng Y, et al. Stagewise keratinocyte differentiation from human embryonic stem cells by defined signal transduction modulators. Int J Biol Sci. 2020;16:1450-1462 pubmed publisher
Peng B, Li W, Ding J, He Y, Ran T, Xie B, et al. A hypermethylation strategy utilized by enhancer-bound CARM1 to promote estrogen receptor α-dependent transcriptional activation and breast carcinogenesis. Theranostics. 2020;10:3451-3473 pubmed publisher
Hölper J, Klupp B, Luxton G, Franzke K, Mettenleiter T. Function of Torsin AAA+ ATPases in Pseudorabies Virus Nuclear Egress. Cells. 2020;9: pubmed publisher
Renema P, Hardy K, Housley N, Dunbar G, Annamdevula N, Britain A, et al. cAMP signaling primes lung endothelial cells to activate caspase-1 during Pseudomonas aeruginosa infection. Am J Physiol Lung Cell Mol Physiol. 2020;318:L1074-L1083 pubmed publisher
Sanlialp A, Schumacher D, Kiper L, Varma E, Riechert E, Ho T, et al. Saraf-dependent activation of mTORC1 regulates cardiac growth. J Mol Cell Cardiol. 2020;141:30-42 pubmed publisher
He D, Li T, Sheng M, Yang B. Exonuclease 1 (Exo1) Participates in Mammalian Non-Homologous End Joining and Contributes to Drug Resistance in Ovarian Cancer. Med Sci Monit. 2020;26:e918751 pubmed publisher
Billon P, Nambiar T, Hayward S, Zafra M, Schatoff E, Oshima K, et al. Detection of Marker-Free Precision Genome Editing and Genetic Variation through the Capture of Genomic Signatures. Cell Rep. 2020;30:3280-3295.e6 pubmed publisher
ERIKCI ERTUNC M, Kok B, Parsons W, Wang J, Tan D, Donaldson C, et al. AIG1 and ADTRP are endogenous hydrolases of fatty acid esters of hydroxy fatty acids (FAHFAs) in mice. J Biol Chem. 2020;295:5891-5905 pubmed publisher
Kulcsár P, Tálas A, Tóth E, Nyeste A, Ligeti Z, Welker Z, et al. Blackjack mutations improve the on-target activities of increased fidelity variants of SpCas9 with 5'G-extended sgRNAs. Nat Commun. 2020;11:1223 pubmed publisher
Kovacsics D, Brozik A, Tihanyi B, Matula Z, Borsy A, Mészáros N, et al. Precision-engineered reporter cell lines reveal ABCG2 regulation in live lung cancer cells. Biochem Pharmacol. 2020;175:113865 pubmed publisher
Lennox A, Hoye M, Jiang R, Johnson Kerner B, Suit L, Venkataramanan S, et al. Pathogenic DDX3X Mutations Impair RNA Metabolism and Neurogenesis during Fetal Cortical Development. Neuron. 2020;106:404-420.e8 pubmed publisher
Villaseñor R, Pfaendler R, Ambrosi C, Butz S, Giuliani S, Bryan E, et al. ChromID identifies the protein interactome at chromatin marks. Nat Biotechnol. 2020;38:728-736 pubmed publisher
Waku T, Nakamura N, Koji M, Watanabe H, Katoh H, Tatsumi C, et al. NRF3-POMP-20S Proteasome Assembly Axis Promotes Cancer Development via Ubiquitin-Independent Proteolysis of p53 and Retinoblastoma Protein. Mol Cell Biol. 2020;40: pubmed publisher
Boettcher A, Li Y, Ahrens A, Kiupel M, Byrne K, Loving C, et al. Novel Engraftment and T Cell Differentiation of Human Hematopoietic Cells in ART-/-IL2RG-/Y SCID Pigs. Front Immunol. 2020;11:100 pubmed publisher
Loregger A, Raaben M, Nieuwenhuis J, Tan J, Jae L, van den Hengel L, et al. Haploid genetic screens identify SPRING/C12ORF49 as a determinant of SREBP signaling and cholesterol metabolism. Nat Commun. 2020;11:1128 pubmed publisher
Yamada N, Karasawa T, Kimura H, Watanabe S, Komada T, Kamata R, et al. Ferroptosis driven by radical oxidation of n-6 polyunsaturated fatty acids mediates acetaminophen-induced acute liver failure. Cell Death Dis. 2020;11:144 pubmed publisher
Deng H, Tan S, Gao X, Zou C, Xu C, Tu K, et al. Cdk5 knocking out mediated by CRISPR-Cas9 genome editing for PD-L1 attenuation and enhanced antitumor immunity. Acta Pharm Sin B. 2020;10:358-373 pubmed publisher
Brueckner L, Zhao P, van Schaik T, Leemans C, Sima J, Peric Hupkes D, et al. Local rewiring of genome-nuclear lamina interactions by transcription. EMBO J. 2020;39:e103159 pubmed publisher
Beckermann T, Welch R, Williams F, Mortlock D, Sha F, IKIZLER T, et al. CRISPR/Cas9 engineering of albino cystinuria Type A mice. Genesis. 2020;58:e23357 pubmed publisher
Zheng X, Arias E, Qi N, Saunders T, Cartee G. In vivo glucoregulation and tissue-specific glucose uptake in female Akt substrate 160 kDa knockout rats. PLoS ONE. 2020;15:e0223340 pubmed publisher
Okumura G, Iguchi Manaka A, Murata R, Yamashita Kanemaru Y, Shibuya A, Shibuya K. Tumor-derived soluble CD155 inhibits DNAM-1-mediated antitumor activity of natural killer cells. J Exp Med. 2020;217: pubmed publisher
Kiso A, Toba Y, Tsutsumi S, Deguchi S, Igai K, Koshino S, et al. Tolloid-Like 1 Negatively Regulates Hepatic Differentiation of Human Induced Pluripotent Stem Cells Through Transforming Growth Factor Beta Signaling. Hepatol Commun. 2020;4:255-267 pubmed publisher
Mejhert N, Kuruvilla L, Gabriel K, Elliott S, Guie M, Wang H, et al. Partitioning of MLX-Family Transcription Factors to Lipid Droplets Regulates Metabolic Gene Expression. Mol Cell. 2020;77:1251-1264.e9 pubmed publisher
Mendez Dorantes C, Tsai L, Jahanshir E, Lopezcolorado F, Stark J. BLM has Contrary Effects on Repeat-Mediated Deletions, based on the Distance of DNA DSBs to a Repeat and Repeat Divergence. Cell Rep. 2020;30:1342-1357.e4 pubmed publisher
Kubo S, Murata C, Okamura H, Sakasegawa T, Sakurai C, Hatsuzawa K, et al. Oct motif variants in Beckwith-Wiedemann syndrome patients disrupt maintenance of the hypomethylated state of the H19/IGF2 imprinting control region. FEBS Lett. 2020;594:1517-1531 pubmed publisher
Igarashi R, Yamashita S, Yamashita T, Inoue K, Fukuda T, Fukuchi T, et al. Gemcitabine induces Parkin-independent mitophagy through mitochondrial-resident E3 ligase MUL1-mediated stabilization of PINK1. Sci Rep. 2020;10:1465 pubmed publisher
Laparidou M, Schlickenrieder A, Thoma T, Lengyel K, Schusser B. Blocking of the CXCR4-CXCL12 Interaction Inhibits the Migration of Chicken B Cells Into the Bursa of Fabricius. Front Immunol. 2019;10:3057 pubmed publisher
Momoi Y, Nishikimi A, Du G, Kataoka T, Katagiri K. Phosphatidic acid regulates subcellular distribution of RA-GEFs critical for chemokine-dependent migration. Biochem Biophys Res Commun. 2020;524:325-331 pubmed publisher
Xu C, Zhou Z, Liu C, Kang X, Zhong X, Zhang Q, et al. Generation of a DAPK1 knockout first (conditional ready) human embryonic stem cell line (ZSSYe001-A) by CRISPR-Cas9 technology. Stem Cell Res. 2020;43:101693 pubmed publisher
Emmer B, Lascuna P, Tang V, Kotnik E, Saunders T, Khoriaty R, et al. Murine Surf4 is essential for early embryonic development. PLoS ONE. 2020;15:e0227450 pubmed publisher
Chen J, An B, Yu B, Peng X, Yuan H, Yang Q, et al. CRISPR/Cas9-mediated knockin of human factor IX into swine factor IX locus effectively alleviates bleeding in hemophilia B pigs. Haematologica. 2020;: pubmed publisher
Daer R, Hamna F, Barrett C, Haynes K. Site-directed targeting of transcriptional activation-associated proteins to repressed chromatin restores CRISPR activity. APL Bioeng. 2020;4:016102 pubmed publisher
Kozielewicz P, Turku A, Bowin C, Petersen J, Valnohova J, Canizal M, et al. Structural insight into small molecule action on Frizzleds. Nat Commun. 2020;11:414 pubmed publisher
Wen L, Zhao C, Song J, Ma L, Ruan J, Xia X, et al. CRISPR/Cas9-Mediated TERT Disruption in Cancer Cells. Int J Mol Sci. 2020;21: pubmed publisher
Meadows S, Brandsmeier L, Newberry K, Betti M, Nesmith A, Mackiewicz M, et al. Epitope Tagging ChIP-Seq of DNA Binding Proteins Using CETCh-Seq. Methods Mol Biol. 2020;2117:3-34 pubmed publisher
Jo A, Ringel Scaia V, McDaniel D, Thomas C, Zhang R, Riffle J, et al. Fabrication and characterization of PLGA nanoparticles encapsulating large CRISPR-Cas9 plasmid. J Nanobiotechnology. 2020;18:16 pubmed publisher
Yan N, Sun Y, Fang Y, Deng J, Mu L, Xu K, et al. A Universal Surrogate Reporter for Efficient Enrichment of CRISPR/Cas9-Mediated Homology-Directed Repair in Mammalian Cells. Mol Ther Nucleic Acids. 2020;19:775-789 pubmed publisher
Jin J, Xie S, Sun Q, Huang Z, Chen K, Guo D, et al. Upregulation of BCAM and its sense lncRNA BAN are associated with gastric cancer metastasis and poor prognosis. Mol Oncol. 2020;14:829-845 pubmed publisher
Hu O, Provvido A, Zhu Y. Generation of IL17RB Knockout Cell Lines Using CRISPR/Cas9-Based Genome Editing. Methods Mol Biol. 2020;2108:345-353 pubmed publisher
Matsuzaki H, Kuramochi D, Okamura E, Hirakawa K, Ushiki A, Tanimoto K. Recapitulation of gametic DNA methylation and its post-fertilization maintenance with reassembled DNA elements at the mouse Igf2/H19 locus. Epigenetics Chromatin. 2020;13:2 pubmed publisher
Pooley J, Rivers C, Kilcooley M, Paul S, Cavga A, Kershaw Y, et al. Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA. PLoS ONE. 2020;15:e0227520 pubmed publisher
Zhao Z, Zhang R, Fu G, Zhang R, Nie Y, Sun C, et al. The Complete Genome of Emcibacter congregatus ZYLT, a Marine Bacterium Encoding a CRISPR-Cas 9 Immune System. Curr Microbiol. 2020;77:762-768 pubmed publisher
Tanaka M, Shiota M, Koyama M, Nakayama J, Yashiro M, Semba K, et al. Generation of Rat Monoclonal Antibodies Specific for Human Stromal Cell-Derived Factor-2. Monoclon Antib Immunodiagn Immunother. 2020;39:23-26 pubmed publisher
Oji A, Isotani A, Fujihara Y, Castaneda J, Oura S, Ikawa M. Tesmin, Metallothionein-Like 5, is Required for Spermatogenesis in Mice†. Biol Reprod. 2020;102:975-983 pubmed publisher
Wang W, Zuidema A, Te Molder L, Nahidiazar L, Hoekman L, Schmidt T, et al. Hemidesmosomes modulate force generation via focal adhesions. J Cell Biol. 2020;219: pubmed publisher
Gu B, Pósfai E, Gertsenstein M, Rossant J. Efficient Generation of Large-Fragment Knock-In Mouse Models Using 2-Cell (2C)-Homologous Recombination (HR)-CRISPR. Curr Protoc Mouse Biol. 2020;10:e67 pubmed publisher
Kawai K, Negoro R, Ichikawa M, Yamashita T, Deguchi S, Harada K, et al. Establishment of SLC15A1/PEPT1-Knockout Human-Induced Pluripotent Stem Cell Line for Intestinal Drug Absorption Studies. Mol Ther Methods Clin Dev. 2020;17:49-57 pubmed publisher
Gomez Giro G, Arias Fuenzalida J, Jarazo J, Zeuschner D, Ali M, Possemis N, et al. Synapse alterations precede neuronal damage and storage pathology in a human cerebral organoid model of CLN3-juvenile neuronal ceroid lipofuscinosis. Acta Neuropathol Commun. 2019;7:222 pubmed publisher
Shinoda K, Maman Y, Canela A, Schatz D, Livak F, Nussenzweig A. Intra-Vκ Cluster Recombination Shapes the Ig Kappa Locus Repertoire. Cell Rep. 2019;29:4471-4481.e6 pubmed publisher
Madhusudhan N, Hu B, Mishra P, Calva Moreno J, Patel K, Boriack R, et al. Target Discovery of Selective Non-Small-Cell Lung Cancer Toxins Reveals Inhibitors of Mitochondrial Complex I. ACS Chem Biol. 2019;: pubmed publisher
Xie Z, Jiao H, Xiao H, Jiang Y, Liu Z, Qi C, et al. Generation of pRSAD2 gene knock-in pig via CRISPR/Cas9 technology. Antiviral Res. 2019;174:104696 pubmed publisher
Zhao Y, Zhou J, He L, Li Y, Yuan J, Sun K, et al. MyoD induced enhancer RNA interacts with hnRNPL to activate target gene transcription during myogenic differentiation. Nat Commun. 2019;10:5787 pubmed publisher
van Esbroeck A, Kantae V, Di X, van der Wel T, den Dulk H, Stevens A, et al. Identification of α,β-Hydrolase Domain Containing Protein 6 as a Diacylglycerol Lipase in Neuro-2a Cells. Front Mol Neurosci. 2019;12:286 pubmed publisher
Li P, Zhang L, Li Z, Xu C, Du X, Wu S. Cas12a mediates efficient and precise endogenous gene tagging via MITI: microhomology-dependent targeted integrations. Cell Mol Life Sci. 2019;: pubmed publisher
McIlroy G, Mitchell S, Han W, Delibegovic M, Rochford J. Ablation of Bscl2/Seipin in hepatocytes does not cause metabolic dysfunction in congenital generalised lipodystrophy. Dis Model Mech. 2019;: pubmed publisher
Takeishi Y, Fujikane R, Rikitake M, Obayashi Y, Sekiguchi M, Hidaka M. SMARCAD1-mediated recruitment of the DNA mismatch repair protein MutLα to MutSα on damaged chromatin induces apoptosis in human cells. J Biol Chem. 2019;: pubmed publisher
Gamache A, Cronk J, Nash W, Puchalski P, Gillespie A, Wei H, et al. Ly49R activation receptor drives self-MHC-educated NK cell immunity against cytomegalovirus infection. Proc Natl Acad Sci U S A. 2019;: pubmed publisher
Bogutz A, Brind Amour J, Kobayashi H, Jensen K, Nakabayashi K, Imai H, et al. Evolution of imprinting via lineage-specific insertion of retroviral promoters. Nat Commun. 2019;10:5674 pubmed publisher
Wang H, Loerke D, Bruns C, Müller R, Koch P, Puchkov D, et al. Phosphatidylinositol 3,4-bisphosphate synthesis and turnover are spatially segregated in the endocytic pathway. J Biol Chem. 2019;: pubmed publisher
Li B, Ren N, Yang L, Liu J, Huang Q. A qPCR method for genome editing efficiency determination and single-cell clone screening in human cells. Sci Rep. 2019;9:18877 pubmed publisher
Tsukiyama T, Kobayashi K, Nakaya M, Iwatani C, Seita Y, Tsuchiya H, et al. Monkeys mutant for PKD1 recapitulate human autosomal dominant polycystic kidney disease. Nat Commun. 2019;10:5517 pubmed publisher
Kunimoto H, Inoue A, Kojima H, Yang J, Zhao H, Tsuruta D, et al. RBM10 regulates centriole duplication in HepG2 cells by ectopically assembling PLK4-STIL complexes in the nucleus. Genes Cells. 2019;: pubmed publisher
Li G, Zhang X, Wang H, Mo J, Zhong C, Shi J, et al. CRISPR/Cas9-Mediated Integration of Large Transgene into Pig CEP112 Locus. G3 (Bethesda). 2019;: pubmed publisher
Browning J, Rooney M, Hams E, Takahashi S, Mizuno S, Sugiyama F, et al. Highly efficient CRISPR-targeting of the murine Hipp11 intergenic region supports inducible human transgene expression. Mol Biol Rep. 2019;: pubmed publisher
Eaton J, Francis L, Davidson L, West S. A unified allosteric/torpedo mechanism for transcriptional termination on human protein-coding genes. Genes Dev. 2019;: pubmed publisher
Takakura M, Ishiguro K, Akichika S, Miyauchi K, Suzuki T. Biogenesis and functions of aminocarboxypropyluridine in tRNA. Nat Commun. 2019;10:5542 pubmed publisher
Chang Y, Katoh M, Abdellatif A, Xiafukaiti G, Elzeftawy A, Ojima M, et al. Uncovering the role of MAFB in glucagon production and secretion in pancreatic α-cells using a new α-cell-specific Mafb conditional knockout mouse model. Exp Anim. 2019;: pubmed publisher
Kelly T, Brümmer A, Hooshdaran N, Tariveranmoshabad M, Zamudio J. Temporal Control of the TGF-β Signaling Network by Mouse ESC MicroRNA Targets of Different Affinities. Cell Rep. 2019;29:2702-2717.e7 pubmed publisher
Steinmann S, Kunze P, Hampel C, Eckstein M, Bertram Bramsen J, Muenzner J, et al. DAPK1 loss triggers tumor invasion in colorectal tumor cells. Cell Death Dis. 2019;10:895 pubmed publisher
Daga S, Donati F, Capitani K, Croci S, Tita R, Giliberti A, et al. New frontiers to cure Alport syndrome: COL4A3 and COL4A5 gene editing in podocyte-lineage cells. Eur J Hum Genet. 2019;: pubmed publisher
Beauchemin H, Shooshtharizadeh P, Pinder J, Dellaire G, Moroy T. Dominant negative Gfi1b mutations cause moderate thrombocytopenia and an impaired stress thrombopoiesis associated with mild erythropoietic abnormalities in mice. Haematologica. 2019;: pubmed publisher
Bhargava R, Lopezcolorado F, Tsai L, Stark J. The canonical non-homologous end joining factor XLF promotes chromosomal deletion rearrangements in human cells. J Biol Chem. 2019;: pubmed publisher
Majumder P, Lee J, Rahmberg A, Kumar G, Mi T, Scharer C, et al. A super enhancer controls expression and chromatin architecture within the MHC class II locus. J Exp Med. 2020;217: pubmed publisher
Costello R, Cantillo J, Kenter A. Chicken MBD4 Regulates Immunoglobulin Diversification by Somatic Hypermutation. Front Immunol. 2019;10:2540 pubmed publisher
Fukuda A, Honda S, Fujioka N, Sekiguchi Y, Mizuno S, Miwa Y, et al. Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720. PLoS ONE. 2019;14:e0225213 pubmed publisher
Wei P, Xue W, Zhao Y, Ning G, WANG J. CRISPR-based modular assembly of a UAS-cDNA/ORF plasmid library for more than 5500 Drosophila genes conserved in humans. Genome Res. 2019;: pubmed publisher
Brosig A, Fuchs J, Ipek F, Kroon C, Schrötter S, Vadhvani M, et al. The Axonal Membrane Protein PRG2 Inhibits PTEN and Directs Growth to Branches. Cell Rep. 2019;29:2028-2040.e8 pubmed publisher
Gupta S, Dixit S, Dangi S, Kaur G, Mashooq M, Karthik K, et al. Marker-less deletion of cctA gene of Clostridium chauvoei. Anaerobe. 2019;61:102116 pubmed publisher
Hara Y, Minami Y, Yoshimoto S, Hayashi N, Yamasaki A, Ueda S, et al. Anti-tumor effects of an antagonistic mAb against the ASCT2 amino acid transporter on KRAS-mutated human colorectal cancer cells. Cancer Med. 2019;: pubmed publisher
Tang L, Yang F, He X, Xie H, Liu X, Fu J, et al. Efficient cleavage resolves PAM preferences of CRISPR-Cas in human cells. Cell Regen (Lond). 2019;8:44-50 pubmed publisher
Perretta Tejedor N, Freke G, Seda M, Long D, Jenkins D. Generating Mutant Renal Cell Lines Using CRISPR Technologies. Methods Mol Biol. 2020;2067:323-340 pubmed publisher
Ting T, Goralski M, Klein K, Wang B, Kim J, Xie Y, et al. Aryl Sulfonamides Degrade RBM39 and RBM23 by Recruitment to CRL4-DCAF15. Cell Rep. 2019;29:1499-1510.e6 pubmed publisher
Jin S, Alsahafi N, Kuang X, Swann S, Toyoda M, Gottlinger H, et al. Natural HIV-1 Nef Polymorphisms Impair SERINC5 Downregulation Activity. Cell Rep. 2019;29:1449-1457.e5 pubmed publisher
Mahib M, Hosojima S, Kushiyama H, Kinoshita T, Shiroishi T, Suda T, et al. Caspase-7 mediates caspase-1-induced apoptosis independently of Bid. Microbiol Immunol. 2019;: pubmed publisher
Cortázar M, Sheridan R, Erickson B, Fong N, Glover Cutter K, BRANNAN K, et al. Control of RNA Pol II Speed by PNUTS-PP1 and Spt5 Dephosphorylation Facilitates Termination by a "Sitting Duck Torpedo" Mechanism. Mol Cell. 2019;76:896-908.e4 pubmed publisher
Tatsumi G, Kawahara M, Yamamoto R, Hishizawa M, Kito K, Suzuki T, et al. LSD1-mediated repression of GFI1 super-enhancer plays an essential role in erythroleukemia. Leukemia. 2019;: pubmed publisher
Joseph J, Qu L, Wang S, Kim M, Bennett D, RO J, et al. Phosphorylation of TRPV1 S801 Contributes to Modality-Specific Hyperalgesia in Mice. J Neurosci. 2019;39:9954-9966 pubmed publisher
Attwood K, Salsman J, Chung D, Mathavarajah S, Van Iderstine C, Dellaire G. PML isoform expression and DNA break location relative to PML nuclear bodies impacts the efficiency of homologous recombination. Biochem Cell Biol. 2019;: pubmed publisher
Zhang X, Zhang Y, Ba Z, Kyritsis N, Casellas R, Alt F. Fundamental roles of chromatin loop extrusion in antibody class switching. Nature. 2019;575:385-389 pubmed publisher
Someda M, Kuroki S, Miyachi H, Tachibana M, Yonehara S. Caspase-8, receptor-interacting protein kinase 1 (RIPK1), and RIPK3 regulate retinoic acid-induced cell differentiation and necroptosis. Cell Death Differ. 2019;: pubmed publisher
Zou X, Ouyang H, Yu T, Chen X, Pang D, Tang X, et al. Preparation of a new type 2 diabetic miniature pig model via the CRISPR/Cas9 system. Cell Death Dis. 2019;10:823 pubmed publisher
Andreeva A, Bekkhozhin Z, Omertassova N, Baizhumanov T, Yeltay G, Akhmetali M, et al. The apparent deglycase activity of DJ-1 results from the conversion of free methylglyoxal present in fast equilibrium with hemithioacetals and hemiaminals. J Biol Chem. 2019;294:18863-18872 pubmed publisher
Honda A, Miyazaki T, Iwamoto J, Hirayama T, Morishita Y, Monma T, et al. Regulations of bile acid metabolism in mouse models with hydrophobic bile acid composition. J Lipid Res. 2019;: pubmed publisher
Bowen C, Calderón Giadrosic J, Burger Z, Rykiel G, Davis E, Helmers M, et al. Targetable cellular signaling events mediate vascular pathology in vascular Ehlers-Danlos syndrome. J Clin Invest. 2019;: pubmed publisher
Lamas Toranzo I, Fonseca Balvís N, Querejeta Fernández A, Izquierdo Rico M, González Brusi L, Lorenzo P, et al. ZP4 confers structural properties to the zona pellucida essential for embryo development. elife. 2019;8: pubmed publisher
Elbatsh A, Kim E, Eeftens J, Raaijmakers J, van der Weide R, García Nieto A, et al. Distinct Roles for Condensin's Two ATPase Sites in Chromosome Condensation. Mol Cell. 2019;76:724-737.e5 pubmed publisher
Kawasaki K, Fujii M, Sugimoto S, Ishikawa K, Matano M, Ohta Y, et al. Chromosome Engineering of Human Colon-Derived Organoids to Develop a Model of Traditional Serrated Adenoma. Gastroenterology. 2019;: pubmed publisher
Avasarala S, Wu P, Khan S, Yanlin S, Van Scoyk M, Bao J, et al. PRMT6 Promotes Lung Tumor Progression via the Alternate Activation of Tumor-Associated Macrophages. Mol Cancer Res. 2019;: pubmed publisher
Velusamy T, Gowripalan A, Tscharke D. CRISPR/Cas9-Based Genome Editing of HSV. Methods Mol Biol. 2020;2060:169-183 pubmed publisher
Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Biomolecules. 2019;9: pubmed publisher
Shi M, Kawabe Y, Ito A, Kamihira M. Targeted knock-in into the OVA locus of chicken cells using CRISPR/Cas9 system with homology-independent targeted integration. J Biosci Bioeng. 2019;: pubmed publisher
Fischer K, Rieblinger B, Hein R, Sfriso R, Zuber J, Fischer A, et al. Viable pigs after simultaneous inactivation of porcine MHC class I and three xenoreactive antigen genes GGTA1, CMAH and B4GALNT2. Xenotransplantation. 2019;:e12560 pubmed publisher
Chen L, Strohmeier V, He Z, Deshpande M, Catalan Dibene J, Durum S, et al. Interleukin 22 disrupts pancreatic function in newborn mice expressing IL-23. Nat Commun. 2019;10:4517 pubmed publisher
Jostes S, Fellermeyer M, Arévalo L, Merges G, Kristiansen G, Nettersheim D, et al. Unique and redundant roles of SOX2 and SOX17 in regulating the germ cell tumor fate. Int J Cancer. 2019;: pubmed publisher
Han D, Schomacher L, Schüle K, Mallick M, Musheev M, Karaulanov E, et al. NEIL1 and NEIL2 DNA glycosylases protect neural crest development against mitochondrial oxidative stress. elife. 2019;8: pubmed publisher
Flesher J, Paterson Coleman E, Vasudeva P, Ruiz Vega R, Marshall M, Pearlman E, et al. Delineating the role of MITF isoforms in pigmentation and tissue homeostasis. Pigment Cell Melanoma Res. 2019;: pubmed publisher
Strebinger D, Deluz C, Friman E, Govindan S, Alber A, Suter D. Endogenous fluctuations of OCT4 and SOX2 bias pluripotent cell fate decisions. Mol Syst Biol. 2019;15:e9002 pubmed publisher
Yang J, Kunimoto H, Katayama B, Zhao H, Shiromizu T, Wang L, et al. PhosphoSer727 triggers a multi-step inactivation of STAT3 by rapid dissociation of pY705-SH2 through C-terminal tail modulation. Int Immunol. 2019;: pubmed publisher
Xing G, Jing H, Zhang L, Cao Y, Li L, Zhao K, et al. A mechanism in agrin signaling revealed by a prevalent Rapsyn mutation in congenital myasthenic syndrome. elife. 2019;8: pubmed publisher
Suzuki T, Kohyama K, Moriyama K, Ozaki M, Hasegawa S, Ueno T, et al. Extracellular ADP augments microglial inflammasome and NF-κB activation via the P2Y12 receptor. Eur J Immunol. 2019;: pubmed publisher
Xiang J, Kaplan M, Dykstra P, Hinks M, McKeague M, Smolke C. Massively parallel RNA device engineering in mammalian cells with RNA-Seq. Nat Commun. 2019;10:4327 pubmed publisher
Roman Rodriguez F, Ugalde L, Alvarez L, Díez B, Ramirez M, Risueño C, et al. NHEJ-Mediated Repair of CRISPR-Cas9-Induced DNA Breaks Efficiently Corrects Mutations in HSPCs from Patients with Fanconi Anemia. Cell Stem Cell. 2019;25:607-621.e7 pubmed publisher
Chang C, Chen C, Grauffel C, Pien Y, Lim C, Tsai S, et al. Ran pathway-independent regulation of mitotic Golgi disassembly by Importin-α. Nat Commun. 2019;10:4307 pubmed publisher
Vazquez C, Tan C, Horner S. Hepatitis C Virus Infection Is Inhibited by a Noncanonical Antiviral Signaling Pathway Targeted by NS3-NS4A. J Virol. 2019;93: pubmed publisher
Wang H, Shen L, Chen J, Liu X, Tan T, Hu Y, et al. Deletion of CD163 Exon 7 Confers Resistance to Highly Pathogenic Porcine Reproductive and Respiratory Viruses on Pigs. Int J Biol Sci. 2019;15:1993-2005 pubmed publisher
Pan H, Yu W, Zhang M. Homology-directed repair in mouse cells increased by CasRx-mediated knockdown or co-expressing Kaposi's sarcoma-associated herpesvirus ORF52. Biosci Rep. 2019;39: pubmed publisher
Lin S, Huang C, Gunda V, Sun J, Chellappan S, Li Z, et al. Fascin Controls Metastatic Colonization and Mitochondrial Oxidative Phosphorylation by Remodeling Mitochondrial Actin Filaments. Cell Rep. 2019;28:2824-2836.e8 pubmed publisher
Matsuda T, Oinuma I. Imaging endogenous synaptic proteins in primary neurons at single-cell resolution using CRISPR/Cas9. Mol Biol Cell. 2019;30:2838-2855 pubmed publisher
Nagano K, Kwon C, Ishida J, Hashimoto T, Kim J, Kishikawa N, et al. Cooperative action of APJ and α1A-adrenergic receptor in vascular smooth muscle cells induces vasoconstriction. J Biochem. 2019;166:383-392 pubmed publisher
Manna P, Davis L, Robinson M. Fast and cloning-free CRISPR/Cas9-mediated genomic editing in mammalian cells. Traffic. 2019;20:974-982 pubmed publisher
Callies L, Tadeo D, Simper J, Bugge T, Szabo R. Iterative, multiplexed CRISPR-mediated gene editing for functional analysis of complex protease gene clusters. J Biol Chem. 2019;294:15987-15996 pubmed publisher
Kohzaki M, Ootsuyama A, Sun L, Moritake T, Okazaki R. Human RECQL4 represses the RAD52-mediated single-strand annealing pathway after ionizing radiation or cisplatin treatment. Int J Cancer. 2020;146:3098-3113 pubmed publisher
Greenberg R, Long H, Swigut T, Wysocka J. Single Amino Acid Change Underlies Distinct Roles of H2A.Z Subtypes in Human Syndrome. Cell. 2019;178:1421-1436.e24 pubmed publisher
Wang X, Long Y, Paucek R, Gooding A, Lee T, Burdorf R, et al. Regulation of histone methylation by automethylation of PRC2. Genes Dev. 2019;33:1416-1427 pubmed publisher
Balligand T, Achouri Y, Pecquet C, Gaudray G, Colau D, Hug E, et al. Knock-in of murine Calr del52 induces essential thrombocythemia with slow-rising dominance in mice and reveals key role of Calr exon 9 in cardiac development. Leukemia. 2019;: pubmed publisher
Han X, Xiong Y, Zhao C, Xie S, Li C, Li X, et al. Identification of Glyceraldehyde-3-Phosphate Dehydrogenase Gene as an Alternative Safe Harbor Locus in Pig Genome. Genes (Basel). 2019;10: pubmed publisher
Chernyshova K, Inoue K, Yamashita S, Fukuchi T, Kanki T. Glaucoma-Associated Mutations in the Optineurin Gene Have Limited Impact on Parkin-Dependent Mitophagy. Invest Ophthalmol Vis Sci. 2019;60:3625-3635 pubmed publisher
Matsumoto S, Yamamichi T, Shinzawa K, Kasahara Y, Nojima S, Kodama T, et al. GREB1 induced by Wnt signaling promotes development of hepatoblastoma by suppressing TGFβ signaling. Nat Commun. 2019;10:3882 pubmed publisher
Mehravar M, Shirazi A, Mehrazar M, Nazari M, Banan M, Salimi M. Efficient Production of Biallelic RAG1 Knockout Mouse Embryonic Stem Cell Using CRISPR/Cas9. Iran J Biotechnol. 2019;17:e2205 pubmed publisher
Yoshimatsu S, Sone T, Nakajima M, Sato T, Okochi R, Ishikawa M, et al. A versatile toolbox for knock-in gene targeting based on the Multisite Gateway technology. PLoS ONE. 2019;14:e0221164 pubmed publisher
Pettibone J, Yu J, Derman R, Faust T, Hughes E, Filipiak W, et al. Knock-In Rat Lines with Cre Recombinase at the Dopamine D1 and Adenosine 2a Receptor Loci. Eneuro. 2019;6: pubmed publisher
Gurumurthy C, O Brien A, Quadros R, Adams J, Alcaide P, Ayabe S, et al. Reproducibility of CRISPR-Cas9 methods for generation of conditional mouse alleles: a multi-center evaluation. Genome Biol. 2019;20:171 pubmed publisher
Gómez H L, Felipe Medina N, Condezo Y, García Valiente R, Ramos I, Suja J, et al. The PSMA8 subunit of the spermatoproteasome is essential for proper meiotic exit and mouse fertility. PLoS Genet. 2019;15:e1008316 pubmed publisher
Buenaventura T, Bitsi S, Laughlin W, Burgoyne T, Lyu Z, Oqua A, et al. Agonist-induced membrane nanodomain clustering drives GLP-1 receptor responses in pancreatic beta cells. PLoS Biol. 2019;17:e3000097 pubmed publisher
Standage Beier K, Tekel S, Brookhouser N, Schwarz G, Nguyen T, Wang X, et al. A transient reporter for editing enrichment (TREE) in human cells. Nucleic Acids Res. 2019;47:e120 pubmed publisher
Leick K, Rodriguez A, Melssen M, Benamar M, Lindsay R, Eki R, et al. The Barrier Molecules Junction Plakoglobin, Filaggrin, and Dystonin Play Roles in Melanoma Growth and Angiogenesis. Ann Surg. 2019;270:712-722 pubmed publisher
van Karnebeek C, Ramos R, Wen X, Tarailo Graovac M, Gleeson J, Skrypnyk C, et al. Bi-allelic GOT2 Mutations Cause a Treatable Malate-Aspartate Shuttle-Related Encephalopathy. Am J Hum Genet. 2019;105:534-548 pubmed publisher
Lahaie S, Morales D, Bagci H, Hamoud N, Castonguay C, Kazan J, et al. The endosomal sorting adaptor HD-PTP is required for ephrin-B:EphB signalling in cellular collapse and spinal motor axon guidance. Sci Rep. 2019;9:11945 pubmed publisher
El Khattabi L, Zhao H, Kalchschmidt J, Young N, Jung S, van Blerkom P, et al. A Pliable Mediator Acts as a Functional Rather Than an Architectural Bridge between Promoters and Enhancers. Cell. 2019;178:1145-1158.e20 pubmed publisher
Tanave A, Imai Y, Koide T. Nested retrotransposition in the East Asian mouse genome causes the classical nonagouti mutation. Commun Biol. 2019;2:283 pubmed publisher
García Marqués J, Yang C, Espinosa Medina I, Mok K, Koyama M, Lee T. Unlimited Genetic Switches for Cell-Type-Specific Manipulation. Neuron. 2019;104:227-238.e7 pubmed publisher
Zhao Z, Wang L, Bartom E, Marshall S, Rendleman E, Ryan C, et al. β-Catenin/Tcf7l2-dependent transcriptional regulation of GLUT1 gene expression by Zic family proteins in colon cancer. Sci Adv. 2019;5:eaax0698 pubmed publisher
Matsuda T, Oinuma I. Optimized CRISPR/Cas9-mediated in vivo genome engineering applicable to monitoring dynamics of endogenous proteins in the mouse neural tissues. Sci Rep. 2019;9:11309 pubmed publisher
Kelso A, Lopezcolorado F, Bhargava R, Stark J. Distinct roles of RAD52 and POLQ in chromosomal break repair and replication stress response. PLoS Genet. 2019;15:e1008319 pubmed publisher
Gao F, Elliott N, Ho J, Sharp A, Shokhirev M, Hargreaves D. Heterozygous Mutations in SMARCA2 Reprogram the Enhancer Landscape by Global Retargeting of SMARCA4. Mol Cell. 2019;75:891-904.e7 pubmed publisher
Nambiar T, Billon P, Diedenhofen G, Hayward S, Taglialatela A, Cai K, et al. Stimulation of CRISPR-mediated homology-directed repair by an engineered RAD18 variant. Nat Commun. 2019;10:3395 pubmed publisher
Liu D, Awazu A, Sakuma T, Yamamoto T, Sakamoto N. Establishment of knockout adult sea urchins by using a CRISPR-Cas9 system. Dev Growth Differ. 2019;61:378-388 pubmed publisher
Paakinaho V, Johnson T, Presman D, Hager G. Glucocorticoid receptor quaternary structure drives chromatin occupancy and transcriptional outcome. Genome Res. 2019;29:1223-1234 pubmed publisher
Yasuda D, Kobayashi D, Akahoshi N, Ohto Nakanishi T, Yoshioka K, Takuwa Y, et al. Lysophosphatidic acid-induced YAP/TAZ activation promotes developmental angiogenesis by repressing Notch ligand Dll4. J Clin Invest. 2019;130:4332-4349 pubmed publisher
Olbrich T, Vega Sendino M, Murga M, de Carcer G, Malumbres M, Ortega S, et al. A Chemical Screen Identifies Compounds Capable of Selecting for Haploidy in Mammalian Cells. Cell Rep. 2019;28:597-604.e4 pubmed publisher
Zierhut C, Yamaguchi N, Paredes M, Luo J, Carroll T, Funabiki H. The Cytoplasmic DNA Sensor cGAS Promotes Mitotic Cell Death. Cell. 2019;178:302-315.e23 pubmed publisher
Sowinska W, Wawro M, Solecka A, Kasza A. Potential limitations of the Sleeping Beauty transposon use in gene expression studies. Acta Biochim Pol. 2019;66:263-268 pubmed publisher
Shinoda S, Kitagawa S, Nakagawa S, Wei F, Tomizawa K, Araki K, et al. Mammalian NSUN2 introduces 5-methylcytidines into mitochondrial tRNAs. Nucleic Acids Res. 2019;47:8734-8745 pubmed publisher
Benyelles M, Episkopou H, O Donohue M, Kermasson L, Frange P, Poulain F, et al. Impaired telomere integrity and rRNA biogenesis in PARN-deficient patients and knock-out models. EMBO Mol Med. 2019;11:e10201 pubmed publisher
Schertzer M, Braceros K, Starmer J, Cherney R, Lee D, Salazar G, et al. lncRNA-Induced Spread of Polycomb Controlled by Genome Architecture, RNA Abundance, and CpG Island DNA. Mol Cell. 2019;: pubmed publisher
Horigome Y, Ida Yonemochi H, Waguri S, Shibata S, Endo N, Komatsu M. Loss of autophagy in chondrocytes causes severe growth retardation. Autophagy. 2019;:1-11 pubmed publisher
Ruiz de Galarreta M, Bresnahan E, Molina Sánchez P, Lindblad K, Maier B, Sia D, et al. β-catenin activation promotes immune escape and resistance to anti-PD-1 therapy in hepatocellular carcinoma. Cancer Discov. 2019;: pubmed publisher
Park S, Lee C, Dever D, Davis T, Camarena J, Srifa W, et al. Highly efficient editing of the β-globin gene in patient-derived hematopoietic stem and progenitor cells to treat sickle cell disease. Nucleic Acids Res. 2019;47:7955-7972 pubmed publisher
van Bemmel J, Galupa R, Gard C, Servant N, Picard C, Davies J, et al. The bipartite TAD organization of the X-inactivation center ensures opposing developmental regulation of Tsix and Xist. Nat Genet. 2019;: pubmed publisher
MacDougall M, Clarke R, Merrill B. Intracellular Ca2+ Homeostasis and Nuclear Export Mediate Exit from Naive Pluripotency. Cell Stem Cell. 2019;: pubmed publisher
Schertzer M, Thulson E, Braceros K, Lee D, Hinkle E, Murphy R, et al. A piggyBac-based toolkit for inducible genome editing in mammalian cells. RNA. 2019;: pubmed publisher
Ishiuchi T, Ohishi H, Sato T, Kamimura S, Yorino M, Abe S, et al. Zfp281 Shapes the Transcriptome of Trophoblast Stem Cells and Is Essential for Placental Development. Cell Rep. 2019;27:1742-1754.e6 pubmed publisher
Burnight E, Bohrer L, Giacalone J, Klaahsen D, Daggett H, East J, et al. CRISPR-Cas9-Mediated Correction of the 1.02 kb Common Deletion in CLN3 in Induced Pluripotent Stem Cells from Patients with Batten Disease. CRISPR J. 2018;1:75-87 pubmed publisher
Alapati D, Zacharias W, Hartman H, Rossidis A, Stratigis J, Ahn N, et al. In utero gene editing for monogenic lung disease. Sci Transl Med. 2019;11: pubmed publisher
Huber J, Obata M, Gruber J, Akutsu M, Lohr F, Rogova N, et al. An atypical LIR motif within UBA5 (ubiquitin like modifier activating enzyme 5) interacts with GABARAP proteins and mediates membrane localization of UBA5. Autophagy. 2019;:1-15 pubmed publisher
Kweon S, Chen Y, Moon E, Kvederaviciute K, Klimasauskas S, Feldman D. An Adversarial DNA N6-Methyladenine-Sensor Network Preserves Polycomb Silencing. Mol Cell. 2019;74:1138-1147.e6 pubmed publisher
Tejero R, Huang Y, Katsyv I, Kluge M, Lin J, Tome Garcia J, et al. Gene signatures of quiescent glioblastoma cells reveal mesenchymal shift and interactions with niche microenvironment. EBioMedicine. 2019;42:252-269 pubmed publisher
Leimbacher P, Jones S, Shorrocks A, De Marco Zompit M, Day M, Blaauwendraad J, et al. MDC1 Interacts with TOPBP1 to Maintain Chromosomal Stability during Mitosis. Mol Cell. 2019;74:571-583.e8 pubmed publisher
Gasset Rosa F, Lu S, Yu H, Chen C, Melamed Z, Guo L, et al. Cytoplasmic TDP-43 De-mixing Independent of Stress Granules Drives Inhibition of Nuclear Import, Loss of Nuclear TDP-43, and Cell Death. Neuron. 2019;102:339-357.e7 pubmed publisher
Tai Y, Gallo N, Wang M, Yu J, Van Aelst L. Axo-axonic Innervation of Neocortical Pyramidal Neurons by GABAergic Chandelier Cells Requires AnkyrinG-Associated L1CAM. Neuron. 2019;102:358-372.e9 pubmed publisher
Nakamura K, Saredi G, Becker J, Foster B, Nguyen N, Beyer T, et al. H4K20me0 recognition by BRCA1-BARD1 directs homologous recombination to sister chromatids. Nat Cell Biol. 2019;21:311-318 pubmed publisher
Guo L, Lin L, Wang X, Gao M, Cao S, Mai Y, et al. Resolving Cell Fate Decisions during Somatic Cell Reprogramming by Single-Cell RNA-Seq. Mol Cell. 2019;73:815-829.e7 pubmed publisher
Kubli S, Bassi C, Roux C, Wakeham A, Göbl C, Zhou W, et al. AhR controls redox homeostasis and shapes the tumor microenvironment in BRCA1-associated breast cancer. Proc Natl Acad Sci U S A. 2019;116:3604-3613 pubmed publisher
Sahara M, Santoro F, Sohlmér J, Zhou C, Witman N, Leung C, et al. Population and Single-Cell Analysis of Human Cardiogenesis Reveals Unique LGR5 Ventricular Progenitors in Embryonic Outflow Tract. Dev Cell. 2019;48:475-490.e7 pubmed publisher
So C, Ramachandran S, Martin A. E3 Ubiquitin Ligases RNF20 and RNF40 Are Required for Double-Stranded Break (DSB) Repair: Evidence for Monoubiquitination of Histone H2B Lysine 120 as a Novel Axis of DSB Signaling and Repair. Mol Cell Biol. 2019;39: pubmed publisher
Hayashi Y, Jia W, Kidoya H, Muramatsu F, Tsukada Y, Takakura N. Galectin-3 Inhibits Cancer Metastasis by Negatively Regulating Integrin β3 Expression. Am J Pathol. 2019;189:900-910 pubmed publisher
Kusakabe S, Suzuki T, Sugiyama Y, Haga S, Horike K, Tokunaga M, et al. USP15 Participates in Hepatitis C Virus Propagation through Regulation of Viral RNA Translation and Lipid Droplet Formation. J Virol. 2019;93: pubmed publisher
Walczak C, Leto D, Zhang L, Riepe C, Muller R, DaRosa P, et al. Ribosomal protein RPL26 is the principal target of UFMylation. Proc Natl Acad Sci U S A. 2019;116:1299-1308 pubmed publisher
Wang J, Liu M, Zhao L, Li Y, Zhang M, Jin Y, et al. Disabling of nephrogenesis in porcine embryos via CRISPR/Cas9-mediated SIX1 and SIX4 gene targeting. Xenotransplantation. 2019;26:e12484 pubmed publisher
Matsumura T, Endo T, Isotani A, Ogawa M, Ikawa M. An azoospermic factor gene, Ddx3y and its paralog, Ddx3x are dispensable in germ cells for male fertility. J Reprod Dev. 2019;65:121-128 pubmed publisher
Takano T, Bareke E, Takeda N, Aoudjit L, Baldwin C, Pisano P, et al. Recessive mutation in CD2AP causes focal segmental glomerulosclerosis in humans and mice. Kidney Int. 2019;95:57-61 pubmed publisher
Wang J, Hao J, Wang X, Guo H, Sun H, Lai X, et al. DHHC4 and DHHC5 Facilitate Fatty Acid Uptake by Palmitoylating and Targeting CD36 to the Plasma Membrane. Cell Rep. 2019;26:209-221.e5 pubmed publisher
Tan R, Liu J, Zhang Y, Wang H, Li J, Liu Y, et al. Curcumin relieved cisplatin-induced kidney inflammation through inhibiting Mincle-maintained M1 macrophage phenotype. Phytomedicine. 2019;52:284-294 pubmed publisher
Allan C, Heizer P, Tu Y, Sandoval N, Jung R, Morales J, et al. An upstream enhancer regulates Gpihbp1 expression in a tissue-specific manner. J Lipid Res. 2018;: pubmed publisher
Lillo Osuna M, García López J, El Ayachi I, Fatima I, Khalid A, Kumpati J, et al. Activation of Estrogen Receptor Alpha by Decitabine Inhibits Osteosarcoma Growth and Metastasis. Cancer Res. 2019;79:1054-1068 pubmed publisher
Dodo M, Kitamura H, Shima H, Saigusa D, Wati S, Ota N, et al. Lactate dehydrogenase C is required for the protein expression of a sperm-specific isoform of lactate dehydrogenase A. J Biochem. 2019;165:323-334 pubmed publisher
Pozner T, Schray A, Regensburger M, Lie D, Schlötzer Schrehardt U, Winkler J, et al. Tideglusib Rescues Neurite Pathology of SPG11 iPSC Derived Cortical Neurons. Front Neurosci. 2018;12:914 pubmed publisher
Nanaware P, Jurewicz M, Leszyk J, Shaffer S, Stern L. HLA-DO Modulates the Diversity of the MHC-II Self-peptidome. Mol Cell Proteomics. 2019;18:490-503 pubmed publisher
Kinehara Y, Nagatomo I, Koyama S, Ito D, Nojima S, Kurebayashi R, et al. Semaphorin 7A promotes EGFR-TKI resistance in EGFR mutant lung adenocarcinoma cells. JCI Insight. 2018;3: pubmed publisher
Reuven N, Shanzer M, Shaul Y. Hippo Pathway Regulation by Tyrosine Kinases. Methods Mol Biol. 2019;1893:215-236 pubmed publisher
Kabata R, Okuda H, Noguchi A, Kondo D, Fujiwara M, Hata K, et al. Familial episodic limb pain in kindreds with novel Nav1.9 mutations. PLoS ONE. 2018;13:e0208516 pubmed publisher
Rodriguez J, Ren G, Day C, Zhao K, Chow C, Larson D. Intrinsic Dynamics of a Human Gene Reveal the Basis of Expression Heterogeneity. Cell. 2019;176:213-226.e18 pubmed publisher
Croft B, Ohnesorg T, Hewitt J, Bowles J, Quinn A, Tan J, et al. Human sex reversal is caused by duplication or deletion of core enhancers upstream of SOX9. Nat Commun. 2018;9:5319 pubmed publisher
Signes A, Cerutti R, Dickson A, Benincá C, Hinchy E, Ghezzi D, et al. APOPT1/COA8 assists COX assembly and is oppositely regulated by UPS and ROS. EMBO Mol Med. 2019;11: pubmed publisher
Xie Z, Pang D, Yuan H, Jiao H, Lu C, Wang K, et al. Genetically modified pigs are protected from classical swine fever virus. PLoS Pathog. 2018;14:e1007193 pubmed publisher
Mu W, Starmer J, Yee D, Magnuson T. EZH2 variants differentially regulate polycomb repressive complex 2 in histone methylation and cell differentiation. Epigenetics Chromatin. 2018;11:71 pubmed publisher
Pyo K, Kim C, Lee M, Kim J, Kim K, Baek S. ULK1 O-GlcNAcylation Is Crucial for Activating VPS34 via ATG14L during Autophagy Initiation. Cell Rep. 2018;25:2878-2890.e4 pubmed publisher
Bainor A, Saini S, Calderon A, Casado Polanco R, Giner Ramirez B, Moncada C, et al. The HDAC-Associated Sin3B Protein Represses DREAM Complex Targets and Cooperates with APC/C to Promote Quiescence. Cell Rep. 2018;25:2797-2807.e8 pubmed publisher
Scheper W, Kelderman S, Fanchi L, Linnemann C, Bendle G, de Rooij M, et al. Low and variable tumor reactivity of the intratumoral TCR repertoire in human cancers. Nat Med. 2019;25:89-94 pubmed publisher
Bialek J, Walther T, Hauber J, Lange U. CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites. J Vis Exp. 2018;: pubmed publisher
Ikeda K, Uchida N, Nishimura T, White J, Martin R, Nakauchi H, et al. Efficient scarless genome editing in human pluripotent stem cells. Nat Methods. 2018;15:1045-1047 pubmed publisher
Liang C, Zhang Z, Chen Q, Yan H, Zhang M, Xiang X, et al. A positive feedback mechanism ensures proper assembly of the functional inner centromere during mitosis in human cells. J Biol Chem. 2019;294:1437-1450 pubmed publisher
Liu X, Liu H, Wang M, Li R, Zeng J, Mo D, et al. Disruption of the ZBED6 binding site in intron 3 of IGF2 by CRISPR/Cas9 leads to enhanced muscle development in Liang Guang Small Spotted pigs. Transgenic Res. 2019;28:141-150 pubmed publisher
Dubbury S, Boutz P, Sharp P. CDK12 regulates DNA repair genes by suppressing intronic polyadenylation. Nature. 2018;564:141-145 pubmed publisher
Lee S, Cieply B, Yang Y, Peart N, Glaser C, Chan P, et al. Esrp1-Regulated Splicing of Arhgef11 Isoforms Is Required for Epithelial Tight Junction Integrity. Cell Rep. 2018;25:2417-2430.e5 pubmed publisher
Altawaty T, Liu L, Zhang H, Tao C, Hou S, Li K, et al. Lack of LTβR Increases Susceptibility of IPEC-J2 Cells to Porcine Epidemic Diarrhea Virus. Cells. 2018;7: pubmed publisher
Li R, Miao J, Tabaran A, O Sullivan M, Anderson K, Scott P, et al. A novel cancer syndrome caused by KCNQ1-deficiency in the golden Syrian hamster. J Carcinog. 2018;17:6 pubmed publisher
Barajas Mora E, Kleiman E, Xu J, Carrico N, Lu H, Oltz E, et al. A B-Cell-Specific Enhancer Orchestrates Nuclear Architecture to Generate a Diverse Antigen Receptor Repertoire. Mol Cell. 2019;73:48-60.e5 pubmed publisher
Zhou T, Kim T, Chong C, Tan L, Amin S, Sadat Badieyan Z, et al. A hPSC-based platform to discover gene-environment interactions that impact human β-cell and dopamine neuron survival. Nat Commun. 2018;9:4815 pubmed publisher
Krchňáková Z, Thakur P, Krausova M, Bieberstein N, Haberman N, Müller McNicoll M, et al. Splicing of long non-coding RNAs primarily depends on polypyrimidine tract and 5' splice-site sequences due to weak interactions with SR proteins. Nucleic Acids Res. 2018;: pubmed publisher
Nakayama K, Wakamatsu K, Fujii H, Shinzaki S, Takamatsu S, Kitazume S, et al. Core fucose is essential glycosylation for CD14-dependent Toll-like receptor 4 and Toll-like receptor 2 signalling in macrophages. J Biochem. 2019;165:227-237 pubmed publisher
Liang Q, Monetti C, Shutova M, Neely E, Hacibekiroglu S, Yang H, et al. Linking a cell-division gene and a suicide gene to define and improve cell therapy safety. Nature. 2018;563:701-704 pubmed publisher
Mun K, Punga T. Cellular Zinc Finger Protein 622 Hinders Human Adenovirus Lytic Growth and Limits Binding of the Viral pVII Protein to Virus DNA. J Virol. 2019;93: pubmed publisher
Nguyen K, Lee C, Mun S, Truong N, Park S, Hwang C. N-terminal acetylation and the N-end rule pathway control degradation of the lipid droplet protein PLIN2. J Biol Chem. 2019;294:379-388 pubmed publisher
Tonzi P, Yin Y, Lee C, Rothenberg E, Huang T. Translesion polymerase kappa-dependent DNA synthesis underlies replication fork recovery. elife. 2018;7: pubmed publisher
Gartz M, Darlington A, Afzal M, Strande J. Exosomes exert cardioprotection in dystrophin-deficient cardiomyocytes via ERK1/2-p38/MAPK signaling. Sci Rep. 2018;8:16519 pubmed publisher
Hirota A, Nakajima Koyama M, Ashida Y, Nishida E. The nucleosome remodeling and deacetylase complex protein CHD4 regulates neural differentiation of mouse embryonic stem cells by down-regulating p53. J Biol Chem. 2019;294:195-209 pubmed publisher
Cheng C, Deng P, Ikeuchi Y, Yuede C, Li D, Rensing N, et al. Characterization of a Mouse Model of Börjeson-Forssman-Lehmann Syndrome. Cell Rep. 2018;25:1404-1414.e6 pubmed publisher
Tasic B, Yao Z, Graybuck L, Smith K, Nguyen T, Bertagnolli D, et al. Shared and distinct transcriptomic cell types across neocortical areas. Nature. 2018;563:72-78 pubmed publisher
Pickett C, Zeller R. Efficient genome editing using CRISPR-Cas-mediated homology directed repair in the ascidian Ciona robusta. Genesis. 2018;56:e23260 pubmed publisher
Tsunakawa Y, Hamada M, Matsunaga Y, Fuseya S, Jeon H, Wakimoto Y, et al. Mice harboring an MCTO mutation exhibit renal failure resembling nephropathy in human patients. Exp Anim. 2019;68:103-111 pubmed publisher
Fan Z, Yang M, Regouski M, Polejaeva I. Gene Knockouts in Goats Using CRISPR/Cas9 System and Somatic Cell Nuclear Transfer. Methods Mol Biol. 2019;1874:373-390 pubmed publisher
Sato T, Ogawa T. Generating Genetically Engineered Mice Using a Spermatogonial Stem Cell-Mediated Method. Methods Mol Biol. 2019;1874:87-98 pubmed publisher
Mohamed A, Shah N, Hettmer S, Vargesson N, Wackerhage H. Analysis of the relationship between the KRAS G12V oncogene and the Hippo effector YAP1 in embryonal rhabdomyosarcoma. Sci Rep. 2018;8:15674 pubmed publisher
Li P, Zhang X, Cao W, Yang F, Du X, Shi Z, et al. RIG-I is responsible for activation of type I interferon pathway in Seneca Valley virus-infected porcine cells to suppress viral replication. Virol J. 2018;15:162 pubmed publisher
Chen X, Wanggou S, Bodalia A, Zhu M, Dong W, Fan J, et al. A Feedforward Mechanism Mediated by Mechanosensitive Ion Channel PIEZO1 and Tissue Mechanics Promotes Glioma Aggression. Neuron. 2018;100:799-815.e7 pubmed publisher
Blanco Suarez E, Liu T, Kopelevich A, Allen N. Astrocyte-Secreted Chordin-like 1 Drives Synapse Maturation and Limits Plasticity by Increasing Synaptic GluA2 AMPA Receptors. Neuron. 2018;100:1116-1132.e13 pubmed publisher
Kim D, Han J, Ly P, Ye Q, McMahon M, Myung K, et al. TRIP13 and APC15 drive mitotic exit by turnover of interphase- and unattached kinetochore-produced MCC. Nat Commun. 2018;9:4354 pubmed publisher
Liu X, Wang M, Qin Y, Shi X, Cong P, Chen Y, et al. Targeted integration in human cells through single crossover mediated by ZFN or CRISPR/Cas9. BMC Biotechnol. 2018;18:66 pubmed publisher
Guo T, Feng Y, Xiao J, Liu Q, Sun X, Xiang J, et al. Harnessing accurate non-homologous end joining for efficient precise deletion in CRISPR/Cas9-mediated genome editing. Genome Biol. 2018;19:170 pubmed publisher
Tidball A, Swaminathan P, Dang L, Parent J. Generating Loss-of-function iPSC Lines with Combined CRISPR Indel Formation and Reprogramming from Human Fibroblasts. Bio Protoc. 2018;8: pubmed publisher
Zhao C, Zhao Y, Zhang J, Lu J, Chen L, Zhang Y, et al. HIT-Cas9: A CRISPR/Cas9 Genome-Editing Device under Tight and Effective Drug Control. Mol Ther Nucleic Acids. 2018;13:208-219 pubmed publisher
Mori H, Fukuhara T, Ono C, Tamura T, Sato A, Fauzyah Y, et al. Induction of selective autophagy in cells replicating hepatitis C virus genome. J Gen Virol. 2018;99:1643-1657 pubmed publisher
Unoki M, Funabiki H, Velasco G, Francastel C, Sasaki H. CDCA7 and HELLS mutations undermine nonhomologous end joining in centromeric instability syndrome. J Clin Invest. 2019;129:78-92 pubmed publisher
Chang A, Liang Z, Dai H, Chapdelaine Williams A, Andrews N, Bronson R, et al. Neural blastocyst complementation enables mouse forebrain organogenesis. Nature. 2018;563:126-130 pubmed publisher
Fang B, Ren X, Wang Y, Li Z, Zhao L, Zhang M, et al. Apolipoprotein E deficiency accelerates atherosclerosis development in miniature pigs. Dis Model Mech. 2018;11: pubmed publisher
Krishnamoorthy G, Davidson N, Leach S, Zhao Z, Lowe S, Lee G, et al. EIF1AX and RAS Mutations Cooperate to Drive Thyroid Tumorigenesis through ATF4 and c-MYC. Cancer Discov. 2019;9:264-281 pubmed publisher
Zuidema A, Wang W, Kreft M, Te Molder L, Hoekman L, Bleijerveld O, et al. Mechanisms of integrin αVβ5 clustering in flat clathrin lattices. J Cell Sci. 2018;131: pubmed publisher
Wang Y, Zhao J, Duan N, Liu W, Zhang Y, Zhou M, et al. Paired CRISPR/Cas9 Nickases Mediate Efficient Site-Specific Integration of F9 into rDNA Locus of Mouse ESCs. Int J Mol Sci. 2018;19: pubmed publisher
Rossidis A, Stratigis J, Chadwick A, Hartman H, Ahn N, Li H, et al. In utero CRISPR-mediated therapeutic editing of metabolic genes. Nat Med. 2018;24:1513-1518 pubmed publisher
King B, Kulak K, Krus U, Rosberg R, Golec E, Wozniak K, et al. Complement Component C3 Is Highly Expressed in Human Pancreatic Islets and Prevents β Cell Death via ATG16L1 Interaction and Autophagy Regulation. Cell Metab. 2019;29:202-210.e6 pubmed publisher
Fan Z, Périssé I, Cotton C, Regouski M, Meng Q, Domb C, et al. A sheep model of cystic fibrosis generated by CRISPR/Cas9 disruption of the CFTR gene. JCI Insight. 2018;3: pubmed publisher
Blume J, Zietara N, Witzlau K, Liu Y, Sanchez O, Puchałka J, et al. miR-191 modulates B-cell development and targets transcription factors E2A, Foxp1, and Egr1. Eur J Immunol. 2019;49:121-132 pubmed publisher
Zhang H, Pan H, Zhou C, Wei Y, Ying W, Li S, et al. Simultaneous zygotic inactivation of multiple genes in mouse through CRISPR/Cas9-mediated base editing. Development. 2018;145: pubmed publisher
Davies A, Itzhak D, Edgar J, Archuleta T, Hirst J, Jackson L, et al. AP-4 vesicles contribute to spatial control of autophagy via RUSC-dependent peripheral delivery of ATG9A. Nat Commun. 2018;9:3958 pubmed publisher
Suzuki T, Okamoto T, Katoh H, Sugiyama Y, Kusakabe S, Tokunaga M, et al. Infection with flaviviruses requires BCLXL for cell survival. PLoS Pathog. 2018;14:e1007299 pubmed publisher
Harwood F, Klein Geltink R, O Hara B, Cardone M, Janke L, Finkelstein D, et al. ETV7 is an essential component of a rapamycin-insensitive mTOR complex in cancer. Sci Adv. 2018;4:eaar3938 pubmed publisher
Nihei W, Nagafuku M, Hayamizu H, Odagiri Y, Tamura Y, Kikuchi Y, et al. NPC1L1-dependent intestinal cholesterol absorption requires ganglioside GM3 in membrane microdomains. J Lipid Res. 2018;59:2181-2187 pubmed publisher
Han Y, Ming S, Wu H, Zeng L, Ba G, Li J, et al. Myostatin knockout induces apoptosis in human cervical cancer cells via elevated reactive oxygen species generation. Redox Biol. 2018;19:412-428 pubmed publisher
Tóth E, Czene B, Kulcsár P, Krausz S, Tálas A, Nyeste A, et al. Mb- and FnCpf1 nucleases are active in mammalian cells: activities and PAM preferences of four wild-type Cpf1 nucleases and of their altered PAM specificity variants. Nucleic Acids Res. 2018;46:10272-10285 pubmed publisher
Yang B, Fu X, Hao J, Sun J, Li Z, Li H, et al. PAXX Participates in Base Excision Repair via Interacting with Pol β and Contributes to TMZ Resistance in Glioma Cells. J Mol Neurosci. 2018;66:214-221 pubmed publisher
Fauster A, Rebsamen M, Willmann K, César Razquin A, Girardi E, Bigenzahn J, et al. Systematic genetic mapping of necroptosis identifies SLC39A7 as modulator of death receptor trafficking. Cell Death Differ. 2019;26:1138-1155 pubmed publisher
Peng M, Cong K, Panzarino N, Nayak S, Calvo J, Deng B, et al. Opposing Roles of FANCJ and HLTF Protect Forks and Restrain Replication during Stress. Cell Rep. 2018;24:3251-3261 pubmed publisher
Fujihara Y, Oji A, Kojima Kita K, Larasati T, Ikawa M. Co-expression of sperm membrane proteins CMTM2A and CMTM2B is essential for ADAM3 localization and male fertility in mice. J Cell Sci. 2018;131: pubmed publisher
Wardi J, Ernst O, Lilja A, Aeed H, Katz S, Ben Nachum I, et al. 3-Aminobenzamide Prevents Concanavalin A-Induced Acute Hepatitis by an Anti-inflammatory and Anti-oxidative Mechanism. Dig Dis Sci. 2018;63:3382-3397 pubmed publisher
Montagna C, Petris G, Casini A, Maule G, Franceschini G, Zanella I, et al. VSV-G-Enveloped Vesicles for Traceless Delivery of CRISPR-Cas9. Mol Ther Nucleic Acids. 2018;12:453-462 pubmed publisher
Schiwon M, Ehrke Schulz E, Oswald A, Bergmann T, Michler T, Protzer U, et al. One-Vector System for Multiplexed CRISPR/Cas9 against Hepatitis B Virus cccDNA Utilizing High-Capacity Adenoviral Vectors. Mol Ther Nucleic Acids. 2018;12:242-253 pubmed publisher
Tomberg K, Westrick R, Kotnik E, Cleuren A, Siemieniak D, Zhu G, et al. Whole exome sequencing of ENU-induced thrombosis modifier mutations in the mouse. PLoS Genet. 2018;14:e1007658 pubmed publisher
Schöneberg J, Dambournet D, Liu T, Forster R, Hockemeyer D, Betzig E, et al. 4D cell biology: big data image analytics and lattice light-sheet imaging reveal dynamics of clathrin-mediated endocytosis in stem cell-derived intestinal organoids. Mol Biol Cell. 2018;29:2959-2968 pubmed publisher
Abbasi F, Miyata H, Shimada K, Morohoshi A, Nozawa K, Matsumura T, et al. RSPH6A is required for sperm flagellum formation and male fertility in mice. J Cell Sci. 2018;131: pubmed publisher
Pankowicz F, Barzi M, Kim K, Legras X, Martins C, Wooton Kee C, et al. Rapid Disruption of Genes Specifically in Livers of Mice Using Multiplex CRISPR/Cas9 Editing. Gastroenterology. 2018;155:1967-1970.e6 pubmed publisher
Laustsen A, Bak R, Krapp C, Kjær L, Egedahl J, Petersen C, et al. Interferon priming is essential for human CD34+ cell-derived plasmacytoid dendritic cell maturation and function. Nat Commun. 2018;9:3525 pubmed publisher
Men Y, Li X, Tu H, Zhang A, Fu X, Wang Z, et al. Tprn is essential for the integrity of stereociliary rootlet in cochlear hair cells in mice. Front Med. 2018;: pubmed publisher
Niwa Y, Kanda G, Yamada R, Shi S, Sunagawa G, Ukai Tadenuma M, et al. Muscarinic Acetylcholine Receptors Chrm1 and Chrm3 Are Essential for REM Sleep. Cell Rep. 2018;24:2231-2247.e7 pubmed publisher
Sano Y, Mizuno T, Mochizuki T, Uchida Y, Umetsu M, Terasaki T, et al. Evaluation of Organic Anion Transporter 1A2-knock-in Mice as a Model of Human Blood-brain Barrier. Drug Metab Dispos. 2018;46:1767-1775 pubmed publisher
D Agostino G, Lyons D, Cristiano C, Lettieri M, Olarte Sanchez C, Burke L, et al. Nucleus of the Solitary Tract Serotonin 5-HT2C Receptors Modulate Food Intake. Cell Metab. 2018;28:619-630.e5 pubmed publisher
Toki T, Yoshida K, Wang R, Nakamura S, Maekawa T, Goi K, et al. De Novo Mutations Activating Germline TP53 in an Inherited Bone-Marrow-Failure Syndrome. Am J Hum Genet. 2018;103:440-447 pubmed publisher
Li P, Wen Z, Zhang G, Zhang A, Fu X, Gao J. Knock-In Mice with Myo3a Y137C Mutation Displayed Progressive Hearing Loss and Hair Cell Degeneration in the Inner Ear. Neural Plast. 2018;2018:4372913 pubmed publisher
Janssen L, Averink T, Blomen V, Brummelkamp T, Medema R, Raaijmakers J. Loss of Kif18A Results in Spindle Assembly Checkpoint Activation at Microtubule-Attached Kinetochores. Curr Biol. 2018;28:2685-2696.e4 pubmed publisher
Benati D, Miselli F, Cocchiarella F, Patrizi C, Carretero M, Baldassarri S, et al. CRISPR/Cas9-Mediated In Situ Correction of LAMB3 Gene in Keratinocytes Derived from a Junctional Epidermolysis Bullosa Patient. Mol Ther. 2018;26:2592-2603 pubmed publisher
Watanabe T, Cui X, Yuan Z, Qi H, Lin H. MIWI2 targets RNAs transcribed from piRNA-dependent regions to drive DNA methylation in mouse prospermatogonia. EMBO J. 2018;37: pubmed publisher
Zaini M, Patel S, Syafruddin S, Rodrigues P, Vanharanta S. Endogenous HIF2A reporter systems for high-throughput functional screening. Sci Rep. 2018;8:12063 pubmed publisher
Sadahiro T, Isomi M, Muraoka N, Kojima H, Haginiwa S, Kurotsu S, et al. Tbx6 Induces Nascent Mesoderm from Pluripotent Stem Cells and Temporally Controls Cardiac versus Somite Lineage Diversification. Cell Stem Cell. 2018;23:382-395.e5 pubmed publisher
Kuscu C, Mammadov R, Czikora A, Unlu H, Tufan T, Fischer N, et al. Temporal and Spatial Epigenome Editing Allows Precise Gene Regulation in Mammalian Cells. J Mol Biol. 2019;431:111-121 pubmed publisher
Tran T, Fukuda A, Aizawa S, Bui P, Hayashi Y, Nishimura K, et al. Live cell imaging of X chromosome reactivation during somatic cell reprogramming. Biochem Biophys Rep. 2018;15:86-92 pubmed publisher
Li X, Wang S, Lu Y, Yin H, Xiao J, Li K, et al. A dual fluorescence reporter system for high throughput screening of effectors of Kiss1 gene expression. FEBS Open Bio. 2018;8:1352-1363 pubmed publisher
Chugh S, Barkeer S, Rachagani S, Nimmakayala R, Perumal N, Pothuraju R, et al. Disruption of C1galt1 Gene Promotes Development and Metastasis of Pancreatic Adenocarcinomas in Mice. Gastroenterology. 2018;155:1608-1624 pubmed publisher
Robinson McCarthy L, McCarthy K, Raaben M, Piccinotti S, Nieuwenhuis J, Stubbs S, et al. Reconstruction of the cell entry pathway of an extinct virus. PLoS Pathog. 2018;14:e1007123 pubmed publisher
Hu S, Knowlton R, Watson B, Glanowska K, Murphy G, Parent J, et al. Somatic Depdc5 deletion recapitulates electroclinical features of human focal cortical dysplasia type IIA. Ann Neurol. 2018;84:140-146 pubmed publisher
Ghezraoui H, Oliveira C, Becker J, Bilham K, Moralli D, Anzilotti C, et al. 53BP1 cooperation with the REV7-shieldin complex underpins DNA structure-specific NHEJ. Nature. 2018;560:122-127 pubmed publisher
Gertsenstein M, Nutter L. Engineering Point Mutant and Epitope-Tagged Alleles in Mice Using Cas9 RNA-Guided Nuclease. Curr Protoc Mouse Biol. 2018;8:28-53 pubmed publisher
Bian S, Repic M, Guo Z, Kavirayani A, Burkard T, Bagley J, et al. Genetically engineered cerebral organoids model brain tumor formation. Nat Methods. 2018;15:631-639 pubmed publisher
Li Z, Jella K, Jaafar L, Li S, Park S, Story M, et al. Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells. Sci Rep. 2018;8:11038 pubmed publisher
Darnell A, Subramaniam A, O Shea E. Translational Control through Differential Ribosome Pausing during Amino Acid Limitation in Mammalian Cells. Mol Cell. 2018;71:229-243.e11 pubmed publisher
Yang D, Cheng D, Tu Q, Yang H, Sun B, Yan L, et al. HUWE1 controls the development of non-small cell lung cancer through down-regulation of p53. Theranostics. 2018;8:3517-3529 pubmed publisher
Noordermeer S, Adam S, Setiaputra D, Barazas M, Pettitt S, Ling A, et al. The shieldin complex mediates 53BP1-dependent DNA repair. Nature. 2018;560:117-121 pubmed publisher
Sevim H, Kocaefe Y, Onur M, Uckan Cetinkaya D, Gürpinar O. Bone marrow derived mesenchymal stem cells ameliorate inflammatory response in an in vitro model of familial hemophagocytic lymphohistiocytosis 2. Stem Cell Res Ther. 2018;9:198 pubmed publisher
Hung P, Johnson B, Chen B, Byrum A, Bredemeyer A, Yewdell W, et al. MRI Is a DNA Damage Response Adaptor during Classical Non-homologous End Joining. Mol Cell. 2018;71:332-342.e8 pubmed publisher
Daigle T, Madisen L, Hage T, Valley M, Knoblich U, Larsen R, et al. A Suite of Transgenic Driver and Reporter Mouse Lines with Enhanced Brain-Cell-Type Targeting and Functionality. Cell. 2018;174:465-480.e22 pubmed publisher
Hirohata A, Sato I, Kaino K, Iwata Y, Koizumi N, Mishiba K. CRISPR/Cas9-mediated homologous recombination in tobacco. Plant Cell Rep. 2019;38:463-473 pubmed publisher
Xu J, Li W, Hossen M, Jia Y, Li L, Huang Z. Optimized Plasmid Construction Strategy for Cas9. Cell Physiol Biochem. 2018;48:131-137 pubmed publisher
Amin S, Cook B, Zhou T, Ghazizadeh Z, Lis R, Zhang T, et al. Discovery of a drug candidate for GLIS3-associated diabetes. Nat Commun. 2018;9:2681 pubmed publisher
Tsvetkov P, Adler J, Myers N, Biran A, Reuven N, Shaul Y. Oncogenic addiction to high 26S proteasome level. Cell Death Dis. 2018;9:773 pubmed publisher
Kasu Y, Alemu S, Lamari A, Loew N, Brower C. The N Termini of TAR DNA-Binding Protein 43 (TDP43) C-Terminal Fragments Influence Degradation, Aggregation Propensity, and Morphology. Mol Cell Biol. 2018;38: pubmed publisher
Lin S, Liu Q, Lelyveld V, Choe J, Szostak J, Gregory R. Mettl1/Wdr4-Mediated m7G tRNA Methylome Is Required for Normal mRNA Translation and Embryonic Stem Cell Self-Renewal and Differentiation. Mol Cell. 2018;71:244-255.e5 pubmed publisher
Karthikeyan S, Russo A, DEAN M, Lantvit D, Endsley M, Burdette J. Prolactin signaling drives tumorigenesis in human high grade serous ovarian cancer cells and in a spontaneous fallopian tube derived model. Cancer Lett. 2018;433:221-231 pubmed publisher
Fan Z, Chang Y, Cui C, Sun L, Wang D, Pan Z, et al. Near infrared fluorescent peptide nanoparticles for enhancing esophageal cancer therapeutic efficacy. Nat Commun. 2018;9:2605 pubmed publisher
Tsukamoto T, Sakai E, Iizuka S, Taracena Gándara M, Sakurai F, Mizuguchi H. Generation of the Adenovirus Vector-Mediated CRISPR/Cpf1 System and the Application for Primary Human Hepatocytes Prepared from Humanized Mice with Chimeric Liver. Biol Pharm Bull. 2018;41:1089-1095 pubmed publisher
Zhao W, Liu M, Ji H, Zhu Y, Wang C, Huang Y, et al. The polycomb group protein Yaf2 regulates the pluripotency of embryonic stem cells in a phosphorylation-dependent manner. J Biol Chem. 2018;293:12793-12804 pubmed publisher
Bhargava R, Sandhu M, Muk S, Lee G, Vaidehi N, Stark J. C-NHEJ without indels is robust and requires synergistic function of distinct XLF domains. Nat Commun. 2018;9:2484 pubmed publisher
Stein C, Jadiya P, Zhang X, McLendon J, Abouassaly G, Witmer N, et al. Mitoregulin: A lncRNA-Encoded Microprotein that Supports Mitochondrial Supercomplexes and Respiratory Efficiency. Cell Rep. 2018;23:3710-3720.e8 pubmed publisher
Li H, Zhao C, Xu J, Xu Y, Cheng C, Liu Y, et al. Rapid generation of gene-targeted EPS-derived mouse models through tetraploid complementation. Protein Cell. 2019;10:20-30 pubmed publisher
Du Y, Wang T, Xu J, Zhao C, Li H, Fu Y, et al. Efficient derivation of extended pluripotent stem cells from NOD-scid Il2rg-/- mice. Protein Cell. 2019;10:31-42 pubmed publisher
Feng W, Herbst L, Lichter P, Pfister S, Liu H, Kawauchi D. CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer. J Vis Exp. 2018;: pubmed publisher
Nunes Dos Santos R, Carneiro D Albuquerque L, Reyes L, Estrada J, Wang Z, Tector M, et al. CRISPR/Cas and recombinase-based human-to-pig orthotopic gene exchange for xenotransplantation. J Surg Res. 2018;229:28-40 pubmed publisher
Kitamura K, Que L, Shimadu M, Koura M, Ishihara Y, Wakae K, et al. Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus. PLoS Pathog. 2018;14:e1007124 pubmed publisher
Pongsuchart M, Kuchimaru T, Yonezawa S, Tran D, Kha N, Hoang N, et al. Novel lymphoid enhancer-binding factor 1-cytoglobin axis promotes extravasation of osteosarcoma cells into the lungs. Cancer Sci. 2018;109:2746-2756 pubmed publisher
Ferlin J, Farhat R, Belouzard S, Cocquerel L, Bertin A, Hober D, et al. Investigation of the role of GBF1 in the replication of positive-sense single-stranded RNA viruses. J Gen Virol. 2018;99:1086-1096 pubmed publisher
Mali G, Yeyati P, Mizuno S, Dodd D, Tennant P, Keighren M, et al. ZMYND10 functions in a chaperone relay during axonemal dynein assembly. elife. 2018;7: pubmed publisher
Vasquez J, Wedel C, Cosentino R, Siegel T. Exploiting CRISPR-Cas9 technology to investigate individual histone modifications. Nucleic Acids Res. 2018;46:e106 pubmed publisher
Adachi K, Kopp W, Wu G, Heising S, Greber B, Stehling M, et al. Esrrb Unlocks Silenced Enhancers for Reprogramming to Naive Pluripotency. Cell Stem Cell. 2018;23:266-275.e6 pubmed publisher
Liu H, Xue Q, Cao W, Yang F, Ma L, Liu W, et al. Foot-and-mouth disease virus nonstructural protein 2B interacts with cyclophilin A, modulating virus replication. FASEB J. 2018;:fj201701351 pubmed publisher
Watts S, Darios E, Mullick A, Garver H, Saunders T, Hughes E, et al. The chemerin knockout rat reveals chemerin dependence in female, but not male, experimental hypertension. FASEB J. 2018;:fj201800479 pubmed publisher
Zhang J, Lan Y, Li M, Lamers M, Fusade Boyer M, Klemm E, et al. Flaviviruses Exploit the Lipid Droplet Protein AUP1 to Trigger Lipophagy and Drive Virus Production. Cell Host Microbe. 2018;23:819-831.e5 pubmed publisher
Gerlach M, Kraft T, Brenner B, Petersen B, Niemann H, Montag J. Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene. Genes (Basel). 2018;9: pubmed publisher
TerBush A, Hafkamp F, Lee H, Coscoy L. A Kaposi's Sarcoma-Associated Herpesvirus Infection Mechanism Is Independent of Integrins α3β1, αVβ3, and αVβ5. J Virol. 2018;92: pubmed publisher
Liu Q, Thoms J, Nunez A, Huang Y, Knezevic K, Packham D, et al. Disruption of a -35 kb Enhancer Impairs CTCF Binding and MLH1 Expression in Colorectal Cells. Clin Cancer Res. 2018;24:4602-4611 pubmed publisher
Oikonomidi I, Burbridge E, Cavadas M, Sullivan G, Collis B, Naegele H, et al. iTAP, a novel iRhom interactor, controls TNF secretion by policing the stability of iRhom/TACE. elife. 2018;7: pubmed publisher
Gu B, Pósfai E, Rossant J. Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat Biotechnol. 2018;36:632-637 pubmed publisher
Tong Y, Sun J, Wong C, Kang Q, Ru B, Wong C, et al. MICMIC: identification of DNA methylation of distal regulatory regions with causal effects on tumorigenesis. Genome Biol. 2018;19:73 pubmed publisher
Nahorski M, Maddirevula S, Ishimura R, Alsahli S, Brady A, Begemann A, et al. Biallelic UFM1 and UFC1 mutations expand the essential role of ufmylation in brain development. Brain. 2018;141:1934-1945 pubmed publisher
Gibson C, Codreanu S, Schrimpe Rutledge A, Retzlaff C, Wright J, Mortlock D, et al. Global untargeted serum metabolomic analyses nominate metabolic pathways responsive to loss of expression of the orphan metallo β-lactamase, MBLAC1. Mol Omics. 2018;14:142-155 pubmed publisher
Rousseaux M, Revelli J, Vázquez Vélez G, Kim J, Craigen E, Gonzales K, et al. Depleting Trim28 in adult mice is well tolerated and reduces levels of α-synuclein and tau. elife. 2018;7: pubmed publisher
Wang B, Zuo J, Kang W, Wei Q, Li J, Wang C, et al. Generation of Hutat2:Fc Knockin Primary Human Monocytes Using CRISPR/Cas9. Mol Ther Nucleic Acids. 2018;11:130-141 pubmed publisher
Vachey G, Déglon N. CRISPR/Cas9-Mediated Genome Editing for Huntington's Disease. Methods Mol Biol. 2018;1780:463-481 pubmed publisher
Gopalappa R, Song M, Chandrasekaran A, Das S, Haq S, Koh H, et al. Efficient genome editing by FACS enrichment of paired D10A Cas9 nickases coupled with fluorescent proteins. Arch Pharm Res. 2018;41:911-920 pubmed publisher
Jia Y, Guo X, Lu J, Wang X, Qiu L, Wang T. CRISPR/Cas9-mediated gene knockout for DNA methyltransferase Dnmt3a in CHO cells displays enhanced transgenic expression and long-term stability. J Cell Mol Med. 2018;22:4106-4116 pubmed publisher
Kobayashi K, Sudaka Y, Takashino A, Imura A, Fujii K, Koike S. Amino Acid Variation at VP1-145 of Enterovirus 71 Determines Attachment Receptor Usage and Neurovirulence in Human Scavenger Receptor B2 Transgenic Mice. J Virol. 2018;92: pubmed publisher
Laursen K, Gudas L. Combinatorial knockout of RARα, RARβ, and RARγ completely abrogates transcriptional responses to retinoic acid in murine embryonic stem cells. J Biol Chem. 2018;293:11891-11900 pubmed publisher
Okumura M, Natsume T, Kanemaki M, Kiyomitsu T. Dynein-Dynactin-NuMA clusters generate cortical spindle-pulling forces as a multi-arm ensemble. elife. 2018;7: pubmed publisher
Brinkman E, Chen T, de Haas M, Holland H, Akhtar W, van Steensel B. Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks. Mol Cell. 2018;70:801-813.e6 pubmed publisher
Lambrus B, Moyer T, Holland A. Applying the auxin-inducible degradation system for rapid protein depletion in mammalian cells. Methods Cell Biol. 2018;144:107-135 pubmed publisher
Tsuchiya M, Hara Y, Okuda M, Itoh K, Nishioka R, Shiomi A, et al. Cell surface flip-flop of phosphatidylserine is critical for PIEZO1-mediated myotube formation. Nat Commun. 2018;9:2049 pubmed publisher
Shin J, Jung S, Ramakrishna S, Kim H, Lee J. In vivo gene correction with targeted sequence substitution through microhomology-mediated end joining. Biochem Biophys Res Commun. 2018;502:116-122 pubmed publisher
Yao X, Zhang M, Wang X, Ying W, Hu X, Dai P, et al. Tild-CRISPR Allows for Efficient and Precise Gene Knockin in Mouse and Human Cells. Dev Cell. 2018;45:526-536.e5 pubmed publisher
Mukherjee S, Zhang T, Lacko L, Tan L, Xiang J, Butler J, et al. Derivation and characterization of a UCP1 reporter human ES cell line. Stem Cell Res. 2018;30:12-21 pubmed publisher
Posfai D, Sylvester K, Reddy A, Ganley J, Wirth J, Cullen Q, et al. Plasmodium parasite exploits host aquaporin-3 during liver stage malaria infection. PLoS Pathog. 2018;14:e1007057 pubmed publisher
Kamijo S, Ishii Y, Horigane S, Suzuki K, Ohkura M, Nakai J, et al. A Critical Neurodevelopmental Role for L-Type Voltage-Gated Calcium Channels in Neurite Extension and Radial Migration. J Neurosci. 2018;38:5551-5566 pubmed publisher
Finnen R, Banfield B. CRISPR/Cas9 Mutagenesis of UL21 in Multiple Strains of Herpes Simplex Virus Reveals Differential Requirements for pUL21 in Viral Replication. Viruses. 2018;10: pubmed publisher
Lin H, Miyauchi K, Harada T, Okita R, Takeshita E, Komaki H, et al. CO2-sensitive tRNA modification associated with human mitochondrial disease. Nat Commun. 2018;9:1875 pubmed publisher
Li X, Das I, Lepletier A, Addala V, Bald T, Stannard K, et al. CD155 loss enhances tumor suppression via combined host and tumor-intrinsic mechanisms. J Clin Invest. 2018;128:2613-2625 pubmed publisher
Cornejo I, Villanueva S, Burgos J, López Cayuqueo K, Chambrey R, Julio Kalajzić F, et al. Tissue Distribution of Kir7.1 Inwardly Rectifying K+ Channel Probed in a Knock-in Mouse Expressing a Haemagglutinin-Tagged Protein. Front Physiol. 2018;9:428 pubmed publisher
Nagata K, Takahashi M, Matsuba Y, Okuyama Uchimura F, Sato K, Hashimoto S, et al. Generation of App knock-in mice reveals deletion mutations protective against Alzheimer's disease-like pathology. Nat Commun. 2018;9:1800 pubmed publisher
Li F, Kim H, Ji Z, Zhang T, Chen B, Ge Y, et al. The BUB3-BUB1 Complex Promotes Telomere DNA Replication. Mol Cell. 2018;70:395-407.e4 pubmed publisher
Koshimizu T, Honda K, Nagaoka Uozumi S, Ichimura A, Kimura I, Nakaya M, et al. Complex formation between the vasopressin 1b receptor, β-arrestin-2, and the μ-opioid receptor underlies morphine tolerance. Nat Neurosci. 2018;21:820-833 pubmed publisher
Khlghatyan J, Evstratova A, Chamberland S, Marakhovskaia A, Bahremand A, Toth K, et al. Mental Illnesses-Associated Fxr1 and Its Negative Regulator Gsk3β Are Modulators of Anxiety and Glutamatergic Neurotransmission. Front Mol Neurosci. 2018;11:119 pubmed publisher
van der Goot A, Pearce M, Leto D, Shaler T, Kopito R. Redundant and Antagonistic Roles of XTP3B and OS9 in Decoding Glycan and Non-glycan Degrons in ER-Associated Degradation. Mol Cell. 2018;70:516-530.e6 pubmed publisher
Xu J, Zhang L, Xie M, Li Y, Huang P, Saunders T, et al. Role of Complement in a Rat Model of Paclitaxel-Induced Peripheral Neuropathy. J Immunol. 2018;200:4094-4101 pubmed publisher
Lou W, Reynolds C, Li Y, Liu J, Huttemann M, Schlame M, et al. Loss of tafazzin results in decreased myoblast differentiation in C2C12 cells: A myoblast model of Barth syndrome and cardiolipin deficiency. Biochim Biophys Acta Mol Cell Biol Lipids. 2018;1863:857-865 pubmed publisher
Staring J, van den Hengel L, Raaben M, Blomen V, Carette J, Brummelkamp T. KREMEN1 Is a Host Entry Receptor for a Major Group of Enteroviruses. Cell Host Microbe. 2018;23:636-643.e5 pubmed publisher
Ngo Thai Bich V, Hongu T, Miura Y, Katagiri N, Ohbayashi N, Yamashita Kanemaru Y, et al. Physiological function of phospholipase D2 in anti-tumor immunity: regulation of CD8+ T lymphocyte proliferation. Sci Rep. 2018;8:6283 pubmed publisher
Kato Inui T, Takahashi G, Hsu S, Miyaoka Y. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 with improved proof-reading enhances homology-directed repair. Nucleic Acids Res. 2018;46:4677-4688 pubmed publisher
Gao J, Yan X, Banfield B. Comparative Analysis of UL16 Mutants Derived from Multiple Strains of Herpes Simplex Virus 2 (HSV-2) and HSV-1 Reveals Species-Specific Requirements for the UL16 Protein. J Virol. 2018;92: pubmed publisher
Yamashita W, Takahashi M, Kikkawa T, Gotoh H, Osumi N, Ono K, et al. Conserved and divergent functions of Pax6 underlie species-specific neurogenic patterns in the developing amniote brain. Development. 2018;145: pubmed publisher
Taschner M, Lorentzen A, Mourão A, Collins T, Freke G, Moulding D, et al. Crystal structure of intraflagellar transport protein 80 reveals a homo-dimer required for ciliogenesis. elife. 2018;7: pubmed publisher
Li G, Liu D, Zhang X, Quan R, Zhong C, Mo J, et al. Suppressing Ku70/Ku80 expression elevates homology-directed repair efficiency in primary fibroblasts. Int J Biochem Cell Biol. 2018;99:154-160 pubmed publisher
Yin L, Hu S, Mei S, Sun H, Xu F, Li J, et al. CRISPR/Cas9 Inhibits Multiple Steps of HIV-1 Infection. Hum Gene Ther. 2018;29:1264-1276 pubmed publisher
Schuijers J, Manteiga J, Weintraub A, Day D, Zamudio A, Hnisz D, et al. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism. Cell Rep. 2018;23:349-360 pubmed publisher
Mendez Dorantes C, Bhargava R, Stark J. Repeat-mediated deletions can be induced by a chromosomal break far from a repeat, but multiple pathways suppress such rearrangements. Genes Dev. 2018;32:524-536 pubmed publisher
Li S, Ma Y, Zheng P, Zhang P. GDF15 promotes the proliferation of cervical cancer cells by phosphorylating AKT1 and Erk1/2 through the receptor ErbB2. J Exp Clin Cancer Res. 2018;37:80 pubmed publisher
Lee J, Alexeyev M, Kozhukhar N, Pastukh V, White R, Stevens T. Carbonic anhydrase IX is a critical determinant of pulmonary microvascular endothelial cell pH regulation and angiogenesis during acidosis. Am J Physiol Lung Cell Mol Physiol. 2018;315:L41-L51 pubmed publisher
Russell T, Velusamy T, Tseng Y, Tscharke D. Increasing antigen presentation on HSV-1-infected cells increases lesion size but does not alter neural infection or latency. J Gen Virol. 2018;99:682-692 pubmed publisher
Gaidukov L, Wroblewska L, Teague B, Nelson T, Zhang X, Liu Y, et al. A multi-landing pad DNA integration platform for mammalian cell engineering. Nucleic Acids Res. 2018;46:4072-4086 pubmed publisher
Bahrami Nejad Z, Zhao M, Tholen S, Hunerdosse D, Tkach K, van Schie S, et al. A Transcriptional Circuit Filters Oscillating Circadian Hormonal Inputs to Regulate Fat Cell Differentiation. Cell Metab. 2018;27:854-868.e8 pubmed publisher
Song C, Wang D, Jiang T, O CONNOR K, Tang Q, Cai L, et al. In Vivo Genome Editing Partially Restores Alpha1-Antitrypsin in a Murine Model of AAT Deficiency. Hum Gene Ther. 2018;29:853-860 pubmed publisher
Zhou P, Ding X, Wan X, Liu L, Yuan X, Zhang W, et al. MLL5 suppresses antiviral innate immune response by facilitating STUB1-mediated RIG-I degradation. Nat Commun. 2018;9:1243 pubmed publisher
Mitxelena J, Apraiz A, Vallejo Rodríguez J, García Santisteban I, Fullaondo A, Alvarez Fernandez M, et al. An E2F7-dependent transcriptional program modulates DNA damage repair and genomic stability. Nucleic Acids Res. 2018;46:4546-4559 pubmed publisher
Gopalappa R, Suresh B, Ramakrishna S, Kim H. Paired D10A Cas9 nickases are sometimes more efficient than individual nucleases for gene disruption. Nucleic Acids Res. 2018;46:e71 pubmed publisher
Zakany J, Duboule D. Rescue of an aggressive female sexual courtship in mice by CRISPR/Cas9 secondary mutation in vivo. BMC Res Notes. 2018;11:193 pubmed publisher
Yao X, Wang X, Liu J, Shi L, Huang P, Yang H. CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy. J Vis Exp. 2018;: pubmed publisher
Sarin S, ZUNIGA SANCHEZ E, Kurmangaliyev Y, Cousins H, Patel M, Hernandez J, et al. Role for Wnt Signaling in Retinal Neuropil Development: Analysis via RNA-Seq and In Vivo Somatic CRISPR Mutagenesis. Neuron. 2018;98:109-126.e8 pubmed publisher
Miller J, Aoki K, Moehring F, Murphy C, O Hara C, Tiemeyer M, et al. Neuropathic pain in a Fabry disease rat model. JCI Insight. 2018;3: pubmed publisher
van Gool I, Rayner E, Osse E, Nout R, Creutzberg C, Tomlinson I, et al. Adjuvant Treatment for POLE Proofreading Domain-Mutant Cancers: Sensitivity to Radiotherapy, Chemotherapy, and Nucleoside Analogues. Clin Cancer Res. 2018;24:3197-3203 pubmed publisher
Soto F, Zhao L, Kerschensteiner D. Synapse maintenance and restoration in the retina by NGL2. elife. 2018;7: pubmed publisher
Lange U, Bialek J, Walther T, Hauber J. Pinpointing recurrent proviral integration sites in new models for latent HIV-1 infection. Virus Res. 2018;249:69-75 pubmed publisher
Murase M, Kawasaki T, Hakozaki R, Sueyoshi T, Putri D, Kitai Y, et al. Intravesicular Acidification Regulates Lipopolysaccharide Inflammation and Tolerance through TLR4 Trafficking. J Immunol. 2018;200:2798-2808 pubmed publisher
Brinkman E, Kousholt A, Harmsen T, Leemans C, Chen T, Jonkers J, et al. Easy quantification of template-directed CRISPR/Cas9 editing. Nucleic Acids Res. 2018;46:e58 pubmed publisher
Morita M, Sato T, Nomura M, Sakamoto Y, Inoue Y, Tanaka R, et al. PKM1 Confers Metabolic Advantages and Promotes Cell-Autonomous Tumor Cell Growth. Cancer Cell. 2018;33:355-367.e7 pubmed publisher
Klann T, Crawford G, Reddy T, Gersbach C. Screening Regulatory Element Function with CRISPR/Cas9-based Epigenome Editing. Methods Mol Biol. 2018;1767:447-480 pubmed publisher
Hill P, Leitch H, Requena C, Sun Z, Amouroux R, Román Trufero M, et al. Epigenetic reprogramming enables the transition from primordial germ cell to gonocyte. Nature. 2018;555:392-396 pubmed publisher
Giacalone J, Sharma T, Burnight E, Fingert J, Mullins R, Stone E, et al. CRISPR-Cas9-Based Genome Editing of Human Induced Pluripotent Stem Cells. Curr Protoc Stem Cell Biol. 2018;44:5B.7.1-5B.7.22 pubmed publisher
Hernandez G, Ramirez M, Minguillón J, Quiles P, Ruiz de Garibay G, Aza Carmona M, et al. Decapping protein EDC4 regulates DNA repair and phenocopies BRCA1. Nat Commun. 2018;9:967 pubmed publisher
Hsu C, Lee E, Gordon K, Paz E, Shen W, Ohnishi K, et al. MAP4K3 mediates amino acid-dependent regulation of autophagy via phosphorylation of TFEB. Nat Commun. 2018;9:942 pubmed publisher
Kim S, Matsumoto T, Kagawa H, Nakamura M, Hirohata R, Ueno A, et al. Microhomology-assisted scarless genome editing in human iPSCs. Nat Commun. 2018;9:939 pubmed publisher
Honma K, Abe S, Endo T, Uno N, Oshimura M, Ohbayashi T, et al. Development of a multiple-gene-loading method by combining multi-integration system-equipped mouse artificial chromosome vector and CRISPR-Cas9. PLoS ONE. 2018;13:e0193642 pubmed publisher
Bai M, Vozdek R, Hnizda A, Jiang C, Wang B, Kuchar L, et al. Conserved roles of C. elegans and human MANFs in sulfatide binding and cytoprotection. Nat Commun. 2018;9:897 pubmed publisher
Guallar D, Bi X, Pardavila J, Huang X, Sáenz C, Shi X, et al. RNA-dependent chromatin targeting of TET2 for endogenous retrovirus control in pluripotent stem cells. Nat Genet. 2018;50:443-451 pubmed publisher
Ye F, Nager A, Nachury M. BBSome trains remove activated GPCRs from cilia by enabling passage through the transition zone. J Cell Biol. 2018;217:1847-1868 pubmed publisher
Göder A, Emmerich C, Nikolova T, Kiweler N, Schreiber M, Kühl T, et al. HDAC1 and HDAC2 integrate checkpoint kinase phosphorylation and cell fate through the phosphatase-2A subunit PR130. Nat Commun. 2018;9:764 pubmed publisher
Zhou Z, Wang L, Ge F, Gong P, Wang H, Wang F, et al. Pold3 is required for genomic stability and telomere integrity in embryonic stem cells and meiosis. Nucleic Acids Res. 2018;46:3468-3486 pubmed publisher
Harmsen T, Klaasen S, van de Vrugt H, te Riele H. DNA mismatch repair and oligonucleotide end-protection promote base-pair substitution distal from a CRISPR/Cas9-induced DNA break. Nucleic Acids Res. 2018;46:2945-2955 pubmed publisher
Tauriello D, Palomo Ponce S, Stork D, Berenguer Llergo A, Badia Ramentol J, Iglesias M, et al. TGFβ drives immune evasion in genetically reconstituted colon cancer metastasis. Nature. 2018;554:538-543 pubmed publisher
Sharif A, Yu D, Loertscher S, Austin R, Nguyen K, Mathur P, et al. C8ORF37 Is Required for Photoreceptor Outer Segment Disc Morphogenesis by Maintaining Outer Segment Membrane Protein Homeostasis. J Neurosci. 2018;38:3160-3176 pubmed publisher
Li X, Lin Z, Wang H, Zhao D, Xu X, Wei Y, et al. Heritable, Allele-Specific Chromosomal Looping between Tandem Promoters Specifies Promoter Usage of SHC1. Mol Cell Biol. 2018;38: pubmed publisher
Fueyo R, Iacobucci S, PAPPA S, Estarás C, Lois S, Vicioso Mantis M, et al. Lineage specific transcription factors and epigenetic regulators mediate TGF?-dependent enhancer activation. Nucleic Acids Res. 2018;46:3351-3365 pubmed publisher
Søreng K, Munson M, Lamb C, Bjørndal G, Pankiv S, Carlsson S, et al. SNX18 regulates ATG9A trafficking from recycling endosomes by recruiting Dynamin-2. EMBO Rep. 2018;19: pubmed publisher
Casini A, Olivieri M, Petris G, Montagna C, Reginato G, Maule G, et al. A highly specific SpCas9 variant is identified by in vivo screening in yeast. Nat Biotechnol. 2018;36:265-271 pubmed publisher
Zhang Z, Ursin R, Mahapatra S, Gallicano G. CRISPR/CAS9 ablation of individual miRNAs from a miRNA family reveals their individual efficacies for regulating cardiac differentiation. Mech Dev. 2018;150:10-20 pubmed publisher
Zhang M, Miao F, Huang R, Liu W, Zhao Y, Jiao T, et al. RHBDD1 promotes colorectal cancer metastasis through the Wnt signaling pathway and its downstream target ZEB1. J Exp Clin Cancer Res. 2018;37:22 pubmed publisher
Lesport E, Ferster A, Biver A, Roch B, Vasquez N, Jabado N, et al. Reduced recruitment of 53BP1 during interstrand crosslink repair is associated with genetically inherited attenuation of mitomycin C sensitivity in a family with Fanconi anemia. Oncotarget. 2018;9:3779-3793 pubmed publisher
Lebensohn A, Rohatgi R. R-spondins can potentiate WNT signaling without LGRs. elife. 2018;7: pubmed publisher
Asano K, Suzuki T, Saito A, Wei F, Ikeuchi Y, Numata T, et al. Metabolic and chemical regulation of tRNA modification associated with taurine deficiency and human disease. Nucleic Acids Res. 2018;46:1565-1583 pubmed publisher
Williams R, Senanayake U, Artibani M, Taylor G, Wells D, Ahmed A, et al. Genome and epigenome engineering CRISPR toolkit for in vivo modulation of cis-regulatory interactions and gene expression in the chicken embryo. Development. 2018;145: pubmed publisher
Feng S, Harayama T, Montessuit S, David F, Winssinger N, Martinou J, et al. Mitochondria-specific photoactivation to monitor local sphingosine metabolism and function. elife. 2018;7: pubmed publisher
Abbasi F, Miyata H, Ikawa M. Revolutionizing male fertility factor research in mice by using the genome editing tool CRISPR/Cas9. Reprod Med Biol. 2018;17:3-10 pubmed publisher
Kang C, Xie L, Gunasekar S, Mishra A, Zhang Y, Pai S, et al. SWELL1 is a glucose sensor regulating β-cell excitability and systemic glycaemia. Nat Commun. 2018;9:367 pubmed publisher
Ushiki A, Matsuzaki H, Fukamizu A, Tanimoto K. Homeostatic Response of Mouse renin Gene Transcription in a Hypertensive Environment Is Mediated by a Novel 5' Enhancer. Mol Cell Biol. 2018;38: pubmed publisher
Hu X, Li L, Yu X, Zhang R, Yan S, Zeng Z, et al. CRISPR/Cas9-mediated reversibly immortalized mouse bone marrow stromal stem cells (BMSCs) retain multipotent features of mesenchymal stem cells (MSCs). Oncotarget. 2017;8:111847-111865 pubmed publisher
Kageyama S, Saito T, Obata M, Koide R, Ichimura Y, Komatsu M. Negative Regulation of the Keap1-Nrf2 Pathway by a p62/Sqstm1 Splicing Variant. Mol Cell Biol. 2018;38: pubmed publisher
He Z, Zhang Y, Yang Y, Ma C, Wang P, Du W, et al. In Vivo Ovarian Cancer Gene Therapy Using CRISPR-Cas9. Hum Gene Ther. 2018;29:223-233 pubmed publisher
Wang Y, Ji T, Nelson A, Glanowska K, Murphy G, Jenkins P, et al. Critical roles of αII spectrin in brain development and epileptic encephalopathy. J Clin Invest. 2018;128:760-773 pubmed publisher
Seino T, Kawasaki S, Shimokawa M, Tamagawa H, Toshimitsu K, Fujii M, et al. Human Pancreatic Tumor Organoids Reveal Loss of Stem Cell Niche Factor Dependence during Disease Progression. Cell Stem Cell. 2018;22:454-467.e6 pubmed publisher
Yang H, Zhang J, Zhang X, Shi J, Pan Y, Zhou R, et al. CD163 knockout pigs are fully resistant to highly pathogenic porcine reproductive and respiratory syndrome virus. Antiviral Res. 2018;151:63-70 pubmed publisher
Silva J, Aivio S, Knobel P, Bailey L, Casali A, Vinaixa M, et al. EXD2 governs germ stem cell homeostasis and lifespan by promoting mitoribosome integrity and translation. Nat Cell Biol. 2018;20:162-174 pubmed publisher
Takayama K, Mizuguchi H. Generation of Optogenetically Modified Adenovirus Vector for Spatiotemporally Controllable Gene Therapy. ACS Chem Biol. 2018;13:449-454 pubmed publisher
Huang G, Liu X, Duszynski D, Tang X, El Ashram S, Liu Z, et al. Improved Cytotoxic T Lymphocyte Responses to Vaccination with Porcine Reproductive and Respiratory Syndrome Virus in 4-1BB Transgenic Pigs. Front Immunol. 2017;8:1846 pubmed publisher
Nishitsuji H, Ujino S, Harada K, Shimotohno K. TIP60 Complex Inhibits Hepatitis B Virus Transcription. J Virol. 2018;92: pubmed publisher
Larraufie P, Martin Gallausiaux C, Lapaque N, Dore J, Gribble F, Reimann F, et al. SCFAs strongly stimulate PYY production in human enteroendocrine cells. Sci Rep. 2018;8:74 pubmed publisher
Panchakshari R, Zhang X, Kumar V, Du Z, Wei P, Kao J, et al. DNA double-strand break response factors influence end-joining features of IgH class switch and general translocation junctions. Proc Natl Acad Sci U S A. 2018;115:762-767 pubmed publisher
Pederick D, Richards K, Piltz S, Kumar R, Mincheva Tasheva S, Mandelstam S, et al. Abnormal Cell Sorting Underlies the Unique X-Linked Inheritance of PCDH19 Epilepsy. Neuron. 2018;97:59-66.e5 pubmed publisher
Xiang P, Wei W, Hofs N, Clemans Gibbon J, Maetzig T, Lai C, et al. A knock-in mouse strain facilitates dynamic tracking and enrichment of MEIS1. Blood Adv. 2017;1:2225-2235 pubmed publisher
Pittermann E, Lachmann N, MacLean G, Emmrich S, Ackermann M, Göhring G, et al. Gene correction of HAX1 reversed Kostmann disease phenotype in patient-specific induced pluripotent stem cells. Blood Adv. 2017;1:903-914 pubmed publisher
Hulseberg C, Fénéant L, Szymańska K, White J. Lamp1 Increases the Efficiency of Lassa Virus Infection by Promoting Fusion in Less Acidic Endosomal Compartments. MBio. 2018;9: pubmed publisher
Kawabe Y, Komatsu S, Komatsu S, Murakami M, Ito A, Sakuma T, et al. Targeted knock-in of an scFv-Fc antibody gene into the hprt locus of Chinese hamster ovary cells using CRISPR/Cas9 and CRIS-PITCh systems. J Biosci Bioeng. 2018;125:599-605 pubmed publisher
Chang C, Chang C, Hsia K, Tsai S. Generation of FHL2 homozygous knockout lines from human embryonic stem cells by CRISPR/Cas9-mediated ablation. Stem Cell Res. 2018;27:21-24 pubmed publisher
Sugimoto S, Ohta Y, Fujii M, Matano M, Shimokawa M, Nanki K, et al. Reconstruction of the Human Colon Epithelium In Vivo. Cell Stem Cell. 2018;22:171-176.e5 pubmed publisher
Hamilton C, Abney K, Vasauskas A, Alexeyev M, Li N, Honkanen R, et al. Serine/threonine phosphatase 5 (PP5C/PPP5C) regulates the ISOC channel through a PP5C-FKBP51 axis. Pulm Circ. 2018;8:2045893217753156 pubmed publisher
Huang B, Li X, Tu X, Zhao W, Zhu D, Feng Y, et al. OTX1 regulates cell cycle progression of neural progenitors in the developing cerebral cortex. J Biol Chem. 2018;293:2137-2148 pubmed publisher
Phan Q, Contzen J, Seemann P, Gossen M. Site-specific chromosomal gene insertion: Flp recombinase versus Cas9 nuclease. Sci Rep. 2017;7:17771 pubmed publisher
Xie H, Tang L, He X, Liu X, Zhou C, Liu J, et al. SaCas9 Requires 5'-NNGRRT-3' PAM for Sufficient Cleavage and Possesses Higher Cleavage Activity than SpCas9 or FnCpf1 in Human Cells. Biotechnol J. 2018;13:e1700561 pubmed publisher
Lu J, Zhao C, Zhao Y, Zhang J, Zhang Y, Chen L, et al. Multimode drug inducible CRISPR/Cas9 devices for transcriptional activation and genome editing. Nucleic Acids Res. 2018;46:e25 pubmed publisher
Yano H, Hamanaka R, Nakamura Ota M, Zhang J, Matsuo N, Yoshioka H. Regulation of type I collagen expression by microRNA-29 following ionizing radiation. Radiat Environ Biophys. 2018;57:41-54 pubmed publisher
Oldrini B, Hsieh W, Erdjument Bromage H, Codega P, Carro M, Curiel García A, et al. EGFR feedback-inhibition by Ran-binding protein 6 is disrupted in cancer. Nat Commun. 2017;8:2035 pubmed publisher
Takebe T, Sakamoto K, Higami Y, Harada Y. A novel mouse model for tracking the fate of CXCR5-expressing T cells. Biochem Biophys Res Commun. 2018;495:1642-1647 pubmed publisher
Onyango D, Lee G, Stark J. PRPF8 is important for BRCA1-mediated homologous recombination. Oncotarget. 2017;8:93319-93337 pubmed publisher
Adikusuma F, Pfitzner C, Thomas P. Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. PLoS ONE. 2017;12:e0187236 pubmed publisher
Chen X, Wang R, Liu X, Wu Y, Zhou T, Yang Y, et al. A Chemical-Genetic Approach Reveals the Distinct Roles of GSK3? and GSK3? in Regulating Embryonic Stem Cell Fate. Dev Cell. 2017;43:563-576.e4 pubmed publisher
Markossian S, Guyot R, Richard S, Teixeira M, Aguilera N, Bouchet M, et al. CRISPR/Cas9 Editing of the Mouse Thra Gene Produces Models with Variable Resistance to Thyroid Hormone. Thyroid. 2018;28:139-150 pubmed publisher
Gillies T, Pargett M, Minguet M, Davies A, Albeck J. Linear Integration of ERK Activity Predominates over Persistence Detection in Fra-1 Regulation. Cell Syst. 2017;5:549-563.e5 pubmed publisher
Hadoux J, Desterke C, Feraud O, Guibert M, De Rose R, Opolon P, et al. Transcriptional landscape of a RETC634Y-mutated iPSC and its CRISPR-corrected isogenic control reveals the putative role of EGR1 transcriptional program in the development of multiple endocrine neoplasia type 2A-associated cancers. Stem Cell Res. 2018;26:8-16 pubmed publisher
Evavold C, Ruan J, Tan Y, Xia S, Wu H, Kagan J. The Pore-Forming Protein Gasdermin D Regulates Interleukin-1 Secretion from Living Macrophages. Immunity. 2018;48:35-44.e6 pubmed publisher
Jacobs E, Warrier S, Volders P, D haene E, Van Lombergen E, Vantomme L, et al. CRISPR/Cas9-mediated genome editing in naïve human embryonic stem cells. Sci Rep. 2017;7:16650 pubmed publisher
Rauch F, Geng Y, Lamplugh L, Hekmatnejad B, Gaumond M, Penney J, et al. Crispr-Cas9 engineered osteogenesis imperfecta type V leads to severe skeletal deformities and perinatal lethality in mice. Bone. 2018;107:131-142 pubmed publisher
Lin B, Coleman J, Peterson J, Zunitch M, Jang W, Herrick D, et al. Injury Induces Endogenous Reprogramming and Dedifferentiation of Neuronal Progenitors to Multipotency. Cell Stem Cell. 2017;21:761-774.e5 pubmed publisher
Nguyen H, Dong J, Panchakshari R, Kumar V, Alt F, Bories J. Histone methyltransferase MMSET promotes AID-mediated DNA breaks at the donor switch region during class switch recombination. Proc Natl Acad Sci U S A. 2017;114:E10560-E10567 pubmed publisher
Avbelj M, Panter G, Jerala R. The role of N-terminal segment and membrane association in MyD88-mediated signaling. Biochem Biophys Res Commun. 2018;495:878-883 pubmed publisher
Le Guerroué F, Eck F, Jung J, Starzetz T, Mittelbronn M, Kaulich M, et al. Autophagosomal Content Profiling Reveals an LC3C-Dependent Piecemeal Mitophagy Pathway. Mol Cell. 2017;68:786-796.e6 pubmed publisher
Nagata K, Takahashi M, Kiryu Seo S, Kiyama H, Saido T. Distinct functional consequences of ECEL1/DINE missense mutations in the pathogenesis of congenital contracture disorders. Acta Neuropathol Commun. 2017;5:83 pubmed publisher
Abe S, Kobayashi K, Oji A, Sakuma T, Kazuki K, Takehara S, et al. Modification of single-nucleotide polymorphism in a fully humanized CYP3A mouse by genome editing technology. Sci Rep. 2017;7:15189 pubmed publisher
Morgan M, Rickels R, Collings C, He X, Cao K, Herz H, et al. A cryptic Tudor domain links BRWD2/PHIP to COMPASS-mediated histone H3K4 methylation. Genes Dev. 2017;31:2003-2014 pubmed publisher
Mall E, Herrmann D, Niemann H. Murine pluripotent stem cells with a homozygous knockout of Foxg1 show reduced differentiation towards cortical progenitors in vitro. Stem Cell Res. 2017;25:50-60 pubmed publisher
Wu Y, Xiong Q, Li S, Yang X, Ge F. Integrated Proteomic and Transcriptomic Analysis Reveals Long Noncoding RNA HOX Transcript Antisense Intergenic RNA (HOTAIR) Promotes Hepatocellular Carcinoma Cell Proliferation by Regulating Opioid Growth Factor Receptor (OGFr). Mol Cell Proteomics. 2018;17:146-159 pubmed publisher
Yi Y, Tsai S, Cheng J, Wang E, Anglesio M, Cochrane D, et al. APELA promotes tumour growth and cell migration in ovarian cancer in a p53-dependent manner. Gynecol Oncol. 2017;147:663-671 pubmed publisher
Abramowski V, Etienne O, Elsaid R, Yang J, Berland A, Kermasson L, et al. PAXX and Xlf interplay revealed by impaired CNS development and immunodeficiency of double KO mice. Cell Death Differ. 2018;25:444-452 pubmed publisher
Zhu B, Ueda A, Song X, Horike S, Yokota T, Akagi T. Baf53a is involved in survival of mouse ES cells, which can be compensated by Baf53b. Sci Rep. 2017;7:14059 pubmed publisher
Bernabò P, Tebaldi T, Groen E, Lane F, Perenthaler E, Mattedi F, et al. In Vivo Translatome Profiling in Spinal Muscular Atrophy Reveals a Role for SMN Protein in Ribosome Biology. Cell Rep. 2017;21:953-965 pubmed publisher
Fujihara Y, Oji A, Larasati T, Kojima Kita K, Ikawa M. Human Globozoospermia-Related Gene Spata16 Is Required for Sperm Formation Revealed by CRISPR/Cas9-Mediated Mouse Models. Int J Mol Sci. 2017;18: pubmed publisher
Zhao W, Huang Y, Zhang J, Liu M, Ji H, Wang C, et al. Polycomb group RING finger proteins 3/5 activate transcription via an interaction with the pluripotency factor Tex10 in embryonic stem cells. J Biol Chem. 2017;292:21527-21537 pubmed publisher
Zakany J, Darbellay F, Mascrez B, Necsulea A, Duboule D. Control of growth and gut maturation by HoxD genes and the associated lncRNA Haglr. Proc Natl Acad Sci U S A. 2017;114:E9290-E9299 pubmed publisher
Vaites L, Paulo J, Huttlin E, Harper J. Systematic Analysis of Human Cells Lacking ATG8 Proteins Uncovers Roles for GABARAPs and the CCZ1/MON1 Regulator C18orf8/RMC1 in Macroautophagic and Selective Autophagic Flux. Mol Cell Biol. 2018;38: pubmed publisher
Iwata T, Niimura Y, Kobayashi C, Shirakawa D, Suzuki H, Enomoto T, et al. A long-range cis-regulatory element for class I odorant receptor genes. Nat Commun. 2017;8:885 pubmed publisher
Hoffmann H, Schneider W, Blomen V, Scull M, Hovnanian A, Brummelkamp T, et al. Diverse Viruses Require the Calcium Transporter SPCA1 for Maturation and Spread. Cell Host Microbe. 2017;22:460-470.e5 pubmed publisher
Tillotson R, Selfridge J, Koerner M, Gadalla K, Guy J, De Sousa D, et al. Radically truncated MeCP2 rescues Rett syndrome-like neurological defects. Nature. 2017;550:398-401 pubmed publisher
Davies B, Brown L, Cais O, Watson J, Clayton A, Chang V, et al. A point mutation in the ion conduction pore of AMPA receptor GRIA3 causes dramatically perturbed sleep patterns as well as intellectual disability. Hum Mol Genet. 2017;26:3869-3882 pubmed publisher
Wang K, Tang X, Xie Z, Zou X, Li M, Yuan H, et al. CRISPR/Cas9-mediated knockout of myostatin in Chinese indigenous Erhualian pigs. Transgenic Res. 2017;26:799-805 pubmed publisher
Uno N, Hiramatsu K, Uno K, Komoto S, Kazuki Y, Oshimura M. CRISPR/Cas9-induced transgene insertion and telomere-associated truncation of a single human chromosome for chromosome engineering in CHO and A9 cells. Sci Rep. 2017;7:12739 pubmed publisher
Kulcsár P, Tálas A, Huszár K, Ligeti Z, Tóth E, Weinhardt N, et al. Crossing enhanced and high fidelity SpCas9 nucleases to optimize specificity and cleavage. Genome Biol. 2017;18:190 pubmed publisher
Cinghu S, Yang P, Kosak J, Conway A, Kumar D, Oldfield A, et al. Intragenic Enhancers Attenuate Host Gene Expression. Mol Cell. 2017;68:104-117.e6 pubmed publisher
Sancisi V, Manzotti G, Gugnoni M, Rossi T, Gandolfi G, Gobbi G, et al. RUNX2 expression in thyroid and breast cancer requires the cooperation of three non-redundant enhancers under the control of BRD4 and c-JUN. Nucleic Acids Res. 2017;45:11249-11267 pubmed publisher
Feng Y, Xiang J, Liu S, Guo T, Yan G, Feng Y, et al. H2AX facilitates classical non-homologous end joining at the expense of limited nucleotide loss at repair junctions. Nucleic Acids Res. 2017;45:10614-10633 pubmed publisher
Wenz C, Faust D, Linz B, Turmann C, Nikolova T, Bertin J, et al. t-BuOOH induces ferroptosis in human and murine cell lines. Arch Toxicol. 2018;92:759-775 pubmed publisher
Rickels R, Herz H, Sze C, Cao K, Morgan M, Collings C, et al. Histone H3K4 monomethylation catalyzed by Trr and mammalian COMPASS-like proteins at enhancers is dispensable for development and viability. Nat Genet. 2017;49:1647-1653 pubmed publisher
Gimpel P, Lee Y, Sobota R, Calvi A, Koullourou V, Patel R, et al. Nesprin-1α-Dependent Microtubule Nucleation from the Nuclear Envelope via Akap450 Is Necessary for Nuclear Positioning in Muscle Cells. Curr Biol. 2017;27:2999-3009.e9 pubmed publisher
Arnoult N, Correia A, Ma J, Merlo A, Garcia Gomez S, Maric M, et al. Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017;549:548-552 pubmed publisher
Fogarty N, McCarthy A, Snijders K, Powell B, Kubikova N, Blakeley P, et al. Genome editing reveals a role for OCT4 in human embryogenesis. Nature. 2017;550:67-73 pubmed publisher
Capone E, Piccolo E, Fichera I, Ciufici P, Barcaroli D, Sala A, et al. Generation of a novel Antibody-Drug Conjugate targeting endosialin: potent and durable antitumor response in sarcoma. Oncotarget. 2017;8:60368-60377 pubmed publisher
Liang P, Ding C, Sun H, Xie X, Xu Y, Zhang X, et al. Correction of ?-thalassemia mutant by base editor in human embryos. Protein Cell. 2017;8:811-822 pubmed publisher
Shao S, Ren C, Liu Z, Bai Y, Chen Z, Wei Z, et al. Enhancing CRISPR/Cas9-mediated homology-directed repair in mammalian cells by expressing Saccharomyces cerevisiae Rad52. Int J Biochem Cell Biol. 2017;92:43-52 pubmed publisher
Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Stem Cell Res. 2017;23:105-108 pubmed publisher
Wegner W, Ilgen P, Gregor C, van Dort J, Mott A, Steffens H, et al. In vivo mouse and live cell STED microscopy of neuronal actin plasticity using far-red emitting fluorescent proteins. Sci Rep. 2017;7:11781 pubmed publisher
Tu M, Rahim M, Sayed C, Mahmoud A, Makrigiannis A. Immunosurveillance and Immunoediting of Breast Cancer via Class I MHC Receptors. Cancer Immunol Res. 2017;5:1016-1028 pubmed publisher
Engelholm L, Riaz A, Serra D, Dagnæs Hansen F, Johansen J, Santoni Rugiu E, et al. CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma. Gastroenterology. 2017;153:1662-1673.e10 pubmed publisher
Fuster García C, García García G, Gonzalez Romero E, Jaijo T, Sequedo M, Ayuso C, et al. USH2A Gene Editing Using the CRISPR System. Mol Ther Nucleic Acids. 2017;8:529-541 pubmed publisher
Timin A, Muslimov A, Lepik K, Epifanovskaya O, Shakirova A, Mock U, et al. Efficient gene editing via non-viral delivery of CRISPR-Cas9 system using polymeric and hybrid microcarriers. Nanomedicine. 2018;14:97-108 pubmed publisher
Lenain C, de Graaf C, Pagie L, Visser N, de Haas M, de Vries S, et al. Massive reshaping of genome-nuclear lamina interactions during oncogene-induced senescence. Genome Res. 2017;27:1634-1644 pubmed publisher
Wang J, Kong D, Hoerner C, Loncarek J, Stearns T. Centriole triplet microtubules are required for stable centriole formation and inheritance in human cells. elife. 2017;6: pubmed publisher
Chihara K, Kato Y, Yoshiki H, Takeuchi K, Fujieda S, Sada K. Syk-dependent tyrosine phosphorylation of 3BP2 is required for optimal FcRγ-mediated phagocytosis and chemokine expression in U937 cells. Sci Rep. 2017;7:11480 pubmed publisher
Wu G, Mu T, Gao Z, Wang J, Sy M, Li C. Prion protein is required for tumor necrosis factor α (TNFα)-triggered nuclear factor κB (NF-κB) signaling and cytokine production. J Biol Chem. 2017;292:18747-18759 pubmed publisher
Nihongaki Y, Furuhata Y, Otabe T, Hasegawa S, Yoshimoto K, Sato M. CRISPR-Cas9-based photoactivatable transcription systems to induce neuronal differentiation. Nat Methods. 2017;14:963-966 pubmed publisher
Li Y, Kim J. Distinct roles of neuronal and microglial CB2 cannabinoid receptors in the mouse hippocampus. Neuroscience. 2017;363:11-25 pubmed publisher
Tungadi E, Ito A, Kiyomitsu T, Goshima G. Human microcephaly ASPM protein is a spindle pole-focusing factor that functions redundantly with CDK5RAP2. J Cell Sci. 2017;130:3676-3684 pubmed publisher
Loregger A, Raaben M, Tan J, Scheij S, Moeton M, van den Berg M, et al. Haploid Mammalian Genetic Screen Identifies UBXD8 as a Key Determinant of HMGCR Degradation and Cholesterol Biosynthesis. Arterioscler Thromb Vasc Biol. 2017;37:2064-2074 pubmed publisher
Papizan J, Garry G, Brezprozvannaya S, McAnally J, Bassel Duby R, Liu N, et al. Deficiency in Kelch protein Klhl31 causes congenital myopathy in mice. J Clin Invest. 2017;127:3730-3740 pubmed publisher
Johansen A, Molenaar B, Versteeg D, Leitoguinho A, Demkes C, Spanjaard B, et al. Postnatal Cardiac Gene Editing Using CRISPR/Cas9 With AAV9-Mediated Delivery of Short Guide RNAs Results in Mosaic Gene Disruption. Circ Res. 2017;121:1168-1181 pubmed publisher
Shao S, Chang L, Sun Y, Hou Y, Fan X, Sun Y. Multiplexed sgRNA Expression Allows Versatile Single Nonrepetitive DNA Labeling and Endogenous Gene Regulation. ACS Synth Biol. 2018;7:176-186 pubmed publisher
Alomer R, da Silva E, Chen J, Piekarz K, McDonald K, Sansam C, et al. Esco1 and Esco2 regulate distinct cohesin functions during cell cycle progression. Proc Natl Acad Sci U S A. 2017;114:9906-9911 pubmed publisher
Nakanishi M, Nomura J, Ji X, Tamada K, Arai T, Takahashi E, et al. Functional significance of rare neuroligin 1 variants found in autism. PLoS Genet. 2017;13:e1006940 pubmed publisher
Vangapandu H, Havranek O, Ayres M, Kaipparettu B, Balakrishnan K, Wierda W, et al. B-cell Receptor Signaling Regulates Metabolism in Chronic Lymphocytic Leukemia. Mol Cancer Res. 2017;15:1692-1703 pubmed publisher
Li G, Zhang X, Zhong C, Mo J, Quan R, Yang J, et al. Small molecules enhance CRISPR/Cas9-mediated homology-directed genome editing in primary cells. Sci Rep. 2017;7:8943 pubmed publisher
Lownik J, Luker A, Damle S, Cooley L, El Sayed R, Hutloff A, et al. ADAM10-Mediated ICOS Ligand Shedding on B Cells Is Necessary for Proper T Cell ICOS Regulation and T Follicular Helper Responses. J Immunol. 2017;199:2305-2315 pubmed publisher
Mezzadra R, Sun C, Jae L, Gomez Eerland R, de Vries E, Wu W, et al. Identification of CMTM6 and CMTM4 as PD-L1 protein regulators. Nature. 2017;549:106-110 pubmed publisher
Neiman Zenevich J, Stuart S, Abdel Nour M, Girardin S, Mogridge J. Listeria monocytogenes and Shigella flexneri Activate the NLRP1B Inflammasome. Infect Immun. 2017;85: pubmed publisher
Kieffer Kwon K, Nimura K, Rao S, Xu J, Jung S, Pekowska A, et al. Myc Regulates Chromatin Decompaction and Nuclear Architecture during B Cell Activation. Mol Cell. 2017;67:566-578.e10 pubmed publisher
Cho C, Smallwood P, Nathans J. Reck and Gpr124 Are Essential Receptor Cofactors for Wnt7a/Wnt7b-Specific Signaling in Mammalian CNS Angiogenesis and Blood-Brain Barrier Regulation. Neuron. 2017;95:1056-1073.e5 pubmed publisher
Tang Z, Takahashi Y, Chen C, Liu Y, He H, Tsotakos N, et al. Atg2A/B deficiency switches cytoprotective autophagy to non-canonical caspase-8 activation and apoptosis. Cell Death Differ. 2017;24:2127-2138 pubmed publisher
Jiang R, Yemelyanova A, Xing D, Anchoori R, Hamazaki J, Murata S, et al. Early and consistent overexpression of ADRM1 in ovarian high-grade serous carcinoma. J Ovarian Res. 2017;10:53 pubmed publisher
Mayor Ruiz C, Dominguez O, Fernandez Capetillo O. TrapSeq: An RNA Sequencing-Based Pipeline for the Identification of Gene-Trap Insertions in Mammalian Cells. J Mol Biol. 2017;429:2780-2789 pubmed publisher
van Eijl R, van den Brand T, Nguyen L, Mulder K. Reactivity of human AGO2 monoclonal antibody 11A9 with the SWI/SNF complex: A case study for rigorously defining antibody selectivity. Sci Rep. 2017;7:7278 pubmed publisher
Tsunematsu H, Uyeda A, Yamamoto N, Sugo N. Immunocytochemistry and fluorescence imaging efficiently identify individual neurons with CRISPR/Cas9-mediated gene disruption in primary cortical cultures. BMC Neurosci. 2017;18:55 pubmed publisher
Ueda A, Akagi T, Yokota T. GA-Binding Protein Alpha Is Involved in the Survival of Mouse Embryonic Stem Cells. Stem Cells. 2017;35:2229-2238 pubmed publisher
Yamaguchi J, Tanaka T, Saito H, Nomura S, Aburatani H, Waki H, et al. Echinomycin inhibits adipogenesis in 3T3-L1 cells in a HIF-independent manner. Sci Rep. 2017;7:6516 pubmed publisher
Yasumoto J, Kasai H, Yoshimura K, Otoguro T, Watashi K, Wakita T, et al. Hepatitis B virus prevents excessive viral production via reduction of cell death-inducing DFF45-like effectors. J Gen Virol. 2017;98:1762-1773 pubmed publisher
Hanssen L, Kassouf M, Oudelaar A, Biggs D, Preece C, Downes D, et al. Tissue-specific CTCF-cohesin-mediated chromatin architecture delimits enhancer interactions and function in vivo. Nat Cell Biol. 2017;19:952-961 pubmed publisher
Royba E, Miyamoto T, Natsuko Akutsu S, Hosoba K, Tauchi H, Kudo Y, et al. Evaluation of ATM heterozygous mutations underlying individual differences in radiosensitivity using genome editing in human cultured cells. Sci Rep. 2017;7:5996 pubmed publisher
Judge L, Perez Bermejo J, Truong A, Ribeiro A, Yoo J, Jensen C, et al. A BAG3 chaperone complex maintains cardiomyocyte function during proteotoxic stress. JCI Insight. 2017;2: pubmed publisher
Zhang Z, Meszaros G, He W, Xu Y, de Fatima Magliarelli H, Mailly L, et al. Protein kinase D at the Golgi controls NLRP3 inflammasome activation. J Exp Med. 2017;214:2671-2693 pubmed publisher
Vukotic M, Nolte H, König T, Saita S, Ananjew M, Kruger M, et al. Acylglycerol Kinase Mutated in Sengers Syndrome Is a Subunit of the TIM22 Protein Translocase in Mitochondria. Mol Cell. 2017;67:471-483.e7 pubmed publisher
Wahi K, Friesen S, Coppola V, Cole S. Putative binding sites for mir-125 family miRNAs in the mouse Lfng 3'UTR affect transcript expression in the segmentation clock, but mir-125a-5p is dispensable for normal somitogenesis. Dev Dyn. 2017;246:740-748 pubmed publisher
Saito S, Maeda R, Adachi N. Dual loss of human POLQ and LIG4 abolishes random integration. Nat Commun. 2017;8:16112 pubmed publisher
Cook P, Thomas R, Kannan R, de Leon E, Drilon A, Rosenblum M, et al. Somatic chromosomal engineering identifies BCAN-NTRK1 as a potent glioma driver and therapeutic target. Nat Commun. 2017;8:15987 pubmed publisher
Takii R, Fujimoto M, Matsuura Y, Wu F, Oshibe N, Takaki E, et al. HSF1 and HSF3 cooperatively regulate the heat shock response in lizards. PLoS ONE. 2017;12:e0180776 pubmed publisher
Tálas A, Kulcsár P, Weinhardt N, Borsy A, Tóth E, Szebényi K, et al. A convenient method to pre-screen candidate guide RNAs for CRISPR/Cas9 gene editing by NHEJ-mediated integration of a 'self-cleaving' GFP-expression plasmid. DNA Res. 2017;24:609-621 pubmed publisher
Zhang C, Lai M, Khandan L, Lee L, Chen Z, Junge H. Norrin-induced Frizzled4 endocytosis and endo-lysosomal trafficking control retinal angiogenesis and barrier function. Nat Commun. 2017;8:16050 pubmed publisher
Luo W, Galvan D, Woodard L, Dorset D, Levy S, Wilson M. Comparative analysis of chimeric ZFP-, TALE- and Cas9-piggyBac transposases for integration into a single locus in human cells. Nucleic Acids Res. 2017;45:8411-8422 pubmed publisher
Romanel A, Garritano S, Stringa B, Blattner M, Dalfovo D, Chakravarty D, et al. Inherited determinants of early recurrent somatic mutations in prostate cancer. Nat Commun. 2017;8:48 pubmed publisher
Cody W, Scholthof H, Mirkov T. Multiplexed Gene Editing and Protein Overexpression Using a Tobacco mosaic virus Viral Vector. Plant Physiol. 2017;175:23-35 pubmed publisher
Barzi M, Pankowicz F, Zorman B, Liu X, Legras X, Yang D, et al. A novel humanized mouse lacking murine P450 oxidoreductase for studying human drug metabolism. Nat Commun. 2017;8:39 pubmed publisher
Mojarad B, Gupta G, Hasegan M, Goudiam O, Basto R, Gingras A, et al. CEP19 cooperates with FOP and CEP350 to drive early steps in the ciliogenesis programme. Open Biol. 2017;7: pubmed publisher
Lai M, Zhang C, Shi J, Johnson V, Khandan L, McVey J, et al. TSPAN12 Is a Norrin Co-receptor that Amplifies Frizzled4 Ligand Selectivity and Signaling. Cell Rep. 2017;19:2809-2822 pubmed publisher
Sternburg E, Dias K, Karginov F. Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells. J Vis Exp. 2017;: pubmed publisher
Delerue F, Ittner L. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J Vis Exp. 2017;: pubmed publisher
Fukuhara T, Tamura T, Ono C, Shiokawa M, Mori H, Uemura K, et al. Host-derived apolipoproteins play comparable roles with viral secretory proteins Erns and NS1 in the infectious particle formation of Flaviviridae. PLoS Pathog. 2017;13:e1006475 pubmed publisher
Noda T, Oji A, Ikawa M. Genome Editing in Mouse Zygotes and Embryonic Stem Cells by Introducing SgRNA/Cas9 Expressing Plasmids. Methods Mol Biol. 2017;1630:67-80 pubmed publisher
O Hayre M, Eichel K, Avino S, Zhao X, Steffen D, Feng X, et al. Genetic evidence that β-arrestins are dispensable for the initiation of β2-adrenergic receptor signaling to ERK. Sci Signal. 2017;10: pubmed publisher
Shi Z, Fujii K, Kovary K, Genuth N, Röst H, Teruel M, et al. Heterogeneous Ribosomes Preferentially Translate Distinct Subpools of mRNAs Genome-wide. Mol Cell. 2017;67:71-83.e7 pubmed publisher
Yang F, Liu C, Chen D, Tu M, Xie H, Sun H, et al. CRISPR/Cas9-loxP-Mediated Gene Editing as a Novel Site-Specific Genetic Manipulation Tool. Mol Ther Nucleic Acids. 2017;7:378-386 pubmed publisher
Chida T, Ito M, Nakashima K, Kanegae Y, Aoshima T, Takabayashi S, et al. Critical role of CREBH-mediated induction of transforming growth factor ?2 by hepatitis C virus infection in fibrogenic responses in hepatic stellate cells. Hepatology. 2017;66:1430-1443 pubmed publisher
Mohsen Z, Sim H, García Galiano D, Han X, Bellefontaine N, Saunders T, et al. Sexually dimorphic distribution of Prokr2 neurons revealed by the Prokr2-Cre mouse model. Brain Struct Funct. 2017;222:4111-4129 pubmed publisher
Mou H, Smith J, Peng L, Yin H, Moore J, Zhang X, et al. CRISPR/Cas9-mediated genome editing induces exon skipping by alternative splicing or exon deletion. Genome Biol. 2017;18:108 pubmed publisher
Inoue T, Tsai B. Regulated Erlin-dependent release of the B12 transmembrane J-protein promotes ER membrane penetration of a non-enveloped virus. PLoS Pathog. 2017;13:e1006439 pubmed publisher
Guo L, Allu P, Zandarashvili L, McKinley K, Sekulic N, Dawicki McKenna J, et al. Centromeres are maintained by fastening CENP-A to DNA and directing an arginine anchor-dependent nucleosome transition. Nat Commun. 2017;8:15775 pubmed publisher
Lu X, Nowicka U, Sridharan V, Liu F, Randles L, Hymel D, et al. Structure of the Rpn13-Rpn2 complex provides insights for Rpn13 and Uch37 as anticancer targets. Nat Commun. 2017;8:15540 pubmed publisher
Harayama T, Riezman H. Detection of genome-edited mutant clones by a simple competition-based PCR method. PLoS ONE. 2017;12:e0179165 pubmed publisher
Zhang C, Lu L. Precise and Efficient In-Frame Integration of an Exogenous GFP Tag in Aspergillus fumigatus by a CRISPR System. Methods Mol Biol. 2017;1625:249-258 pubmed publisher
Kuscu C, Parlak M, Tufan T, Yang J, Szlachta K, Wei X, et al. CRISPR-STOP: gene silencing through base-editing-induced nonsense mutations. Nat Methods. 2017;14:710-712 pubmed publisher
Simsek D, Tiu G, Flynn R, Byeon G, Leppek K, Xu A, et al. The Mammalian Ribo-interactome Reveals Ribosome Functional Diversity and Heterogeneity. Cell. 2017;169:1051-1065.e18 pubmed publisher
Peng X, So K, He L, Zhao Y, Zhou J, Li Y, et al. MyoD- and FoxO3-mediated hotspot interaction orchestrates super-enhancer activity during myogenic differentiation. Nucleic Acids Res. 2017;45:8785-8805 pubmed publisher
Beneke T, Madden R, Makin L, Valli J, Sunter J, Gluenz E. A CRISPR Cas9 high-throughput genome editing toolkit for kinetoplastids. R Soc Open Sci. 2017;4:170095 pubmed publisher
Sin Y, Price P, Ballantyne L, Funk C. Proof-of-Concept Gene Editing for the Murine Model of Inducible Arginase-1 Deficiency. Sci Rep. 2017;7:2585 pubmed publisher
Brockmann M, Blomen V, Nieuwenhuis J, Stickel E, Raaben M, Bleijerveld O, et al. Genetic wiring maps of single-cell protein states reveal an off-switch for GPCR signalling. Nature. 2017;546:307-311 pubmed publisher
Sinha S, Thomas D, Chan S, Gao Y, Brunen D, Torabi D, et al. Systematic discovery of mutation-specific synthetic lethals by mining pan-cancer human primary tumor data. Nat Commun. 2017;8:15580 pubmed publisher
Miyamoto T, Lo P, Saichi N, Ueda K, Hirata M, Tanikawa C, et al. Argininosuccinate synthase 1 is an intrinsic Akt repressor transactivated by p53. Sci Adv. 2017;3:e1603204 pubmed publisher
Wang Y, Chang L, Zhai J, Wu Q, Wang D, Wang Y. Generation of carbamoyl phosphate synthetase 1 reporter cell lines for the assessment of ammonia metabolism. J Cell Mol Med. 2017;21:3214-3223 pubmed publisher
Müller T, Dewitz C, Schmitz J, Schröder A, Bräsen J, Stockwell B, et al. Necroptosis and ferroptosis are alternative cell death pathways that operate in acute kidney failure. Cell Mol Life Sci. 2017;74:3631-3645 pubmed publisher
Butler J, Santos R, Martens G, Ladowski J, Wang Z, Li P, et al. Efficient generation of targeted and controlled mutational events in porcine cells using nuclease-directed homologous recombination. J Surg Res. 2017;212:238-245 pubmed publisher
Li Z, Li Y, Bi Y, Zhang H, Yao Y, Li Q, et al. Extracellular Interactions between Hepatitis C Virus and Secreted Apolipoprotein E. J Virol. 2017;91: pubmed publisher
Gomes Silva D, Srinivasan M, Sharma S, Lee C, Wagner D, Davis T, et al. CD7-edited T cells expressing a CD7-specific CAR for the therapy of T-cell malignancies. Blood. 2017;130:285-296 pubmed publisher
Petris G, Casini A, Montagna C, Lorenzin F, Prandi D, Romanel A, et al. Hit and go CAS9 delivered through a lentiviral based self-limiting circuit. Nat Commun. 2017;8:15334 pubmed publisher
Yao X, Wang X, Liu J, Hu X, Shi L, Shen X, et al. CRISPR/Cas9 - Mediated Precise Targeted Integration In Vivo Using a Double Cut Donor with Short Homology Arms. EBioMedicine. 2017;20:19-26 pubmed publisher
Nora E, Goloborodko A, Valton A, Gibcus J, Uebersohn A, Abdennur N, et al. Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization. Cell. 2017;169:930-944.e22 pubmed publisher
Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, et al. Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Cell Res. 2017;27:801-814 pubmed publisher
Wallis A, Wallace E, Hostager B, Yi Z, Houtman J, Bishop G. TRAF3 enhances TCR signaling by regulating the inhibitors Csk and PTPN22. Sci Rep. 2017;7:2081 pubmed publisher
Jaco I, Annibaldi A, Lalaoui N, Wilson R, Tenev T, Laurien L, et al. MK2 Phosphorylates RIPK1 to Prevent TNF-Induced Cell Death. Mol Cell. 2017;66:698-710.e5 pubmed publisher
Cunningham C, Wu Z, Jafari A, Zhao B, Schrode K, Harkins Perry S, et al. The murine catecholamine methyltransferase mTOMT is essential for mechanotransduction by cochlear hair cells. elife. 2017;6: pubmed publisher
Ono C, Fukuhara T, Motooka D, Nakamura S, Okuzaki D, Yamamoto S, et al. Characterization of miR-122-independent propagation of HCV. PLoS Pathog. 2017;13:e1006374 pubmed publisher
Elia I, Broekaert D, Christen S, Boon R, Radaelli E, Orth M, et al. Proline metabolism supports metastasis formation and could be inhibited to selectively target metastasizing cancer cells. Nat Commun. 2017;8:15267 pubmed publisher
Natsume T, Nishimura K, Minocherhomji S, Bhowmick R, Hickson I, Kanemaki M. Acute inactivation of the replicative helicase in human cells triggers MCM8-9-dependent DNA synthesis. Genes Dev. 2017;31:816-829 pubmed publisher
Bisht K, Grill S, Graniel J, Nandakumar J. A lentivirus-free inducible CRISPR-Cas9 system for efficient targeting of human genes. Anal Biochem. 2017;530:40-49 pubmed publisher
Haarhuis J, van der Weide R, Blomen V, Yáñez Cuna J, Amendola M, van Ruiten M, et al. The Cohesin Release Factor WAPL Restricts Chromatin Loop Extension. Cell. 2017;169:693-707.e14 pubmed publisher
Kawarada L, Suzuki T, Ohira T, Hirata S, Miyauchi K, Suzuki T. ALKBH1 is an RNA dioxygenase responsible for cytoplasmic and mitochondrial tRNA modifications. Nucleic Acids Res. 2017;45:7401-7415 pubmed publisher
Zou Z, Huang K, Wei Y, Chen H, Liu Z, Jin M. Construction of a highly efficient CRISPR/Cas9-mediated duck enteritis virus-based vaccine against H5N1 avian influenza virus and duck Tembusu virus infection. Sci Rep. 2017;7:1478 pubmed publisher
Day T, Layer J, Cleary J, Guha S, Stevenson K, Tivey T, et al. PARP3 is a promoter of chromosomal rearrangements and limits G4 DNA. Nat Commun. 2017;8:15110 pubmed publisher
Zhang Y, Xie L, Gunasekar S, Tong D, Mishra A, Gibson W, et al. SWELL1 is a regulator of adipocyte size, insulin signalling and glucose homeostasis. Nat Cell Biol. 2017;19:504-517 pubmed publisher
Nagashima K, Sawa S, Nitta T, Tsutsumi M, Okamura T, Penninger J, et al. Identification of subepithelial mesenchymal cells that induce IgA and diversify gut microbiota. Nat Immunol. 2017;18:675-682 pubmed publisher
Treiber T, Treiber N, Plessmann U, Harlander S, Daiß J, Eichner N, et al. A Compendium of RNA-Binding Proteins that Regulate MicroRNA Biogenesis. Mol Cell. 2017;66:270-284.e13 pubmed publisher
She Z, Pan M, Tan F, Yang W. Minus end-directed kinesin-14 KIFC1 regulates the positioning and architecture of the Golgi apparatus. Oncotarget. 2017;8:36469-36483 pubmed publisher
Niccheri F, Pecori R, Conticello S. An efficient method to enrich for knock-out and knock-in cellular clones using the CRISPR/Cas9 system. Cell Mol Life Sci. 2017;74:3413-3423 pubmed publisher
Diao Y, Fang R, Li B, Meng Z, Yu J, Qiu Y, et al. A tiling-deletion-based genetic screen for cis-regulatory element identification in mammalian cells. Nat Methods. 2017;14:629-635 pubmed publisher
Li Q, Li B, Hu L, Ning H, Jiang M, Wang D, et al. Identification of a novel functional JAK1 S646P mutation in acute lymphoblastic leukemia. Oncotarget. 2017;8:34687-34697 pubmed publisher
Zhu Z, Li C, Du X, Wang G, Cao W, Yang F, et al. Foot-and-mouth disease virus infection inhibits LGP2 protein expression to exaggerate inflammatory response and promote viral replication. Cell Death Dis. 2017;8:e2747 pubmed publisher
Tanaka A, Tumkosit U, Nakamura S, Motooka D, Kishishita N, Priengprom T, et al. Genome-Wide Screening Uncovers the Significance of N-Sulfation of Heparan Sulfate as a Host Cell Factor for Chikungunya Virus Infection. J Virol. 2017;91: pubmed publisher
Chujo T, Yamazaki T, Kawaguchi T, Kurosaka S, Takumi T, Nakagawa S, et al. Unusual semi-extractability as a hallmark of nuclear body-associated architectural noncoding RNAs. EMBO J. 2017;36:1447-1462 pubmed publisher
Shinmyo Y, Kawasaki H. CRISPR/Cas9-Mediated Gene Knockout in the Mouse Brain Using In Utero Electroporation. Curr Protoc Neurosci. 2017;79:3.32.1-3.32.11 pubmed publisher
Honjoh C, Chihara K, Yoshiki H, Yamauchi S, Takeuchi K, Kato Y, et al. Association of C-Type Lectin Mincle with FcεRIβγ Subunits Leads to Functional Activation of RBL-2H3 Cells through Syk. Sci Rep. 2017;7:46064 pubmed publisher
Yan Y, Zhao W, Huang Y, Tong H, Xia Y, Jiang Q, et al. Loss of Polycomb Group Protein Pcgf1 Severely Compromises Proper Differentiation of Embryonic Stem Cells. Sci Rep. 2017;7:46276 pubmed publisher
Hsu S, Gilgenast T, Bartman C, Edwards C, Stonestrom A, Huang P, et al. The BET Protein BRD2 Cooperates with CTCF to Enforce Transcriptional and Architectural Boundaries. Mol Cell. 2017;66:102-116.e7 pubmed publisher
Yang Y, Liu B, Xu J, Wang J, Wu J, Shi C, et al. Derivation of Pluripotent Stem Cells with In Vivo Embryonic and Extraembryonic Potency. Cell. 2017;169:243-257.e25 pubmed publisher
Abeln M, Borst K, Cajic S, Thiesler H, Kats E, Albers I, et al. Sialylation Is Dispensable for Early Murine Embryonic Development in Vitro. Chembiochem. 2017;18:1305-1316 pubmed publisher
Kitada S, Kayama H, Okuzaki D, Koga R, Kobayashi M, Arima Y, et al. BATF2 inhibits immunopathological Th17 responses by suppressing Il23a expression during Trypanosoma cruzi infection. J Exp Med. 2017;214:1313-1331 pubmed publisher
Shimokawa M, Ohta Y, Nishikori S, Matano M, Takano A, Fujii M, et al. Visualization and targeting of LGR5+ human colon cancer stem cells. Nature. 2017;545:187-192 pubmed publisher
Legnini I, Di Timoteo G, Rossi F, Morlando M, Briganti F, Sthandier O, et al. Circ-ZNF609 Is a Circular RNA that Can Be Translated and Functions in Myogenesis. Mol Cell. 2017;66:22-37.e9 pubmed publisher
Gaj T, Staahl B, Rodrigues G, Limsirichai P, Ekman F, Doudna J, et al. Targeted gene knock-in by homology-directed genome editing using Cas9 ribonucleoprotein and AAV donor delivery. Nucleic Acids Res. 2017;45:e98 pubmed publisher
McFarland A, Luo S, Ahmed Qadri F, Zuck M, Thayer E, Goo Y, et al. Sensing of Bacterial Cyclic Dinucleotides by the Oxidoreductase RECON Promotes NF-κB Activation and Shapes a Proinflammatory Antibacterial State. Immunity. 2017;46:433-445 pubmed publisher
Perrin A, Rousseau J, Tremblay J. Increased Expression of Laminin Subunit Alpha 1 Chain by dCas9-VP160. Mol Ther Nucleic Acids. 2017;6:68-79 pubmed publisher
Turgeon M, Silander T, Doycheva D, Liao X, Rigden M, Ongaro L, et al. TRH Action Is Impaired in Pituitaries of Male IGSF1-Deficient Mice. Endocrinology. 2017;158:815-830 pubmed publisher
Feng W, Kawauchi D, Körkel Qu H, Deng H, Serger E, Sieber L, et al. Chd7 is indispensable for mammalian brain development through activation of a neuronal differentiation programme. Nat Commun. 2017;8:14758 pubmed publisher
Barr A, Cooper S, Heldt F, Butera F, Stoy H, Mansfeld J, et al. DNA damage during S-phase mediates the proliferation-quiescence decision in the subsequent G1 via p21 expression. Nat Commun. 2017;8:14728 pubmed publisher
Balczon R, Morrow K, Zhou C, Edmonds B, Alexeyev M, Pittet J, et al. Pseudomonas aeruginosa infection liberates transmissible, cytotoxic prion amyloids. FASEB J. 2017;31:2785-2796 pubmed publisher
Halim D, Wilson M, Oliver D, Brosens E, Verheij J, Han Y, et al. Loss of LMOD1 impairs smooth muscle cytocontractility and causes megacystis microcolon intestinal hypoperistalsis syndrome in humans and mice. Proc Natl Acad Sci U S A. 2017;114:E2739-E2747 pubmed publisher
Liu H, Leslie E, Carlson J, Beaty T, Marazita M, Lidral A, et al. Identification of common non-coding variants at 1p22 that are functional for non-syndromic orofacial clefting. Nat Commun. 2017;8:14759 pubmed publisher
Cruz Molina S, Respuela P, Tebartz C, Kolovos P, Nikolic M, Fueyo R, et al. PRC2 Facilitates the Regulatory Topology Required for Poised Enhancer Function during Pluripotent Stem Cell Differentiation. Cell Stem Cell. 2017;20:689-705.e9 pubmed publisher
Li Z, Bi Y, Xiao H, Sun L, Ren Y, Li Y, et al. CRISPR-Cas9 system-driven site-specific selection pressure on Herpes simplex virus genomes. Virus Res. 2018;244:286-295 pubmed publisher
Gao J, Hay T, Banfield B. The Product of the Herpes Simplex Virus 2 UL16 Gene Is Critical for the Egress of Capsids from the Nuclei of Infected Cells. J Virol. 2017;91: pubmed publisher
Tatebe H, Murayama S, Yonekura T, Hatano T, Richter D, Furuya T, et al. Substrate specificity of TOR complex 2 is determined by a ubiquitin-fold domain of the Sin1 subunit. elife. 2017;6: pubmed publisher
Ferry Q, Lyutova R, Fulga T. Rational design of inducible CRISPR guide RNAs for de novo assembly of transcriptional programs. Nat Commun. 2017;8:14633 pubmed publisher
Machitani M, Sakurai F, Wakabayashi K, Nakatani K, Takayama K, Tachibana M, et al. Inhibition of CRISPR/Cas9-Mediated Genome Engineering by a Type I Interferon-Induced Reduction in Guide RNA Expression. Biol Pharm Bull. 2017;40:272-277 pubmed publisher
Soonthornvacharin S, Rodriguez Frandsen A, Zhou Y, Galvez F, Huffmaster N, Tripathi S, et al. Systems-based analysis of RIG-I-dependent signalling identifies KHSRP as an inhibitor of RIG-I receptor activation. Nat Microbiol. 2017;2:17022 pubmed publisher
Mitzelfelt K, McDermott Roe C, Grzybowski M, Marquez M, Kuo C, Riedel M, et al. Efficient Precision Genome Editing in iPSCs via Genetic Co-targeting with Selection. Stem Cell Reports. 2017;8:491-499 pubmed publisher
Lv J, Zhou G, Chen X, Chen H, Wu K, Xiang L, et al. Targeted RP9 ablation and mutagenesis in mouse photoreceptor cells by CRISPR-Cas9. Sci Rep. 2017;7:43062 pubmed publisher
Lim J, Gopalappa R, Kim S, Ramakrishna S, Lee M, Kim W, et al. Somatic Mutations in TSC1 and TSC2 Cause Focal Cortical Dysplasia. Am J Hum Genet. 2017;100:454-472 pubmed publisher
Devost D, Sleno R, Pétrin D, Zhang A, Shinjo Y, Okde R, et al. Conformational Profiling of the AT1 Angiotensin II Receptor Reflects Biased Agonism, G Protein Coupling, and Cellular Context. J Biol Chem. 2017;292:5443-5456 pubmed publisher
Sugino N, Kawahara M, Tatsumi G, Kanai A, Matsui H, Yamamoto R, et al. A novel LSD1 inhibitor NCD38 ameliorates MDS-related leukemia with complex karyotype by attenuating leukemia programs via activating super-enhancers. Leukemia. 2017;31:2303-2314 pubmed publisher
Déry M, LeBlanc A. Luman contributes to brefeldin A-induced prion protein gene expression by interacting with the ERSE26 element. Sci Rep. 2017;7:42285 pubmed publisher
Shcherbakova A, Tiemann B, Buettner F, Bakker H. Distinct C-mannosylation of netrin receptor thrombospondin type 1 repeats by mammalian DPY19L1 and DPY19L3. Proc Natl Acad Sci U S A. 2017;114:2574-2579 pubmed publisher
Liu Y, Han X, Yuan J, Geng T, Chen S, Hu X, et al. Biallelic insertion of a transcriptional terminator via the CRISPR/Cas9 system efficiently silences expression of protein-coding and non-coding RNA genes. J Biol Chem. 2017;292:5624-5633 pubmed publisher
Hirose M, Hasegawa A, Mochida K, Matoba S, Hatanaka Y, Inoue K, et al. CRISPR/Cas9-mediated genome editing in wild-derived mice: generation of tamed wild-derived strains by mutation of the a (nonagouti) gene. Sci Rep. 2017;7:42476 pubmed publisher
Fan Y, Li H, Liang X, Xiang Z. CBX3 promotes colon cancer cell proliferation by CDK6 kinase-independent function during cell cycle. Oncotarget. 2017;8:19934-19946 pubmed publisher
He C, Yu T, Shi Y, Ma C, Yang W, Fang L, et al. MicroRNA 301A Promotes Intestinal Inflammation and Colitis-Associated Cancer Development by Inhibiting BTG1. Gastroenterology. 2017;152:1434-1448.e15 pubmed publisher
Staahl B, Benekareddy M, Coulon Bainier C, Banfal A, Floor S, Sabo J, et al. Efficient genome editing in the mouse brain by local delivery of engineered Cas9 ribonucleoprotein complexes. Nat Biotechnol. 2017;35:431-434 pubmed publisher
Ishizu N, Yui D, Hebisawa A, Aizawa H, Cui W, Fujita Y, et al. Impaired striatal dopamine release in homozygous Vps35 D620N knock-in mice. Hum Mol Genet. 2016;25:4507-4517 pubmed publisher
Chicaybam L, Barcelos C, Peixoto B, Carneiro M, Limia C, Redondo P, et al. An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells. Front Bioeng Biotechnol. 2016;4:99 pubmed publisher
Nounamo B, Li Y, O Byrne P, Kearney A, Khan A, Liu J. An interaction domain in human SAMD9 is essential for myxoma virus host-range determinant M062 antagonism of host anti-viral function. Virology. 2017;503:94-102 pubmed publisher
Kundu S, Ji F, Sunwoo H, Jain G, Lee J, Sadreyev R, et al. Polycomb Repressive Complex 1 Generates Discrete Compacted Domains that Change during Differentiation. Mol Cell. 2017;65:432-446.e5 pubmed publisher
El Fatimy R, Subramanian S, Uhlmann E, Krichevsky A. Genome Editing Reveals Glioblastoma Addiction to MicroRNA-10b. Mol Ther. 2017;25:368-378 pubmed publisher
Zhai S, Liu C, Zhang L, Zhu J, Guo J, Zhang J, et al. PLCE1 Promotes Esophageal Cancer Cell Progression by Maintaining the Transcriptional Activity of Snail. Neoplasia. 2017;19:154-164 pubmed publisher
Martinez A, Yamashita S, Nagaike T, Sakaguchi Y, Suzuki T, Tomita K. Human BCDIN3D monomethylates cytoplasmic histidine transfer RNA. Nucleic Acids Res. 2017;45:5423-5436 pubmed publisher
Goldfarb K, Cech T. Targeted CRISPR disruption reveals a role for RNase MRP RNA in human preribosomal RNA processing. Genes Dev. 2017;31:59-71 pubmed publisher
Golden R, Chen B, Li T, Braun J, Manjunath H, Chen X, et al. An Argonaute phosphorylation cycle promotes microRNA-mediated silencing. Nature. 2017;542:197-202 pubmed publisher
Callif B, Maunze B, Krueger N, Simpson M, Blackmore M. The application of CRISPR technology to high content screening in primary neurons. Mol Cell Neurosci. 2017;80:170-179 pubmed publisher
Horikiri T, Ohi H, Shibata M, Ikeya M, Ueno M, Sotozono C, et al. SOX10-Nano-Lantern Reporter Human iPS Cells; A Versatile Tool for Neural Crest Research. PLoS ONE. 2017;12:e0170342 pubmed publisher
Fu X, Zhang L, Jin Y, Sun X, Zhang A, Wen Z, et al. Loss of Myh14 Increases Susceptibility to Noise-Induced Hearing Loss in CBA/CaJ Mice. Neural Plast. 2016;2016:6720420 pubmed publisher
Cirera Salinas D, Yu J, Bodak M, Ngondo R, Herbert K, Ciaudo C. Noncanonical function of DGCR8 controls mESC exit from pluripotency. J Cell Biol. 2017;216:355-366 pubmed publisher
Cebrian Serrano A, Zha S, Hanssen L, Biggs D, Preece C, Davies B. Maternal Supply of Cas9 to Zygotes Facilitates the Efficient Generation of Site-Specific Mutant Mouse Models. PLoS ONE. 2017;12:e0169887 pubmed publisher
Sper R, Koh S, Zhang X, Simpson S, Collins B, Sommer J, et al. Generation of a Stable Transgenic Swine Model Expressing a Porcine Histone 2B-eGFP Fusion Protein for Cell Tracking and Chromosome Dynamics Studies. PLoS ONE. 2017;12:e0169242 pubmed publisher
Noguchi T, Ward J, Gubin M, Arthur C, Lee S, Hundal J, et al. Temporally Distinct PD-L1 Expression by Tumor and Host Cells Contributes to Immune Escape. Cancer Immunol Res. 2017;5:106-117 pubmed publisher
Juszkiewicz S, Hegde R. Initiation of Quality Control during Poly(A) Translation Requires Site-Specific Ribosome Ubiquitination. Mol Cell. 2017;65:743-750.e4 pubmed publisher
Tie J, Stafford D. Functional Study of the Vitamin K Cycle Enzymes in Live Cells. Methods Enzymol. 2017;584:349-394 pubmed publisher
Bhargava R, Carson C, Lee G, Stark J. Contribution of canonical nonhomologous end joining to chromosomal rearrangements is enhanced by ATM kinase deficiency. Proc Natl Acad Sci U S A. 2017;114:728-733 pubmed publisher
Rivera Torres N, Banas K, Bialk P, Bloh K, Kmiec E. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides. PLoS ONE. 2017;12:e0169350 pubmed publisher
Zhao W, Tong H, Huang Y, Yan Y, Teng H, Xia Y, et al. Essential Role for Polycomb Group Protein Pcgf6 in Embryonic Stem Cell Maintenance and a Noncanonical Polycomb Repressive Complex 1 (PRC1) Integrity. J Biol Chem. 2017;292:2773-2784 pubmed publisher
Gonen N, Quinn A, O Neill H, Koopman P, Lovell Badge R. Normal Levels of Sox9 Expression in the Developing Mouse Testis Depend on the TES/TESCO Enhancer, but This Does Not Act Alone. PLoS Genet. 2017;13:e1006520 pubmed publisher
Rauch B, Silvis M, Hultquist J, Waters C, McGregor M, Krogan N, et al. Inhibition of CRISPR-Cas9 with Bacteriophage Proteins. Cell. 2017;168:150-158.e10 pubmed publisher
Hay E, Knowles C, Kolb A, Mackenzie A. Using the CRISPR/Cas9 system to understand neuropeptide biology and regulation. Neuropeptides. 2017;64:19-25 pubmed publisher
Ouellet D, Cherif K, Rousseau J, Tremblay J. Deletion of the GAA repeats from the human frataxin gene using the CRISPR-Cas9 system in YG8R-derived cells and mouse models of Friedreich ataxia. Gene Ther. 2017;24:265-274 pubmed publisher
Van Nostrand E, Gelboin Burkhart C, Wang R, Pratt G, Blue S, Yeo G. CRISPR/Cas9-mediated integration enables TAG-eCLIP of endogenously tagged RNA binding proteins. Methods. 2017;118-119:50-59 pubmed publisher
Qaisar N, Lin S, Ryan G, Yang C, Oikemus S, Brodsky M, et al. A Critical Role for the Type I Interferon Receptor in Virus-Induced Autoimmune Diabetes in Rats. Diabetes. 2017;66:145-157 pubmed publisher
Bompada P, Atac D, Luan C, Andersson R, Omella J, Laakso E, et al. Histone acetylation of glucose-induced thioredoxin-interacting protein gene expression in pancreatic islets. Int J Biochem Cell Biol. 2016;81:82-91 pubmed publisher
Morgenstern J, Fleming T, Schumacher D, Eckstein V, Freichel M, Herzig S, et al. Loss of Glyoxalase 1 Induces Compensatory Mechanism to Achieve Dicarbonyl Detoxification in Mammalian Schwann Cells. J Biol Chem. 2017;292:3224-3238 pubmed publisher
Song C, Li Y, Mou H, Moore J, Park A, Pomyen Y, et al. Genome-Wide CRISPR Screen Identifies Regulators of Mitogen-Activated Protein Kinase as Suppressors of Liver Tumors in Mice. Gastroenterology. 2017;152:1161-1173.e1 pubmed publisher
Ishimura R, Obata M, Kageyama S, Daniel J, Tanaka K, Komatsu M. A novel approach to assess the ubiquitin-fold modifier 1-system in cells. FEBS Lett. 2017;591:196-204 pubmed publisher
Yamashita S, Jin X, Furukawa K, Hamasaki M, Nezu A, Otera H, et al. Mitochondrial division occurs concurrently with autophagosome formation but independently of Drp1 during mitophagy. J Cell Biol. 2016;215:649-665 pubmed
Pirnie S, Osman A, Zhu Y, Carmichael G. An Ultraconserved Element (UCE) controls homeostatic splicing of ARGLU1 mRNA. Nucleic Acids Res. 2017;45:3473-3486 pubmed publisher
Yagita Y, Shinohara K, Abe Y, Nakagawa K, Al Owain M, Alkuraya F, et al. Deficiency of a Retinal Dystrophy Protein, Acyl-CoA Binding Domain-containing 5 (ACBD5), Impairs Peroxisomal ?-Oxidation of Very-long-chain Fatty Acids. J Biol Chem. 2017;292:691-705 pubmed publisher
Wang K, Tang X, Liu Y, Xie Z, Zou X, Li M, et al. Efficient Generation of Orthologous Point Mutations in Pigs via CRISPR-assisted ssODN-mediated Homology-directed Repair. Mol Ther Nucleic Acids. 2016;5:e396 pubmed publisher
Aida T, Nakade S, Sakuma T, Izu Y, Oishi A, Mochida K, et al. Gene cassette knock-in in mammalian cells and zygotes by enhanced MMEJ. BMC Genomics. 2016;17:979 pubmed
Sasaki S, Ibi T, Akiyama T, Fukushima M, Sugimoto Y. Loss of maternal ANNEXIN A10 via a 34-kb deleted-type copy number variation is associated with embryonic mortality in Japanese Black cattle. BMC Genomics. 2016;17:968 pubmed
Xu Y, Anderson D, Ye Y. The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation. Cell Discov. 2016;2:16040 pubmed
Okashita N, Suwa Y, Nishimura O, Sakashita N, Kadota M, Nagamatsu G, et al. PRDM14 Drives OCT3/4 Recruitment via Active Demethylation in the Transition from Primed to Naive Pluripotency. Stem Cell Reports. 2016;7:1072-1086 pubmed publisher
Lee W, Higuchi H, Ikeda S, Macke E, Takimoto T, Pattnaik B, et al. Mouse Tmem135 mutation reveals a mechanism involving mitochondrial dynamics that leads to age-dependent retinal pathologies. elife. 2016;5: pubmed publisher
Ushiki A, Matsuzaki H, Ishida J, Fukamizu A, Tanimoto K. Long-Range Control of Renin Gene Expression in Tsukuba Hypertensive Mice. PLoS ONE. 2016;11:e0166974 pubmed publisher
Tsutsui H, Higashiyama T. pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana. Plant Cell Physiol. 2017;58:46-56 pubmed publisher
Le M, Haddad D, Ling A, Li C, So C, Chopra A, et al. Kin17 facilitates multiple double-strand break repair pathways that govern B cell class switching. Sci Rep. 2016;6:37215 pubmed publisher
Callegari S, Oeljeklaus S, Warscheid B, Dennerlein S, Thumm M, Rehling P, et al. Phospho-ubiquitin-PARK2 complex as a marker for mitophagy defects. Autophagy. 2017;13:201-211 pubmed publisher
Fujii S, Shinjo K, Matsumoto S, Harada T, Nojima S, Sato S, et al. Epigenetic upregulation of ARL4C, due to DNA hypomethylation in the 3'-untranslated region, promotes tumorigenesis of lung squamous cell carcinoma. Oncotarget. 2016;7:81571-81587 pubmed publisher
Schneider S, Balbach M, Jan F Jikeli -, Fietz D, Nettersheim D, Jostes S, et al. Re-visiting the Protamine-2 locus: deletion, but not haploinsufficiency, renders male mice infertile. Sci Rep. 2016;6:36764 pubmed publisher
Lin J, Kumari S, Kim C, Van T, Wachsmuth L, Polykratis A, et al. RIPK1 counteracts ZBP1-mediated necroptosis to inhibit inflammation. Nature. 2016;540:124-128 pubmed publisher
Shide K, Kameda T, Yamaji T, Sekine M, Inada N, Kamiunten A, et al. Calreticulin mutant mice develop essential thrombocythemia that is ameliorated by the JAK inhibitor ruxolitinib. Leukemia. 2017;31:1136-1144 pubmed publisher
Bisht K, Smith E, Tesmer V, Nandakumar J. Structural and functional consequences of a disease mutation in the telomere protein TPP1. Proc Natl Acad Sci U S A. 2016;113:13021-13026 pubmed
Young S, Miyata H, Satouh Y, Aitken R, Baker M, Ikawa M. CABYR is essential for fibrous sheath integrity and progressive motility in mouse spermatozoa. J Cell Sci. 2016;129:4379-4387 pubmed
Ishihara K, Nakamoto M, Nakao M. DNA methylation-independent removable insulator controls chromatin remodeling at the HOXA locus via retinoic acid signaling. Hum Mol Genet. 2016;25:5383-5394 pubmed publisher
Gómez H L, Felipe Medina N, Sanchez Martin M, Davies O, Ramos I, García Tuñón I, et al. C14ORF39/SIX6OS1 is a constituent of the synaptonemal complex and is essential for mouse fertility. Nat Commun. 2016;7:13298 pubmed publisher
Daer R, Cutts J, Brafman D, Haynes K. The Impact of Chromatin Dynamics on Cas9-Mediated Genome Editing in Human Cells. ACS Synth Biol. 2017;6:428-438 pubmed publisher
Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, et al. Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Sci Rep. 2016;6:35747 pubmed publisher
Naert T, Colpaert R, Van Nieuwenhuysen T, Dimitrakopoulou D, Leoen J, Haustraete J, et al. CRISPR/Cas9 mediated knockout of rb1 and rbl1 leads to rapid and penetrant retinoblastoma development in Xenopus tropicalis. Sci Rep. 2016;6:35264 pubmed publisher
Lee C, Zhu H, Davis T, Deshmukh H, Bao G. Design and Validation of CRISPR/Cas9 Systems for Targeted Gene Modification in Induced Pluripotent Stem Cells. Methods Mol Biol. 2017;1498:3-21 pubmed
Zhu Z, Wang G, Yang F, Cao W, Mao R, Du X, et al. Foot-and-Mouth Disease Virus Viroporin 2B Antagonizes RIG-I-Mediated Antiviral Effects by Inhibition of Its Protein Expression. J Virol. 2016;90:11106-11121 pubmed
Kherdjemil Y, Lalonde R, Sheth R, Dumouchel A, de Martino G, Pineault K, et al. Evolution of Hoxa11 regulation in vertebrates is linked to the pentadactyl state. Nature. 2016;539:89-92 pubmed publisher
Shintaku J, Peterson J, Talbert E, Gu J, Ladner K, Williams D, et al. MyoD Regulates Skeletal Muscle Oxidative Metabolism Cooperatively with Alternative NF-?B. Cell Rep. 2016;17:514-526 pubmed publisher
Tanigawa H, Miyata K, Tian Z, Aoi J, Kadomatsu T, Fukushima S, et al. Upregulation of ANGPTL6 in mouse keratinocytes enhances susceptibility to psoriasis. Sci Rep. 2016;6:34690 pubmed publisher
Richter Dennerlein R, Oeljeklaus S, Lorenzi I, Ronsör C, Bareth B, Schendzielorz A, et al. Mitochondrial Protein Synthesis Adapts to Influx of Nuclear-Encoded Protein. Cell. 2016;167:471-483.e10 pubmed publisher
Edgar J, Manna P, Nishimura S, Banting G, Robinson M. Tetherin is an exosomal tether. elife. 2016;5: pubmed publisher
Roncagalli R, Cucchetti M, Jarmuzynski N, Gregoire C, Bergot E, Audebert S, et al. The scaffolding function of the RLTPR protein explains its essential role for CD28 co-stimulation in mouse and human T cells. J Exp Med. 2016;213:2437-2457 pubmed
Tóth E, Weinhardt N, Bencsura P, Huszár K, Kulcsár P, Tálas A, et al. Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Biol Direct. 2016;11:46 pubmed publisher
Young S, Miyata H, Satouh Y, Muto M, Larsen M, Aitken R, et al. CRISPR/Cas9-mediated mutation revealed cytoplasmic tail is dispensable for IZUMO1 function and male fertility. Reproduction. 2016;152:665-672 pubmed
Tan X, Thapa N, Liao Y, Choi S, Anderson R. PtdIns(4,5)P2 signaling regulates ATG14 and autophagy. Proc Natl Acad Sci U S A. 2016;113:10896-901 pubmed publisher
Xue Z, Hennelly S, Doyle B, Gulati A, Novikova I, Sanbonmatsu K, et al. A G-Rich Motif in the lncRNA Braveheart Interacts with a Zinc-Finger Transcription Factor to Specify the Cardiovascular Lineage. Mol Cell. 2016;64:37-50 pubmed publisher
Takagi M, Natsume T, Kanemaki M, Imamoto N. Perichromosomal protein Ki67 supports mitotic chromosome architecture. Genes Cells. 2016;21:1113-1124 pubmed publisher
Petersen B, Frenzel A, Lucas Hahn A, Herrmann D, Hassel P, Klein S, et al. Efficient production of biallelic GGTA1 knockout pigs by cytoplasmic microinjection of CRISPR/Cas9 into zygotes. Xenotransplantation. 2016;23:338-46 pubmed publisher
Bialk P, Sansbury B, Rivera Torres N, Bloh K, Man D, Kmiec E. Analyses of point mutation repair and allelic heterogeneity generated by CRISPR/Cas9 and single-stranded DNA oligonucleotides. Sci Rep. 2016;6:32681 pubmed publisher
Park A, Hong P, Won S, Thibault P, Vigant F, Oguntuyo K, et al. Sendai virus, an RNA virus with no risk of genomic integration, delivers CRISPR/Cas9 for efficient gene editing. Mol Ther Methods Clin Dev. 2016;3:16057 pubmed publisher
de Solis C, Ho A, Holehonnur R, Ploski J. The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. Front Mol Neurosci. 2016;9:70 pubmed publisher
Sano R, Nakajima T, Takahashi Y, Kubo R, Kobayashi M, Takahashi K, et al. Epithelial Expression of Human ABO Blood Group Genes Is Dependent upon a Downstream Regulatory Element Functioning through an Epithelial Cell-specific Transcription Factor, Elf5. J Biol Chem. 2016;291:22594-22606 pubmed
Liang W, Liang P, Wong C, Ng T, Huang J, Zhang J, et al. CRISPR/Cas9 Technology Targeting Fas Gene Protects Mice From Concanavalin-A Induced Fulminant Hepatic Failure. J Cell Biochem. 2017;118:530-536 pubmed publisher
Nishitsuji H, Ujino S, Yoshio S, Sugiyama M, Mizokami M, Kanto T, et al. Long noncoding RNA #32 contributes to antiviral responses by controlling interferon-stimulated gene expression. Proc Natl Acad Sci U S A. 2016;113:10388-93 pubmed publisher
Xie C, Zhang Y, Song L, Luo J, Qi W, Hu J, et al. Genome editing with CRISPR/Cas9 in postnatal mice corrects PRKAG2 cardiac syndrome. Cell Res. 2016;26:1099-1111 pubmed publisher
Pankowicz F, Barzi M, Legras X, Hubert L, Mi T, Tomolonis J, et al. Reprogramming metabolic pathways in vivo with CRISPR/Cas9 genome editing to treat hereditary tyrosinaemia. Nat Commun. 2016;7:12642 pubmed publisher
Chung W, Song M, Park J, Namkung W, Lee J, Kim H, et al. Generation of ?F508-CFTR T84 cell lines by CRISPR/Cas9-mediated genome editing. Biotechnol Lett. 2016;38:2023-2034 pubmed
Zhang T, Kwiatkowski N, Olson C, Dixon Clarke S, Abraham B, Greifenberg A, et al. Covalent targeting of remote cysteine residues to develop CDK12 and CDK13 inhibitors. Nat Chem Biol. 2016;12:876-84 pubmed publisher
Cuella Martin R, Oliveira C, Lockstone H, Snellenberg S, Grolmusova N, Chapman J. 53BP1 Integrates DNA Repair and p53-Dependent Cell Fate Decisions via Distinct Mechanisms. Mol Cell. 2016;64:51-64 pubmed publisher
Xia Q, Chesi A, Manduchi E, Johnston B, Lu S, Leonard M, et al. The type 2 diabetes presumed causal variant within TCF7L2 resides in an element that controls the expression of ACSL5. Diabetologia. 2016;59:2360-2368 pubmed publisher
Santos D, Kiskinis E, Eggan K, Merkle F. Comprehensive Protocols for CRISPR/Cas9-based Gene Editing in Human Pluripotent Stem Cells. Curr Protoc Stem Cell Biol. 2016;38:5B.6.1-5B.6.60 pubmed publisher
Oji A, Noda T, Fujihara Y, Miyata H, Kim Y, Muto M, et al. CRISPR/Cas9 mediated genome editing in ES cells and its application for chimeric analysis in mice. Sci Rep. 2016;6:31666 pubmed publisher
Richardson C, Ray G, Bray N, Corn J. Non-homologous DNA increases gene disruption efficiency by altering DNA repair outcomes. Nat Commun. 2016;7:12463 pubmed publisher
Schmidt J, Zaug A, Cech T. Live Cell Imaging Reveals the Dynamics of Telomerase Recruitment to Telomeres. Cell. 2016;166:1188-1197.e9 pubmed publisher
Benakanakere M, Finoti L, Tanaka U, Grant G, Scarel Caminaga R, Kinane D. Investigation of the functional role of human Interleukin-8 gene haplotypes by CRISPR/Cas9 mediated genome editing. Sci Rep. 2016;6:31180 pubmed publisher
Shy B, MacDougall M, Clarke R, Merrill B. Co-incident insertion enables high efficiency genome engineering in mouse embryonic stem cells. Nucleic Acids Res. 2016;44:7997-8010 pubmed publisher
Li C, Ding L, Sun C, Wu L, Zhou D, Pawlik K, et al. Novel HDAd/EBV Reprogramming Vector and Highly Efficient Ad/CRISPR-Cas Sickle Cell Disease Gene Correction. Sci Rep. 2016;6:30422 pubmed publisher
Stolfa G, Mondal N, Zhu Y, Yu X, Buffone A, Neelamegham S. Using CRISPR-Cas9 to quantify the contributions of O-glycans, N-glycans and Glycosphingolipids to human leukocyte-endothelium adhesion. Sci Rep. 2016;6:30392 pubmed publisher
Drost R, Dhillon K, van der Gulden H, van der Heijden I, Brandsma I, Cruz C, et al. BRCA1185delAG tumors may acquire therapy resistance through expression of RING-less BRCA1. J Clin Invest. 2016;126:2903-18 pubmed publisher
Lee V, Halabi C, Hoffman E, Carmichael N, Leshchiner I, Lian C, et al. Loss of function mutation in LOX causes thoracic aortic aneurysm and dissection in humans. Proc Natl Acad Sci U S A. 2016;113:8759-64 pubmed publisher
Nguyen D, Miyaoka Y, Gilbert L, Mayerl S, Lee B, Weissman J, et al. Ligand-binding domains of nuclear receptors facilitate tight control of split CRISPR activity. Nat Commun. 2016;7:12009 pubmed publisher
Tahara S, Nojima S, Ohshima K, Hori Y, Kurashige M, Wada N, et al. S100A4 accelerates the proliferation and invasion of endometrioid carcinoma and is associated with the "MELF" pattern. Cancer Sci. 2016;107:1345-52 pubmed publisher
Benamar M, Guessous F, Du K, Corbett P, Obeid J, Gioeli D, et al. Inactivation of the CRL4-CDT2-SET8/p21 ubiquitylation and degradation axis underlies the therapeutic efficacy of pevonedistat in melanoma. EBioMedicine. 2016;10:85-100 pubmed publisher
Zhang J, Huang K, O Neill K, Pang X, Luo X. Bax/Bak activation in the absence of Bid, Bim, Puma, and p53. Cell Death Dis. 2016;7:e2266 pubmed publisher
Akabane S, Matsuzaki K, Yamashita S, Arai K, Okatsu K, Kanki T, et al. Constitutive Activation of PINK1 Protein Leads to Proteasome-mediated and Non-apoptotic Cell Death Independently of Mitochondrial Autophagy. J Biol Chem. 2016;291:16162-74 pubmed publisher
Lee J, Takahama S, Zhang G, Tomarev S, Ye Y. Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Nat Cell Biol. 2016;18:765-76 pubmed publisher
Nakagawa Y, Oikawa F, Mizuno S, Ohno H, Yagishita Y, Satoh A, et al. Hyperlipidemia and hepatitis in liver-specific CREB3L3 knockout mice generated using a one-step CRISPR/Cas9 system. Sci Rep. 2016;6:27857 pubmed publisher
Marusugi K, Nakano K, Sasaki H, Kimura J, Yanobu Takanashi R, Okamura T, et al. Functional validation of tensin2 SH2-PTB domain by CRISPR/Cas9-mediated genome editing. J Vet Med Sci. 2016;78:1413-1420 pubmed
Lemoine A, Chauveau Le Friec G, Langa F, Louvet C. Generation of a Double KO Mouse by Simultaneous Targeting of the Neighboring Genes Tmem176a and Tmem176b Using CRISPR/Cas9: Key Steps from Design to Genotyping. J Genet Genomics. 2016;43:329-40 pubmed publisher
Okuda H, Noguchi A, Kobayashi H, Kondo D, Harada K, Youssefian S, et al. Infantile Pain Episodes Associated with Novel Nav1.9 Mutations in Familial Episodic Pain Syndrome in Japanese Families. PLoS ONE. 2016;11:e0154827 pubmed publisher
Shigeta M, Sakane Y, Iida M, Suzuki M, Kashiwagi K, Kashiwagi A, et al. Rapid and efficient analysis of gene function using CRISPR-Cas9 in Xenopus tropicalis founders. Genes Cells. 2016;21:755-71 pubmed publisher
Nakano S, Suzuki T, Kawarada L, Iwata H, Asano K, Suzuki T. NSUN3 methylase initiates 5-formylcytidine biogenesis in human mitochondrial tRNA(Met). Nat Chem Biol. 2016;12:546-51 pubmed publisher
Bai M, Liang D, Wang Y, Li Q, Wu Y, Li J. Spermatogenic Cell-Specific Gene Mutation in Mice via CRISPR-Cas9. J Genet Genomics. 2016;43:289-96 pubmed publisher
Zhang S, Pondarre C, Pennarun G, Labussière Wallet H, Vera G, France B, et al. A nonsense mutation in the DNA repair factor Hebo causes mild bone marrow failure and microcephaly. J Exp Med. 2016;213:1011-28 pubmed publisher
Chiapparo G, Lin X, Lescroart F, Chabab S, Paulissen C, Pitisci L, et al. Mesp1 controls the speed, polarity, and directionality of cardiovascular progenitor migration. J Cell Biol. 2016;213:463-77 pubmed publisher
Mikuni T, Nishiyama J, Sun Y, Kamasawa N, Yasuda R. High-Throughput, High-Resolution Mapping of Protein Localization in Mammalian Brain by In Vivo Genome Editing. Cell. 2016;165:1803-1817 pubmed publisher
Ramachandran S, Haddad D, Li C, Le M, Ling A, So C, et al. The SAGA Deubiquitination Module Promotes DNA Repair and Class Switch Recombination through ATM and DNAPK-Mediated ?H2AX Formation. Cell Rep. 2016;15:1554-1565 pubmed publisher
Labrie V, Buske O, Oh E, Jeremian R, Ptak C, Gasiunas G, et al. Lactase nonpersistence is directed by DNA-variation-dependent epigenetic aging. Nat Struct Mol Biol. 2016;23:566-73 pubmed publisher
Yamamoto S, Fukuhara T, Ono C, Uemura K, Kawachi Y, Shiokawa M, et al. Lipoprotein Receptors Redundantly Participate in Entry of Hepatitis C Virus. PLoS Pathog. 2016;12:e1005610 pubmed publisher
Aizawa S, Okamoto T, Sugiyama Y, Kouwaki T, Ito A, Suzuki T, et al. TRC8-dependent degradation of hepatitis C virus immature core protein regulates viral propagation and pathogenesis. Nat Commun. 2016;7:11379 pubmed publisher
Ambrosio A, Boyle J, Aradi A, Christian K, Di Pietro S. TPC2 controls pigmentation by regulating melanosome pH and size. Proc Natl Acad Sci U S A. 2016;113:5622-7 pubmed publisher
Kaczmarczyk L, Mende Y, Zevnik B, Jackson W. Manipulating the Prion Protein Gene Sequence and Expression Levels with CRISPR/Cas9. PLoS ONE. 2016;11:e0154604 pubmed publisher
Miano J, Zhu Q, Lowenstein C. A CRISPR Path to Engineering New Genetic Mouse Models for Cardiovascular Research. Arterioscler Thromb Vasc Biol. 2016;36:1058-75 pubmed publisher
Chen Q, Zheng P, Yang W. EZH2-mediated repression of GSK-3? and TP53 promotes Wnt/?-catenin signaling-dependent cell expansion in cervical carcinoma. Oncotarget. 2016;7:36115-36129 pubmed publisher
Randhawa S, Cho B, Ghosh D, Sivina M, Koehrer S, Müschen M, et al. Effects of pharmacological and genetic disruption of CXCR4 chemokine receptor function in B-cell acute lymphoblastic leukaemia. Br J Haematol. 2016;174:425-36 pubmed publisher
Meininger I, Griesbach R, Hu D, Gehring T, Seeholzer T, Bertossi A, et al. Alternative splicing of MALT1 controls signalling and activation of CD4(+) T cells. Nat Commun. 2016;7:11292 pubmed publisher
Ruiz S, Mayor Ruiz C, Lafarga V, Murga M, Vega Sendino M, Ortega S, et al. A Genome-wide CRISPR Screen Identifies CDC25A as a Determinant of Sensitivity to ATR Inhibitors. Mol Cell. 2016;62:307-313 pubmed publisher
O Neill K, Huang K, Zhang J, Chen Y, Luo X. Inactivation of prosurvival Bcl-2 proteins activates Bax/Bak through the outer mitochondrial membrane. Genes Dev. 2016;30:973-88 pubmed publisher
Zhang Y, Chen Y, Gucek M, Xu H. The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication. EMBO J. 2016;35:1045-57 pubmed publisher
Choi J, Dang Y, Abraham S, Ma H, Zhang J, Guo H, et al. Lentivirus pre-packed with Cas9 protein for safer gene editing. Gene Ther. 2016;23:627-33 pubmed publisher
Natsume T, Kiyomitsu T, Saga Y, Kanemaki M. Rapid Protein Depletion in Human Cells by Auxin-Inducible Degron Tagging with Short Homology Donors. Cell Rep. 2016;15:210-218 pubmed publisher
Paralkar V, Taborda C, Huang P, Yao Y, Kossenkov A, Prasad R, et al. Unlinking an lncRNA from Its Associated cis Element. Mol Cell. 2016;62:104-10 pubmed publisher
Estep J, Sternburg E, Sanchez G, Karginov F. Immunoblot screening of CRISPR/Cas9-mediated gene knockouts without selection. BMC Mol Biol. 2016;17:9 pubmed publisher
Francis K, Ton A, Xin Y, O Halloran P, Wassif C, Malik N, et al. Modeling Smith-Lemli-Opitz syndrome with induced pluripotent stem cells reveals a causal role for Wnt/β-catenin defects in neuronal cholesterol synthesis phenotypes. Nat Med. 2016;22:388-96 pubmed publisher
Balligand T, Achouri Y, Pecquet C, Chachoua I, Nivarthi H, Marty C, et al. Pathologic activation of thrombopoietin receptor and JAK2-STAT5 pathway by frameshift mutants of mouse calreticulin. Leukemia. 2016;30:1775-8 pubmed publisher
Nagata K, Kiryu Seo S, Tamada H, Okuyama Uchimura F, Kiyama H, Saido T. ECEL1 mutation implicates impaired axonal arborization of motor nerves in the pathogenesis of distal arthrogryposis. Acta Neuropathol. 2016;132:111-26 pubmed publisher
Tal P, Eizenberger S, Cohen E, Goldfinger N, Pietrokovski S, Oren M, et al. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides. Oncotarget. 2016;7:11817-37 pubmed publisher
Qin W, Kutny P, Maser R, Dion S, Lamont J, Zhang Y, et al. Generating Mouse Models Using CRISPR-Cas9-Mediated Genome Editing. Curr Protoc Mouse Biol. 2016;6:39-66 pubmed publisher
Shin M, He Y, Marrogi E, Piperdi S, Ren L, Khanna C, et al. A RUNX2-Mediated Epigenetic Regulation of the Survival of p53 Defective Cancer Cells. PLoS Genet. 2016;12:e1005884 pubmed publisher
Maresch R, Mueller S, Veltkamp C, Ollinger R, Friedrich M, Heid I, et al. Multiplexed pancreatic genome engineering and cancer induction by transfection-based CRISPR/Cas9 delivery in mice. Nat Commun. 2016;7:10770 pubmed publisher
Turan S, Farruggio A, Srifa W, Day J, Calos M. Precise Correction of Disease Mutations in Induced Pluripotent Stem Cells Derived From Patients With Limb Girdle Muscular Dystrophy. Mol Ther. 2016;24:685-96 pubmed publisher
Kanda T, Furuse Y, Oshitani H, Kiyono T. Highly Efficient CRISPR/Cas9-Mediated Cloning and Functional Characterization of Gastric Cancer-Derived Epstein-Barr Virus Strains. J Virol. 2016;90:4383-93 pubmed publisher
Schwer B, Wei P, Chang A, Kao J, Du Z, Meyers R, et al. Transcription-associated processes cause DNA double-strand breaks and translocations in neural stem/progenitor cells. Proc Natl Acad Sci U S A. 2016;113:2258-63 pubmed publisher
Mondal N, Stolfa G, Antonopoulos A, Zhu Y, Wang S, Buffone A, et al. Glycosphingolipids on Human Myeloid Cells Stabilize E-Selectin-Dependent Rolling in the Multistep Leukocyte Adhesion Cascade. Arterioscler Thromb Vasc Biol. 2016;36:718-27 pubmed publisher
Millrine D, Miyata H, Tei M, Dubey P, Nyati K, Nakahama T, et al. Immunomodulatory drugs inhibit TLR4-induced type-1 interferon production independently of Cereblon via suppression of the TRIF/IRF3 pathway. Int Immunol. 2016;28:307-15 pubmed publisher
Millay D, Gamage D, Quinn M, Min Y, Mitani Y, Bassel Duby R, et al. Structure-function analysis of myomaker domains required for myoblast fusion. Proc Natl Acad Sci U S A. 2016;113:2116-21 pubmed publisher
Shinmyo Y, Tanaka S, Tsunoda S, Hosomichi K, Tajima A, Kawasaki H. CRISPR/Cas9-mediated gene knockout in the mouse brain using in utero electroporation. Sci Rep. 2016;6:20611 pubmed publisher
Lee N, Shin J, Park J, Lee G, Cho S, Cho B. Targeted Gene Deletion Using DNA-Free RNA-Guided Cas9 Nuclease Accelerates Adaptation of CHO Cells to Suspension Culture. ACS Synth Biol. 2016;5:1211-1219 pubmed
Romanienko P, Giacalone J, Ingenito J, Wang Y, Isaka M, Johnson T, et al. A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs. PLoS ONE. 2016;11:e0148362 pubmed publisher
Zhao J, Akinsanmi I, Arafat D, Cradick T, Lee C, Banskota S, et al. A Burden of Rare Variants Associated with Extremes of Gene Expression in Human Peripheral Blood. Am J Hum Genet. 2016;98:299-309 pubmed publisher
Sheridan R, Bentley D. Selectable one-step PCR-mediated integration of a degron for rapid depletion of endogenous human proteins. Biotechniques. 2016;60:69-74 pubmed publisher
Nakajo A, Yoshimura S, Togawa H, Kunii M, Iwano T, Izumi A, et al. EHBP1L1 coordinates Rab8 and Bin1 to regulate apical-directed transport in polarized epithelial cells. J Cell Biol. 2016;212:297-306 pubmed publisher
Diao Y, Li B, Meng Z, Jung I, Lee A, Dixon J, et al. A new class of temporarily phenotypic enhancers identified by CRISPR/Cas9-mediated genetic screening. Genome Res. 2016;26:397-405 pubmed publisher
Liu X, Homma A, Sayadi J, Yang S, Ohashi J, Takumi T. Sequence features associated with the cleavage efficiency of CRISPR/Cas9 system. Sci Rep. 2016;6:19675 pubmed publisher
Lu G, Duan J, Shu S, Wang X, Gao L, Guo J, et al. Ligase I and ligase III mediate the DNA double-strand break ligation in alternative end-joining. Proc Natl Acad Sci U S A. 2016;113:1256-60 pubmed publisher
Lee C, Cradick T, Bao G. The Neisseria meningitidis CRISPR-Cas9 System Enables Specific Genome Editing in Mammalian Cells. Mol Ther. 2016;24:645-54 pubmed publisher
He Z, Shi X, Liu M, Sun G, Proudfoot C, Whitelaw C, et al. Comparison of surrogate reporter systems for enrichment of cells with mutations induced by genome editors. J Biotechnol. 2016;221:49-54 pubmed publisher
Chu V, Weber T, Graf R, Sommermann T, Petsch K, Sack U, et al. Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes. BMC Biotechnol. 2016;16:4 pubmed publisher
Geisinger J, Turan S, Hernandez S, Spector L, Calos M. In vivo blunt-end cloning through CRISPR/Cas9-facilitated non-homologous end-joining. Nucleic Acids Res. 2016;44:e76 pubmed publisher
Tie J, Carneiro J, Jin D, Martinhago C, Vermeer C, Stafford D. Characterization of vitamin K-dependent carboxylase mutations that cause bleeding and nonbleeding disorders. Blood. 2016;127:1847-55 pubmed publisher
Kime C, Mandegar M, Srivastava D, Yamanaka S, Conklin B, Rand T. Efficient CRISPR/Cas9-Based Genome Engineering in Human Pluripotent Stem Cells. Curr Protoc Hum Genet. 2016;88:Unit 21.4 pubmed publisher
Carroll K, Makarewich C, McAnally J, Anderson D, Zentilin L, Liu N, et al. A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9. Proc Natl Acad Sci U S A. 2016;113:338-43 pubmed publisher
Linares A, Lin C, Damianov A, Adams K, Novitch B, Black D. The splicing regulator PTBP1 controls the activity of the transcription factor Pbx1 during neuronal differentiation. elife. 2015;4:e09268 pubmed publisher
Ujino S, Nishitsuji H, Hishiki T, Sugiyama K, Takaku H, Shimotohno K. Hepatitis C virus utilizes VLDLR as a novel entry pathway. Proc Natl Acad Sci U S A. 2016;113:188-93 pubmed publisher
Sladitschek H, Neveu P. The bimodally expressed microRNA miR-142 gates exit from pluripotency. Mol Syst Biol. 2015;11:850 pubmed publisher
Sakuma T, Nakade S, Sakane Y, Suzuki K, Yamamoto T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc. 2016;11:118-33 pubmed publisher
Schrage R, Schmitz A, Gaffal E, Annala S, Kehraus S, Wenzel D, et al. The experimental power of FR900359 to study Gq-regulated biological processes. Nat Commun. 2015;6:10156 pubmed publisher
Wang L, Shao Y, Guan Y, Li L, Wu L, Chen F, et al. Large genomic fragment deletion and functional gene cassette knock-in via Cas9 protein mediated genome editing in one-cell rodent embryos. Sci Rep. 2015;5:17517 pubmed publisher
Li M, Huang R, Jiang X, Chen Y, Zhang Z, Zhang X, et al. CRISPR/Cas9 Promotes Functional Study of Testis Specific X-Linked Gene In Vivo. PLoS ONE. 2015;10:e0143148 pubmed publisher
Ramírez Carvajal L, Singh N, de Los Santos T, Rodríguez L, Long C. Depletion of elongation initiation factor 4E binding proteins by CRISPR/Cas9 enhances the antiviral response in porcine cells. Antiviral Res. 2016;125:8-13 pubmed publisher
Spencer N, Yan Z, Cong L, Zhang Y, Engelhardt J, Stanton R. Definitive localization of intracellular proteins: Novel approach using CRISPR-Cas9 genome editing, with glucose 6-phosphate dehydrogenase as a model. Anal Biochem. 2016;494:55-67 pubmed publisher
Kasai H, Kawakami K, Yokoe H, Yoshimura K, Matsuda M, Yasumoto J, et al. Involvement of FKBP6 in hepatitis C virus replication. Sci Rep. 2015;5:16699 pubmed publisher
Gowen B, Chim B, Marceau C, Greene T, Burr P, Gonzalez J, et al. A forward genetic screen reveals novel independent regulators of ULBP1, an activating ligand for natural killer cells. elife. 2015;4: pubmed publisher
Wang K, Ouyang H, Xie Z, Yao C, Guo N, Li M, et al. Efficient Generation of Myostatin Mutations in Pigs Using the CRISPR/Cas9 System. Sci Rep. 2015;5:16623 pubmed publisher
Sun S, Shi G, Sha H, Ji Y, Han X, Shu X, et al. IRE1α is an endogenous substrate of endoplasmic-reticulum-associated degradation. Nat Cell Biol. 2015;17:1546-55 pubmed publisher
Riesenberg S, Groetchen A, Siddaway R, Bald T, Reinhardt J, Smorra D, et al. MITF and c-Jun antagonism interconnects melanoma dedifferentiation with pro-inflammatory cytokine responsiveness and myeloid cell recruitment. Nat Commun. 2015;6:8755 pubmed publisher
Laflam T, Seumois G, Miller C, Lwin W, Fasano K, Waterfield M, et al. Identification of a novel cis-regulatory element essential for immune tolerance. J Exp Med. 2015;212:1993-2002 pubmed publisher
Young S, Miyata H, Satouh Y, Kato H, Nozawa K, Isotani A, et al. CRISPR/Cas9-Mediated Rapid Generation of Multiple Mouse Lines Identified Ccdc63 as Essential for Spermiogenesis. Int J Mol Sci. 2015;16:24732-50 pubmed publisher
Pinder J, Salsman J, Dellaire G. Nuclear domain 'knock-in' screen for the evaluation and identification of small molecule enhancers of CRISPR-based genome editing. Nucleic Acids Res. 2015;43:9379-92 pubmed publisher
Zhang T, Xu Y, Liu Y, Ye Y. gp78 functions downstream of Hrd1 to promote degradation of misfolded proteins of the endoplasmic reticulum. Mol Biol Cell. 2015;26:4438-50 pubmed publisher
Voets E, Marsman J, Demmers J, Beijersbergen R, Wolthuis R. The lethal response to Cdk1 inhibition depends on sister chromatid alignment errors generated by KIF4 and isoform 1 of PRC1. Sci Rep. 2015;5:14798 pubmed publisher
Canver M, SMITH E, Sher F, Pinello L, Sanjana N, Shalem O, et al. BCL11A enhancer dissection by Cas9-mediated in situ saturating mutagenesis. Nature. 2015;527:192-7 pubmed publisher
Koch A, Maia A, Janssen A, Medema R. Molecular basis underlying resistance to Mps1/TTK inhibitors. Oncogene. 2016;35:2518-28 pubmed publisher
Mizuno S, Takami K, Daitoku Y, Tanimoto Y, Dinh T, Mizuno Iijima S, et al. Peri-implantation lethality in mice carrying megabase-scale deletion on 5qc3.3 is caused by Exoc1 null mutation. Sci Rep. 2015;5:13632 pubmed publisher
Nishitsuji H, Ujino S, Shimizu Y, Harada K, Zhang J, Sugiyama M, et al. Novel reporter system to monitor early stages of the hepatitis B virus life cycle. Cancer Sci. 2015;106:1616-24 pubmed publisher
Dong J, Panchakshari R, Zhang T, Zhang Y, Hu J, Volpi S, et al. Orientation-specific joining of AID-initiated DNA breaks promotes antibody class switching. Nature. 2015;525:134-139 pubmed publisher
Crispo M, Mulet A, Tesson L, Barrera N, Cuadro F, Dos Santos Neto P, et al. Efficient Generation of Myostatin Knock-Out Sheep Using CRISPR/Cas9 Technology and Microinjection into Zygotes. PLoS ONE. 2015;10:e0136690 pubmed publisher
Wang X, Zhou J, Cao C, Huang J, Hai T, Wang Y, et al. Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Sci Rep. 2015;5:13348 pubmed publisher
Ono R, Ishii M, Fujihara Y, Kitazawa M, Usami T, Kaneko ishino T, et al. Double strand break repair by capture of retrotransposon sequences and reverse-transcribed spliced mRNA sequences in mouse zygotes. Sci Rep. 2015;5:12281 pubmed publisher
Ma H, Dang Y, Wu Y, Jia G, Anaya E, Zhang J, et al. A CRISPR-Based Screen Identifies Genes Essential for West-Nile-Virus-Induced Cell Death. Cell Rep. 2015;12:673-83 pubmed publisher
Monfort A, Di Minin G, Postlmayr A, Freimann R, Arieti F, Thore S, et al. Identification of Spen as a Crucial Factor for Xist Function through Forward Genetic Screening in Haploid Embryonic Stem Cells. Cell Rep. 2015;12:554-61 pubmed publisher
Shi Y, Yuan B, Qi N, Zhu W, Su J, Li X, et al. An autoinhibitory mechanism modulates MAVS activity in antiviral innate immune response. Nat Commun. 2015;6:7811 pubmed publisher
Flynn R, Grundmann A, Renz P, Hänseler W, James W, Cowley S, et al. CRISPR-mediated genotypic and phenotypic correction of a chronic granulomatous disease mutation in human iPS cells. Exp Hematol. 2015;43:838-848.e3 pubmed publisher
D Osualdo A, Anania V, Yu K, Lill J, Kaufman R, Matsuzawa S, et al. Transcription Factor ATF4 Induces NLRP1 Inflammasome Expression during Endoplasmic Reticulum Stress. PLoS ONE. 2015;10:e0130635 pubmed publisher
Bialk P, Rivera Torres N, Strouse B, Kmiec E. Regulation of Gene Editing Activity Directed by Single-Stranded Oligonucleotides and CRISPR/Cas9 Systems. PLoS ONE. 2015;10:e0129308 pubmed publisher
Kimura Y, Oda M, Nakatani T, Sekita Y, Monfort A, Wutz A, et al. CRISPR/Cas9-mediated reporter knock-in in mouse haploid embryonic stem cells. Sci Rep. 2015;5:10710 pubmed publisher
Li X, Xiao J, Fröhlich H, Tu X, Li L, Xu Y, et al. Foxp1 regulates cortical radial migration and neuronal morphogenesis in developing cerebral cortex. PLoS ONE. 2015;10:e0127671 pubmed publisher
Young S, Aitken R, Ikawa M. Advantages of using the CRISPR/Cas9 system of genome editing to investigate male reproductive mechanisms using mouse models. Asian J Androl. 2015;17:623-7 pubmed publisher
Fachinetti D, Han J, McMahon M, Ly P, Abdullah A, Wong A, et al. DNA Sequence-Specific Binding of CENP-B Enhances the Fidelity of Human Centromere Function. Dev Cell. 2015;33:314-27 pubmed publisher
Merkle F, Neuhausser W, Santos D, Valen E, Gagnon J, Maas K, et al. Efficient CRISPR-Cas9-mediated generation of knockin human pluripotent stem cells lacking undesired mutations at the targeted locus. Cell Rep. 2015;11:875-883 pubmed publisher
Aida T, Chiyo K, Usami T, Ishikubo H, Imahashi R, Wada Y, et al. Cloning-free CRISPR/Cas system facilitates functional cassette knock-in in mice. Genome Biol. 2015;16:87 pubmed publisher
Luo Y, Zhu D, Zhang Z, Chen Y, Sun X. Integrative Analysis of CRISPR/Cas9 Target Sites in the Human HBB Gene. Biomed Res Int. 2015;2015:514709 pubmed publisher
Liang P, Xu Y, Zhang X, Ding C, Huang R, Zhang Z, et al. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 2015;6:363-372 pubmed publisher
Zhang L, Jia R, Palange N, Satheka A, Togo J, An Y, et al. Large genomic fragment deletions and insertions in mouse using CRISPR/Cas9. PLoS ONE. 2015;10:e0120396 pubmed publisher
Hnisz D, Schuijers J, Lin C, Weintraub A, Abraham B, Lee T, et al. Convergence of developmental and oncogenic signaling pathways at transcriptional super-enhancers. Mol Cell. 2015;58:362-70 pubmed publisher
Maruyama T, Dougan S, Truttmann M, Bilate A, Ingram J, Ploegh H. Increasing the efficiency of precise genome editing with CRISPR-Cas9 by inhibition of nonhomologous end joining. Nat Biotechnol. 2015;33:538-42 pubmed publisher
Zhang S, Sodroski J. Efficient human immunodeficiency virus (HIV-1) infection of cells lacking PDZD8. Virology. 2015;481:73-8 pubmed publisher
Hisano Y, Sakuma T, Nakade S, Ohga R, Ota S, Okamoto H, et al. Precise in-frame integration of exogenous DNA mediated by CRISPR/Cas9 system in zebrafish. Sci Rep. 2015;5:8841 pubmed publisher
Lee N, Larionov V, Kouprina N. Highly efficient CRISPR/Cas9-mediated TAR cloning of genes and chromosomal loci from complex genomes in yeast. Nucleic Acids Res. 2015;43:e55 pubmed publisher
Lagutina I, Valentine V, Picchione F, Harwood F, Valentine M, Villarejo Balcells B, et al. Modeling of the human alveolar rhabdomyosarcoma Pax3-Foxo1 chromosome translocation in mouse myoblasts using CRISPR-Cas9 nuclease. PLoS Genet. 2015;11:e1004951 pubmed publisher
Howard S, Yanez D, Stark J. DNA damage response factors from diverse pathways, including DNA crosslink repair, mediate alternative end joining. PLoS Genet. 2015;11:e1004943 pubmed publisher
Navarro J, Touzart A, Pradel L, Loosveld M, Koubi M, Fenouil R, et al. Site- and allele-specific polycomb dysregulation in T-cell leukaemia. Nat Commun. 2015;6:6094 pubmed publisher
Parikh B, Beckman D, Patel S, White J, Yokoyama W. Detailed phenotypic and molecular analyses of genetically modified mice generated by CRISPR-Cas9-mediated editing. PLoS ONE. 2015;10:e0116484 pubmed publisher
Frock R, Hu J, Meyers R, Ho Y, Kii E, Alt F. Genome-wide detection of DNA double-stranded breaks induced by engineered nucleases. Nat Biotechnol. 2015;33:179-86 pubmed publisher
Fukuhara T, Wada M, Nakamura S, Ono C, Shiokawa M, Yamamoto S, et al. Amphipathic α-helices in apolipoproteins are crucial to the formation of infectious hepatitis C virus particles. PLoS Pathog. 2014;10:e1004534 pubmed publisher
Mondal N, Buffone A, Stolfa G, Antonopoulos A, Lau J, Haslam S, et al. ST3Gal-4 is the primary sialyltransferase regulating the synthesis of E-, P-, and L-selectin ligands on human myeloid leukocytes. Blood. 2015;125:687-96 pubmed publisher
Nakade S, Tsubota T, Sakane Y, Kume S, Sakamoto N, Obara M, et al. Microhomology-mediated end-joining-dependent integration of donor DNA in cells and animals using TALENs and CRISPR/Cas9. Nat Commun. 2014;5:5560 pubmed publisher
Maddalo D, Manchado E, Concepcion C, Bonetti C, Vidigal J, Han Y, et al. In vivo engineering of oncogenic chromosomal rearrangements with the CRISPR/Cas9 system. Nature. 2014;516:423-7 pubmed publisher
Brinkman E, Chen T, Amendola M, van Steensel B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 2014;42:e168 pubmed publisher
Fan Z, Li W, Lee S, Meng Q, Shi B, Bunch T, et al. Efficient gene targeting in golden Syrian hamsters by the CRISPR/Cas9 system. PLoS ONE. 2014;9:e109755 pubmed publisher
Harms D, Quadros R, Seruggia D, Ohtsuka M, Takahashi G, Montoliu L, et al. Mouse Genome Editing Using the CRISPR/Cas System. Curr Protoc Hum Genet. 2014;83:15.7.1-27 pubmed publisher
Yang M, Zhang L, Stevens J, Gibson G. CRISPR/Cas9 mediated generation of stable chondrocyte cell lines with targeted gene knockouts; analysis of an aggrecan knockout cell line. Bone. 2014;69:118-25 pubmed publisher
Honda A, Hirose M, Sankai T, Yasmin L, Yuzawa K, Honsho K, et al. Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR/Cas9. Exp Anim. 2015;64:31-7 pubmed publisher
Zhang J, Pandey M, Kahler J, Loshakov A, Harris B, Dagur P, et al. Improving the specificity and efficacy of CRISPR/CAS9 and gRNA through target specific DNA reporter. J Biotechnol. 2014;189:1-8 pubmed publisher
Wang Z, Luo Y, Shao Q, Kinlock B, Wang C, Hildreth J, et al. Heat-stable molecule derived from Streptococcus cristatus induces APOBEC3 expression and inhibits HIV-1 replication. PLoS ONE. 2014;9:e106078 pubmed publisher
Findlay G, Boyle E, Hause R, Klein J, Shendure J. Saturation editing of genomic regions by multiplex homology-directed repair. Nature. 2014;513:120-3 pubmed publisher
Straub C, Granger A, Saulnier J, Sabatini B. CRISPR/Cas9-mediated gene knock-down in post-mitotic neurons. PLoS ONE. 2014;9:e105584 pubmed publisher
Bassett A, Azzam G, Wheatley L, Tibbit C, Rajakumar T, McGowan S, et al. Understanding functional miRNA-target interactions in vivo by site-specific genome engineering. Nat Commun. 2014;5:4640 pubmed publisher
Racz R, Li X, Patel M, Xiang Z, He Y. DNAVaxDB: the first web-based DNA vaccine database and its data analysis. BMC Bioinformatics. 2014;15 Suppl 4:S2 pubmed publisher
Yang H, Wang H, Jaenisch R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 2014;9:1956-68 pubmed publisher
Zhang C, Xiao B, Jiang Y, Zhao Y, Li Z, Gao H, et al. Efficient editing of malaria parasite genome using the CRISPR/Cas9 system. MBio. 2014;5:e01414-14 pubmed publisher
Sakuma T, Nishikawa A, Kume S, Chayama K, Yamamoto T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 2014;4:5400 pubmed publisher
Gonzalez F, Zhu Z, Shi Z, Lelli K, Verma N, Li Q, et al. An iCRISPR platform for rapid, multiplexable, and inducible genome editing in human pluripotent stem cells. Cell Stem Cell. 2014;15:215-226 pubmed publisher
Canver M, Bauer D, Dass A, Yien Y, Chung J, Masuda T, et al. Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells. J Biol Chem. 2014;289:21312-24 pubmed publisher
Ghorbal M, Gorman M, MacPherson C, Martins R, Scherf A, Lopez Rubio J. Genome editing in the human malaria parasite Plasmodium falciparum using the CRISPR-Cas9 system. Nat Biotechnol. 2014;32:819-21 pubmed publisher
He T, Tsai L, Huang C, Chou M, Lee H. LKB1 loss at transcriptional level promotes tumor malignancy and poor patient outcomes in colorectal cancer. Ann Surg Oncol. 2014;21 Suppl 4:S703-10 pubmed publisher
Mizuno S, Dinh T, Kato K, Mizuno Iijima S, Tanimoto Y, Daitoku Y, et al. Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 system. Mamm Genome. 2014;25:327-34 pubmed publisher
Munoz M, Yanez D, Stark J. An RNF168 fragment defective for focal accumulation at DNA damage is proficient for inhibition of homologous recombination in BRCA1 deficient cells. Nucleic Acids Res. 2014;42:7720-33 pubmed publisher
Choi P, Meyerson M. Targeted genomic rearrangements using CRISPR/Cas technology. Nat Commun. 2014;5:3728 pubmed publisher
Wu X, Scott D, Kriz A, Chiu A, Hsu P, Dadon D, et al. Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat Biotechnol. 2014;32:670-6 pubmed publisher
Park A, Won S, Pentecost M, Bartkowski W, Lee B. CRISPR/Cas9 allows efficient and complete knock-in of a destabilization domain-tagged essential protein in a human cell line, allowing rapid knockdown of protein function. PLoS ONE. 2014;9:e95101 pubmed publisher
Ansai S, Kinoshita M. Targeted mutagenesis using CRISPR/Cas system in medaka. Biol Open. 2014;3:362-71 pubmed publisher
Jia H, Wang N. Targeted genome editing of sweet orange using Cas9/sgRNA. PLoS ONE. 2014;9:e93806 pubmed publisher
Hendel A, Kildebeck E, Fine E, Clark J, Punjya N, Sebastiano V, et al. Quantifying genome-editing outcomes at endogenous loci with SMRT sequencing. Cell Rep. 2014;7:293-305 pubmed publisher
Pusapati G, Hughes C, Dorn K, Zhang D, Sugianto P, Aravind L, et al. EFCAB7 and IQCE regulate hedgehog signaling by tethering the EVC-EVC2 complex to the base of primary cilia. Dev Cell. 2014;28:483-96 pubmed publisher
Kranz D, Boutros M. A synthetic lethal screen identifies FAT1 as an antagonist of caspase-8 in extrinsic apoptosis. EMBO J. 2014;33:181-97 pubmed publisher
Bassett A, Tibbit C, Ponting C, Liu J. Mutagenesis and homologous recombination in Drosophila cell lines using CRISPR/Cas9. Biol Open. 2014;3:42-9 pubmed publisher
Mashiko D, Fujihara Y, Satouh Y, Miyata H, Isotani A, Ikawa M. Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA. Sci Rep. 2013;3:3355 pubmed publisher
Gennequin B, Otte D, Zimmer A. CRISPR/Cas-induced double-strand breaks boost the frequency of gene replacements for humanizing the mouse Cnr2 gene. Biochem Biophys Res Commun. 2013;441:815-9 pubmed publisher
Cradick T, Fine E, Antico C, Bao G. CRISPR/Cas9 systems targeting ?-globin and CCR5 genes have substantial off-target activity. Nucleic Acids Res. 2013;41:9584-92 pubmed publisher
Shen T, Yang W, Yi Y, Sung G, Rhee M, Poo H, et al. AP-1/IRF-3 Targeted Anti-Inflammatory Activity of Andrographolide Isolated from Andrographis paniculata. Evid Based Complement Alternat Med. 2013;2013:210736 pubmed publisher
Cong L, Ran F, Cox D, Lin S, Barretto R, Habib N, et al. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339:819-23 pubmed publisher
product information
Catalog Number :
42230
Product Name :
pX330-U6-Chimeric_BB-CBh-hSpCas9
article :
doi10.1126/science.1231143
id6225
pubmed_id23287718
bacterial resistance :
Ampicillin
cloning :
backbonepUC ori vector
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
CRISPR
growth notes :
Alternate plasmid name: pSpCas9(BB) (PX330) For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548. For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/
growth strain :
A human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.
origin :
37
pi :
alt_names
SpCas9
hSpCas9
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5AgeI
promoterCBh
sequencing_primer_3CCAATCCTCCCCCTTGCTGT
sequencing_primer_5agggatggttggttggtggg
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namehumanized S. pyogenes Cas9
shRNA_sequence
size4272
species
tags
locationN terminal on insert
tag3xFLAG
resistance markers :
898
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA