This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCE-hSK
catalog :
41814
citations: 32
Reference
Yarkova E, Grigor eva E, Medvedev S, Pavlova S, Zakian S, Malakhova A. IPSC-Derived Astrocytes Contribute to In Vitro Modeling of Parkinson's Disease Caused by the GBA1 N370S Mutation. Int J Mol Sci. 2023;25: pubmed publisher
Yoshimatsu S, Okahara J, Yoshie J, Igarashi Y, Nakajima R, Sanosaka T, et al. Generation of a tyrosine hydroxylase-2A-Cre knockin non-human primate model by homology-directed-repair-biased CRISPR genome editing. Cell Rep Methods. 2023;3:100590 pubmed publisher
Breitmeyer R, Vogel S, Heider J, Hartmann S, W xfc st R, Keller A, et al. Regulation of synaptic connectivity in schizophrenia spectrum by mutual neuron-microglia interaction. Commun Biol. 2023;6:472 pubmed publisher
Triebelhorn J, Cardon I, Kuffner K, Bader S, Jahner T, Meindl K, et al. Induced neural progenitor cells and iPS-neurons from major depressive disorder patients show altered bioenergetics and electrophysiological properties. Mol Psychiatry. 2022;: pubmed publisher
Gridina M, Nurislamov A, Minina J, Lopatkina M, Drozdov G, Vasilyev S, et al. Generation of iPS cell line (ICGi040-A) from skin fibroblasts of a patient with ring small supernumerary marker chromosome 4. Stem Cell Res. 2022;61:102740 pubmed publisher
Gridina M, Shitik E, Lemskaya N, Minina J, Grishchenko I, Dolskiy A, et al. Derivation of iPS cell line (ICGi032-A) from a patient affected with fragile X syndrome. Stem Cell Res. 2021;57:102615 pubmed publisher
de Souza A, Bressan F, Pieri N, Botigelli R, Revay T, Haddad S, et al. Generation of Primordial Germ Cell-like Cells from iPSCs Derived from Turner Syndrome Patients. Cells. 2021;10: pubmed publisher
Yoshimatsu S, Edamura K, Yoshii Y, Iguchi A, Kondo H, Shibuya H, et al. Non-viral derivation of a transgene-free induced pluripotent stem cell line from a male beagle dog. Stem Cell Res. 2021;53:102375 pubmed publisher
Dementyeva E, Pavlova S, Chernyavsky A, Zakian S. Generation of an induced pluripotent stem cell line, ICGi029-A, by reprogramming peripheral blood mononuclear cells of a patient suffering from hypertrophic cardiomyopathy and carrying a heterozygous p.N515del mutation in MYBPC3. Stem Cell Res. 2021;53:102344 pubmed publisher
Dementyeva E, Vyatkin Y, Chernyavsky A, Zakian S. Generation of an induced pluripotent stem cell line, ICGi028-A, by reprogramming peripheral blood mononuclear cells of a patient suffering from hypertrophic cardiomyopathy and carrying a heterozygous p.E510Q mutation in HADHA. Stem Cell Res. 2021;53:102348 pubmed publisher
Podgurskaya A, Slotvitsky M, Tsvelaya V, Frolova S, Romanova S, Balashov V, et al. Cyclophosphamide arrhythmogenicitytesting using human-induced pluripotent stem cell-derived cardiomyocytes. Sci Rep. 2021;11:2336 pubmed publisher
Khabarova A, Pristyazhnyuk I, Orlova P, Nikitina T, Kashevarova A, Lopatkina M, et al. Generation of iPSC line ICGi024-A from human skin fibroblasts of a patient with ring chromosome 18. Stem Cell Res. 2020;49:102076 pubmed publisher
Gridina M, Orlova P, Minina J, Shitik E, Lemskaya N, Grishchenko I, et al. Establishment of an induced pluripotent stem cell line (ICGi026-A) from peripheral blood mononuclear cells of a patient with fragile X syndrome. Stem Cell Res. 2020;49:102070 pubmed publisher
Gridina M, Nikitina T, Orlova P, Minina J, Kashevarova A, Yakovleva Y, et al. Establishment of an induced pluripotent stem cell line (ICGi025-A) from fibroblasts of a patient with 46,XY,r(8)/45,XY,-8 mosaicism. Stem Cell Res. 2020;49:102024 pubmed publisher
Stock R, Vogel S, Mau Holzmann U, Kriebel M, Wüst R, Fallgatter A, et al. Generation and characterization of human induced pluripotent stem cells lines from four patients diagnosed with schizophrenia and one healthy control. Stem Cell Res. 2020;48:101961 pubmed publisher
Malakhova A, Grigor eva E, Pavlova S, Malankhanova T, Valetdinova K, Vyatkin Y, et al. Generation of induced pluripotent stem cell lines ICGi021-A and ICGi022-A from peripheral blood mononuclear cells of two healthy individuals from Siberian population. Stem Cell Res. 2020;48:101952 pubmed publisher
Ovechkina V, Maretina M, Egorova A, Baranov V, Kiselev A, Zakian S, et al. Generation of a spinal muscular atrophy type III patient-specific induced pluripotent stem cell line ICGi003-A. Stem Cell Res. 2020;48:101938 pubmed publisher
Valetdinova K, Maretina M, Vyatkin Y, Perepelkina M, Egorova A, Baranov V, et al. Generation of three Duchenne muscular dystrophy patient-derived induced pluripotent stem cell (iPSC) lines ICGi002-A, ICGi002-B and ICGi002-C. Stem Cell Res. 2020;48:101941 pubmed publisher
Sasaki Honda M, Kagita A, Jonouchi T, Araki T, Hotta A, Sakurai H. Generation of a transgene-free iPSC line and genetically modified line from a facioscapulohumeral muscular dystrophy type 2 (FSHD2) patient with SMCHD1 p.Lys607Ter mutation. Stem Cell Res. 2020;47:101884 pubmed publisher
Malakhova A, Grigor eva E, Malankhanova T, Pavlova S, Valetdinova K, Abramycheva N, et al. Generation of induced pluripotent stem cell line ICGi018-A from peripheral blood mononuclear cells of a patient with Huntington's disease. Stem Cell Res. 2020;44:101743 pubmed publisher
Nachtigal A, Milenkovic A, Brandl C, Schulz H, Duerr L, Lang G, et al. Mutation-Dependent Pathomechanisms Determine the Phenotype in the Bestrophinopathies. Int J Mol Sci. 2020;21: pubmed publisher
Kumar S, Curran J, Espinosa E, Glahn D, Blangero J. Highly efficient induced pluripotent stem cell reprogramming of cryopreserved lymphoblastoid cell lines. J Biol Methods. 2020;7:e124 pubmed publisher
Lee B, Rengaraj D, Choi H, Han J. A novel F-box domain containing cyclin F like gene is required for maintaining the genome stability and survival of chicken primordial germ cells. FASEB J. 2020;34:1001-1017 pubmed publisher
Dementyeva E, Medvedev S, Kovalenko V, Vyatkin Y, Kretov E, Slotvitsky M, et al. Applying Patient-Specific Induced Pluripotent Stem Cells to Create a Model of Hypertrophic Cardiomyopathy. Biochemistry (Mosc). 2019;84:291-298 pubmed publisher
Podgurskaya A, Tsvelaya V, Slotvitsky M, Dementyeva E, Valetdinova K, Agladze K. The Use of iPSC-Derived Cardiomyocytes and Optical Mapping for Erythromycin Arrhythmogenicity Testing. Cardiovasc Toxicol. 2019;: pubmed publisher
Haghighi F, Dahlmann J, Nakhaei Rad S, Lang A, Kutschka I, Zenker M, et al. bFGF-mediated pluripotency maintenance in human induced pluripotent stem cells is associated with NRAS-MAPK signaling. Cell Commun Signal. 2018;16:96 pubmed publisher
Choi H, Kim I, Lee H, Park Y, Suh J, Han J. Chicken NANOG self-associates via a novel folding-upon-binding mechanism. FASEB J. 2018;32:2563-2573 pubmed publisher
Lu H, Leong M, Lim T, Chua Y, Lim J, Du C, et al. Engineering a functional three-dimensional human cardiac tissue model for drug toxicity screening. Biofabrication. 2017;9:025011 pubmed publisher
Ahmadian Baghbaderani B, Tian X, Scotty Cadet J, Shah K, Walde A, Tran H, et al. A Newly Defined and Xeno-Free Culture Medium Supports Every-Other-Day Medium Replacement in the Generation and Long-Term Cultivation of Human Pluripotent Stem Cells. PLoS ONE. 2016;11:e0161229 pubmed publisher
Drozd A, Walczak M, Piaskowski S, Stoczyńska Fidelus E, Rieske P, Grzela D. Generation of human iPSCs from cells of fibroblastic and epithelial origin by means of the oriP/EBNA-1 episomal reprogramming system. Stem Cell Res Ther. 2015;6:122 pubmed publisher
Kim S, Oceguera Yanez F, Hirohata R, Linker S, Okita K, Yamada Y, et al. KLF4 N-terminal variance modulates induced reprogramming to pluripotency. Stem Cell Reports. 2015;4:727-43 pubmed publisher
Okita K, Yamakawa T, Matsumura Y, Sato Y, Amano N, Watanabe A, et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 2013;31:458-66 pubmed publisher
product information
Catalog Number :
41814
Product Name :
pCE-hSK
article :
doi10.1002/stem.1293
id6095
pubmed_id23193063
bacterial resistance :
Ampicillin
cloning :
backbonepCE
backbone_mutation
backbone_origin
backbone_size9364
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth strain :
Non-integrating (episomal) expression of human SOX2 and KLF4
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5EcoRI
promoterCAG
sequencing_primer_3TTAGCCAGAAGTCAGATGCTC
sequencing_primer_5pCAG-F
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesANOP3, MCOPS3
geneSOX2
id6657
aliasesEZF, GKLF
geneKLF4
id9314
genbank_ids
NM_003106
NM_004235
mutation
nameSOX2, KLF4
shRNA_sequence
size2513
species
9606
Homo sapiens
tags
plasmid copy :
pCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
resistance markers :
596
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA