This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO.1-GSK3 -#2
catalog :
32497
citations: 3
Reference
Wirianto M, Yang J, Kim E, Gao S, Paudel K, Choi J, et al. The GSK-3β-FBXL21 Axis Contributes to Circadian TCAP Degradation and Skeletal Muscle Function. Cell Rep. 2020;32:108140 pubmed publisher
Cortés Vieyra R, Silva García O, Oviedo Boyso J, Huante Mendoza A, Bravo Patiño A, Valdez Alarcón J, et al. The Glycogen Synthase Kinase 3α and β Isoforms Differentially Regulates Interleukin-12p40 Expression in Endothelial Cells Stimulated with Peptidoglycan from Staphylococcus aureus. PLoS ONE. 2015;10:e0132867 pubmed publisher
Yoeli Lerner M, Chin Y, Hansen C, Toker A. Akt/protein kinase b and glycogen synthase kinase-3beta signaling pathway regulates cell migration through the NFAT1 transcription factor. Mol Cancer Res. 2009;7:425-32 pubmed publisher
product information
Catalog Number :
32497
Product Name :
pLKO.1-GSK3 -#2
article :
doi10.1158/1541-7786.MCR-08-0342
id4675
pubmed_id19258413
bacterial resistance :
Ampicillin
cloning :
backbonepLKO.1
backbone_mutation
backbone_originSabatini Lab
backbone_size7000
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
RNAi
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3None
cloning_site_5None
promoterU6
sequencing_primer_3none
sequencing_primer_5LKO.1 (GACTATCATATGCTTACCGT)
site_3_destroyed
site_5_destroyed
entrez_gene
aliases
geneGSK3B
id2932
genbank_ids
mutation
nameGSK3B
shRNA_sequence(AAA)GCTAGATCACTGTAACA
size
species
9606
Homo sapiens
tags
resistance markers :
528
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA