This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
10XSTAT92E luciferase
catalog :
37393
citations: 2
Reference |
---|
Baeg G, Zhou R, Perrimon N. Genome-wide RNAi analysis of JAK/STAT signaling components in Drosophila. Genes Dev. 2005;19:1861-70 pubmed
|
product information
Catalog Number :
37393
Product Name :
10XSTAT92E luciferase
article :
doi | 10.1101/gad.1320705 |
id | 5481 |
pubmed_id | 16055650 |
bacterial resistance :
Ampicillin
cloning :
backbone | pUAST | ||||
backbone_mutation | |||||
backbone_origin | |||||
backbone_size | 8904 | ||||
promoter | |||||
sequencing_primer_3 | |||||
sequencing_primer_5 | |||||
vector_types |
|
growth notes :
Perrimon Lab plasmid #446 A 441-bp genomic fragment in the enhancer of SOCS36E containing two potential STAT92E-binding sites was amplified by PCR, using five different sets of oligos: (1) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (2) CTGCAGGAACCACTCAGAGTGCCTGCGTGT (PstI), CTGCAGATACAAAACTGTCTTAGGTGTTTA (PstI); (3) GAATTCGAACCACTCAGAGTGCCTGCGTGT (EcoRI), GAATTCATACAAAACTGTCTTAGGTGTTTA (EcoRI); (4) AGATCTGAACCACTCAGAGTGCCTGCGTGT (BglII), AGATCTATACAAAACTGTCTTAGGTGTTTA (BglII); (5) GCGGCCGCGAACCACTCAGAGTGCCTGCGTGT (NotI), GCGGCCGCATACAAAACTGTCTTAGGTGTTTA (NotI). Each amplified genomic fragment containing different restriction enzyme sites was sequentially subcloned into pUAST. The genomic fragment amplified using the first set of oligos was subcloned into the PstI/EcoRI sites of pUAST to generate 2XSTAT92E. The genomic fragment amplified using the second set of oligos was subcloned into the PstI site of 2XSTAT92E to generate 4XSTAT92E. The genomic fragment amplified using the third set of oligos was subcloned into the EcoRI site of 4XSTAT92E to generate 6XSTAT92E. The genomic fragment amplified using the fourth set of oligos was subcloned into the BglII site of 6XSTAT92E to generate 8XSTAT92E. Next, the hsp70 minimal promoter element was amplified from pUAST by PCR using oligos GCGGCCGCAGCGGAGACTCTAGCGAGCG (NotI) and CTCGAGAATTCCCTATTCAGAGTTCT (XhoI). This hsp70 minimal promoter was subcloned into the NotI/XhoI sites of 8XSTAT92E to generate 8XSTAT92E hsp70. Again, the genomic fragment amplified using the fifth set of oligos was subcloned into the NotI site of 8XSTAT92E hsp70 vector to generate 10XSTAT92E hsp70. Finally, an XhoI/XbaI fragment containing the firefly luciferase gene from the pGL3 luciferase vector (Promega) was subcloned into the XhoI/XbaI sites of 10XSTAT92E hsp70 to generate 10XSTAT92E luciferase.
origin :
37
pi :
|
resistance markers :
1275 |
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments