This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pHR-SIN-PTEN-Y138L
catalog :
30378
citations: 2
Reference
Peglion F, Capuana L, Perfettini I, Boucontet L, Braithwaite B, Colucci Guyon E, et al. PTEN inhibits AMPK to control collective migration. Nat Commun. 2022;13:4528 pubmed publisher
Kim J, Xu X, Li H, Solomon D, Lane W, Jin T, et al. Mechanistic analysis of a DNA damage-induced, PTEN-dependent size checkpoint in human cells. Mol Cell Biol. 2011;31:2756-71 pubmed publisher
product information
Catalog Number :
30378
Product Name :
pHR-SIN-PTEN-Y138L
article :
doi10.1128/MCB.01323-10
id4413
pubmed_id21536651
bacterial resistance :
Ampicillin
cloning :
backbonepHR-SIN
backbone_mutation
backbone_origin
backbone_size9000
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3Not I
cloning_site_5BamH I
promoter
sequencing_primer_3
sequencing_primer_5CCAAGGACCTGAAATGACCC
site_3_destroyed
site_5_destroyed
entrez_gene
aliases10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1
genePTEN
id5728
genbank_ids
U93051
mutationY138L
namePTEN-Y138L
shRNA_sequence
size1209
species
9606
Homo sapiens
tags
resistance markers :
757
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA