4xCSL-luciferase | Addgene 41726 product information

This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.

product summary

company name :

Addgene

product type :

cDNA

product name :

4xCSL-luciferase

catalog :

41726

citations: 18

Reference
Nomura T, Nagao K, Shirai R, Gotoh H, Umeda M, Ono K. Temperature sensitivity of Notch signaling underlies species-specific developmental plasticity and robustness in amniote brains. Nat Commun. 2022;13:96 pubmed publisher
Siddharth S, Parida S, Muniraj N, Hercules S, Lim D, Nagalingam A, et al. Concomitant activation of GLI1 and Notch1 contributes to racial disparity of human triple negative breast cancer progression. elife. 2021;10: pubmed publisher
Silva G, Sales Dias J, Casal D, Alves S, Domenici G, Barreto C, et al. Development of Dl1.72, a Novel Anti-DLL1 Antibody with Anti-Tumor Efficacy against Estrogen Receptor-Positive Breast Cancer. Cancers (Basel). 2021;13: pubmed publisher
Gutierrez J, Gonzalez D, Escalona Rivano R, Takahashi C, Brandan E. Reduced RECK levels accelerate skeletal muscle differentiation, improve muscle regeneration, and decrease fibrosis. FASEB J. 2021;35:e21503 pubmed publisher
Lake R, Haynes M, Dreval K, Bilkis R, Sklar L, Fan H. A Novel Flow Cytometric Assay to Identify Inhibitors of RBPJ-DNA Interactions. SLAS Discov. 2020;:2472555220932552 pubmed publisher
Tamir T, Bowman B, Agajanian M, Goldfarb D, Schrank T, Stohrer T, et al. Gain-of-function genetic screen of the kinome reveals BRSK2 as an inhibitor of the NRF2 transcription factor. J Cell Sci. 2020;133: pubmed publisher
Kang M, Cho J, Kim T, Lee S, Kim H, Coronado I, et al. Quadrella incana (Capparaceae) Leaf Extract Enhances Proliferation and Maintenance of Neural Stem/Progenitor Cells through Upregulating Glycolytic Flux and Redox Potential. Oxid Med Cell Longev. 2020;2020:5963037 pubmed publisher
Kim T, Kwon H, Kang M, Leem H, Lee K, Kim D. The Antitumor Natural Compound Falcarindiol Disrupts Neural Stem Cell Homeostasis by Suppressing Notch Pathway. Int J Mol Sci. 2018;19: pubmed publisher
LaFoya B, Munroe J, Pu X, Albig A. Src kinase phosphorylates Notch1 to inhibit MAML binding. Sci Rep. 2018;8:15515 pubmed publisher
Castro Colabianchi A, Revinski D, Encinas P, Baez M, Monti R, Rodríguez Abinal M, et al. Notch1 is asymmetrically distributed from the beginning of embryogenesis and controls the ventral center. Development. 2018;145: pubmed publisher
Yamashita W, Takahashi M, Kikkawa T, Gotoh H, Osumi N, Ono K, et al. Conserved and divergent functions of Pax6 underlie species-specific neurogenic patterns in the developing amniote brain. Development. 2018;145: pubmed publisher
Yang X, Geng K, Zhang J, Zhang Y, Shao J, Xia W. Sirt3 Mediates the Inhibitory Effect of Adjudin on Astrocyte Activation and Glial Scar Formation following Ischemic Stroke. Front Pharmacol. 2017;8:943 pubmed publisher
Zhang C, Chen D, Margaret Maguire E, He S, Chen J, An W, et al. Cbx3 Inhibits Vascular Smooth Muscle Cell Proliferation, Migration and Neointima Formation. Cardiovasc Res. 2017;: pubmed publisher
Robinson S, Klobucar K, Pierre C, Ansari A, Zhenilo S, Prokhortchouk E, et al. Kaiso differentially regulates components of the Notch signaling pathway in intestinal cells. Cell Commun Signal. 2017;15:24 pubmed publisher
Yue F, Bi P, Wang C, Shan T, Nie Y, Ratliff T, et al. Pten is necessary for the quiescence and maintenance of adult muscle stem cells. Nat Commun. 2017;8:14328 pubmed publisher
Kivela R, Salmela I, Nguyen Y, Petrova T, Koistinen H, Wiener Z, et al. The transcription factor Prox1 is essential for satellite cell differentiation and muscle fibre-type regulation. Nat Commun. 2016;7:13124 pubmed publisher
Bhola N, Jansen V, Koch J, Li H, Formisano L, Williams J, et al. Treatment of Triple-Negative Breast Cancer with TORC1/2 Inhibitors Sustains a Drug-Resistant and Notch-Dependent Cancer Stem Cell Population. Cancer Res. 2016;76:440-52 pubmed publisher
Saxena M, Schroeter E, Mumm J, Kopan R. Murine notch homologs (N1-4) undergo presenilin-dependent proteolysis. J Biol Chem. 2001;276:40268-73 pubmed

product information

Catalog Number :

41726

Product Name :

4xCSL-luciferase

article :

doi	10.1074/jbc.M107234200
id	6093
pubmed_id	11518718

bacterial resistance :

Ampicillin

cloning :

backbone

RSV-TATA pGL2

backbone_mutation

From pGL2-Basic: Rous sarcoma virus TATA box inserted to reduce basal luciferase activity.

backbone_origin

Dr. D. Towler (Washington University, St. Louis)

backbone_size

promoter

sequencing_primer_3

sequencing_primer_5

vector_types

Mammalian Expression

Luciferase

growth notes :

The 4xCSL-luciferase reporter was constructed from the CBF1/pGL2-GLO TATA CAT plasmid, a gift from Dr. S. Speck. A fragment containing the multimerized high affinity CSL sites (4 CGTGGGAA) was excised by BamHI digest and ligated into a BglII/BamHI-digested RSV-TATA pGL2 vector, a gift from Dr. D. Towler. This modified vector has a TATA box from Rous sarcoma virus inserted into the pGL2-basic vector (Promega) to reduce the basal luciferase activity. Construct was sequenced for verification. Alternate plasmid name: 4xCBS-luciferase

origin :

pi :

alt_names

4xCBS

cloning

clone_method	Restriction Enzyme
cloning_site_3	Bglll/BamHI
cloning_site_5	BglII/BamHI
promoter
sequencing_primer_3	LucNRev
sequencing_primer_5	F1ori-F (GTGGACTCTTGTTCCAAACTGG)
site_3_destroyed	1
site_5_destroyed	1

entrez_gene

genbank_ids

mutation

Contains a multimerized high affinity CSL binding site (4 x CGTGGGAA)

name

4xCSL binding sites

shRNA_sequence

size

species