This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pEVOL-pAzF
catalog :
31186
citations: 37
Reference
Islam J, Conroy P, Fercher C, Kim M, Yaari Z, Jones M, et al. Design of Polarity-Dependent Immunosensors Based on the Structural Analysis of Engineered Antibodies. ACS Chem Biol. 2023;: pubmed publisher
Guo A, Chen X. Genetically Encoded Noncanonical Amino Acids in Proteins to Investigate Lysine Benzoylation. Methods Mol Biol. 2023;2676:131-146 pubmed publisher
Cheng K, Ma N, Liang J, Ma X, Feng Q, Liu G, et al. Site-Specific Modification of Virus-Like Particles for Exogenous Tumor Antigen Display and Minimizing Preexisting Immunity. Small. 2023;19:e2300125 pubmed publisher
Wang Y, Zhang J, Han B, Tan L, Cai W, Li Y, et al. Noncanonical amino acids as doubly bio-orthogonal handles for one-pot preparation of protein multiconjugates. Nat Commun. 2023;14:974 pubmed publisher
Ma X, Wei B, Wang E. Efficient incorporation of p-azido-l-phenylalanine into the protein using organic solvents. Protein Expr Purif. 2022;200:106158 pubmed publisher
Michielsen C, van Aalen E, Merkx M. Ratiometric Bioluminescent Zinc Sensor Proteins to Quantify Serum and Intracellular Free Zn2. ACS Chem Biol. 2022;17:1567-1576 pubmed publisher
Stadler K, Becker W, Darnhofer B, Birner Gruenberger R, Zangger K. Overexpression of recombinant proteins containing non-canonical amino acids in Vibrio natriegens: p-azido-L-phenylalanine as coupling site for 19F-tags. Amino Acids. 2022;54:1041-1053 pubmed publisher
Saurabh S, Chong T, Bayas C, Dahlberg P, Cartwright H, Moerner W, et al. ATP-responsive biomolecular condensates tune bacterial kinase signaling. Sci Adv. 2022;8:eabm6570 pubmed publisher
Van den Bergh B, Schramke H, Michiels J, Kimkes T, Radzikowski J, Schimpf J, et al. Mutations in respiratory complex I promote antibiotic persistence through alterations in intracellular acidity and protein synthesis. Nat Commun. 2022;13:546 pubmed publisher
Ruppert M, Creon A, Tidow H, Huse N. Population Dynamics of Stretching Excitations of p-Azido-phenylalanine Incorporated in Calmodulin-Peptide Complexes. J Phys Chem B. 2022;: pubmed publisher
Kesici M, Tinnefeld P, Vera A. A simple and general approach to generate photoactivatable DNA processing enzymes. Nucleic Acids Res. 2021;: pubmed publisher
Sapienza P, Currie M, Lancaster N, Li K, AUBE J, Goldfarb D, et al. Visualizing an Allosteric Intermediate Using CuAAC Stabilization of an NMR Mixed Labeled Dimer. ACS Chem Biol. 2021;16:2766-2775 pubmed publisher
Chen W, Lu W, Wolynes P, Komives E. Single-molecule conformational dynamics of a transcription factor reveals a continuum of binding modes controlling association and dissociation. Nucleic Acids Res. 2021;49:11211-11223 pubmed publisher
Zhang B, Ryan E, Wang X, Lindsay S. Probing Bioelectronic Connections Using Streptavidin Molecules with Modified Valency. J Am Chem Soc. 2021;143:15139-15144 pubmed publisher
Singh M, Zangoui P, Yamanaka Y, Kenney L. Genetic code expansion enables visualization of Salmonella type three secretion system components and secreted effectors. elife. 2021;10: pubmed publisher
Wörle E, Jakob L, Schmidbauer A, Zinner G, Grohmann D. Decoupling the bridge helix of Cas12a results in a reduced trimming activity, increased mismatch sensitivity and impaired conformational transitions. Nucleic Acids Res. 2021;49:5278-5293 pubmed publisher
Kurttila M, Stucki Buchli B, Rumfeldt J, Schroeder L, Häkkänen H, Liukkonen A, et al. Site-by-site tracking of signal transduction in an azidophenylalanine-labeled bacteriophytochrome with step-scan FTIR spectroscopy. Phys Chem Chem Phys. 2021;23:5615-5628 pubmed publisher
Groves N, Bruns M, Van Engelenburg S. A Quantitative Live-Cell Superresolution Imaging Framework for Measuring the Mobility of Single Molecules at Sites of Virus Assembly. Pathogens. 2020;9: pubmed publisher
Tieu T, Wojnilowicz M, Huda P, Thurecht K, Thissen H, Voelcker N, et al. Nanobody-displaying porous silicon nanoparticles for the co-delivery of siRNA and doxorubicin. Biomater Sci. 2021;9:133-147 pubmed publisher
Liu Z, Liu H, Vera A, Bernardi R, Tinnefeld P, Nash M. High force catch bond mechanism of bacterial adhesion in the human gut. Nat Commun. 2020;11:4321 pubmed publisher
Palani S, Koester D, Balasubramanian M. Phosphoregulation of tropomyosin-actin interaction revealed using a genetic code expansion strategy. Wellcome Open Res. 2020;5:161 pubmed publisher
Hebbrecht T, Liu J, Zwaenepoel O, Boddin G, Van Leene C, Decoene K, et al. Nanobody click chemistry for convenient site-specific fluorescent labelling, single step immunocytochemistry and delivery into living cells by photoporation and live cell imaging. N Biotechnol. 2020;59:33-43 pubmed publisher
Rosier B, Markvoort A, Gumí Audenis B, Roodhuizen J, den Hamer A, Brunsveld L, et al. Proximity-induced caspase-9 activation on a DNA origami-based synthetic apoptosome. Nat Catal. 2020;3:295-306 pubmed publisher
Pezeshkian N, Groves N, Van Engelenburg S. Single-molecule imaging of HIV-1 envelope glycoprotein dynamics and Gag lattice association exposes determinants responsible for virus incorporation. Proc Natl Acad Sci U S A. 2019;116:25269-25277 pubmed publisher
Ma X, Zhu M, Liu J, Li X, Qu L, Liang L, et al. Interactions between PHD3-Bromo of MLL1 and H3K4me3 Revealed by Single-Molecule Magnetic Tweezers in a Parallel DNA Circuit. Bioconjug Chem. 2019;30:2998-3006 pubmed publisher
Dickey T, Song B, Pyle A. RNA binding activates RIG-I by releasing an autorepressed signaling domain. Sci Adv. 2019;5:eaax3641 pubmed publisher
Rimbault C, Maruthi K, Breillat C, Genuer C, Crespillo S, Puente Muñoz V, et al. Engineering selective competitors for the discrimination of highly conserved protein-protein interaction modules. Nat Commun. 2019;10:4521 pubmed publisher
Carlson E, d Aquino A, Kim D, Fulk E, Hoang K, Szal T, et al. Engineered ribosomes with tethered subunits for expanding biological function. Nat Commun. 2019;10:3920 pubmed publisher
Creon A, Josts I, Niebling S, Huse N, Tidow H. Conformation-specific detection of calmodulin binding using the unnatural amino acid p-azido-phenylalanine (AzF) as an IR-sensor. Struct Dyn. 2018;5:064701 pubmed publisher
Hagmann V, Sommer S, Fabian P, Bierlmeier J, van Treel N, Mootz H, et al. Chemically monoubiquitinated PEX5 binds to the components of the peroxisomal docking and export machinery. Sci Rep. 2018;8:16014 pubmed publisher
Betancourt Solis M, Desai T, McNew J. The atlastin membrane anchor forms an intramembrane hairpin that does not span the phospholipid bilayer. J Biol Chem. 2018;293:18514-18524 pubmed publisher
Lim S, Yang B, Jung Y, Cha J, Cho J, Choi E, et al. Controlled Orientation of Active Sites in a Nanostructured Multienzyme Complex. Sci Rep. 2016;6:39587 pubmed publisher
Yang S, Lim S, Kiessling V, Kwon I, Tamm L. Site-specific fluorescent labeling to visualize membrane translocation of a myristoyl switch protein. Sci Rep. 2016;6:32866 pubmed publisher
Nienberg C, Retterath A, Becher K, Saenger T, Mootz H, Jose J. Site-Specific Labeling of Protein Kinase CK2: Combining Surface Display and Click Chemistry for Drug Discovery Applications. Pharmaceuticals (Basel). 2016;9: pubmed publisher
Maklashina E, Rajagukguk S, Starbird C, McDonald W, Koganitsky A, Eisenbach M, et al. Binding of the Covalent Flavin Assembly Factor to the Flavoprotein Subunit of Complex II. J Biol Chem. 2016;291:2904-16 pubmed publisher
Biddle W, Schmitt M, Fisk J. Evaluating Sense Codon Reassignment with a Simple Fluorescence Screen. Biochemistry. 2015;54:7355-64 pubmed publisher
Chin J, Santoro S, Martin A, King D, Wang L, Schultz P. Addition of p-azido-L-phenylalanine to the genetic code of Escherichia coli. J Am Chem Soc. 2002;124:9026-7 pubmed
product information
Catalog Number :
31186
Product Name :
pEVOL-pAzF
article :
doi10.1021/ja027007w
id7160
pubmed_id12148987
bacterial resistance :
Chloramphenicol
cloning :
backbonep15A
backbone_mutation
backbone_origin
backbone_size5000
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth strain :
tRNA synthetase/tRNA pair for the in vivo incorporation of a photocrosslinker, p-azido-l-phenylalanine, into proteins in E coli response to the amber codon, TAG
growth temp :
Any strain for growth, 37 oC, LB/2XYT media
origin :
37
pi :
E107N, D158P, I159L, L162Q, D286RnameM.j. p-azidohenylalanine RS (2 copies +tRNA)shRNA_sequencesize1000species
32644
Other
M.jannaschii
tags
Enzymecloning_site_3<
/td>SalIcloning_s
ite_5BglIIpr
omotersequen
cing_primer_3>sequencing_primer_5ATTAGCGGAT
CCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCT
CCATACCCGTTTTTTsite_3
_destroyedsi
te_5_destroyede>entrez_gene>genbank_ids
mutationY32T
,
alt_names
pEVOL-pAz
cloning
clone_methodRestriction
resistance markers :
975
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA