This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pMXs-IP HA-Parkin
catalog :
38248
citations: 12
| Reference |
|---|
product information
Catalog Number :
38248
Product Name :
pMXs-IP HA-Parkin
article :
| doi | 10.1074/jbc.M110.209338 |
| id | 5628 |
| pubmed_id | 21454557 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pMXs-IP | ||
| backbone_mutation | |||
| backbone_origin | Dr. Toshio Kitamura of the University of Tokyo | ||
| backbone_size | 5800 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
origin :
37
pi :
LPRS2, PARK2, PDJgene PRKN id 5071 genbank_ids
mutation name Parkin shRNA_sequence size 1398 species
tags
Enzymecloning_site_3<
/td> NotI cloning_s
ite_5 NotI pro
moter sequenc
ing_primer_3 aaggaaaaaagcggccgc
ctacacgtcgaaccagtggtc
sequencing_primer_5aaggaaaaaag
cggccgcgtaccatggcttacccatacga
site_3_destroyed <
/tr>site_5_destroyed
td>entre
z_gene
| NM_004562 |
|
|
Enzyme
/td>
ite_5
moter
ing_primer_3
ctacacgtcgaaccagtggtc
sequencing_primer_5
cggccgcgtaccatggcttacccatacga
/tr>
td>
z_gene
|
