This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO.1 GFP shRNA
catalog :
30323
citations: 69
Reference
Dai T, Li Y, Hu H, Zhao Y, Peng H, Bai W, et al. Inhibiting the m6A Reader IGF2BP3 Suppresses Ovarian Cancer Cell Growth via Regulating PLAGL2 mRNA Stabilization. World J Oncol. 2024;15:100-113 pubmed publisher
Vela Rodr xed guez C, Yang C, Alanen H, Eki R, ABBAS T, Maksimainen M, et al. Oligomerisation mediated by the D2 domain of DTX3L is critical for DTX3L-PARP9 reading function of mono-ADP-ribosylated androgen receptor. bioRxiv. 2023;: pubmed publisher
Zhou H, Zhou L, Guan Q, Hou X, Wang C, Liu L, et al. Skp2-mediated MLKL degradation confers cisplatin-resistant in non-small cell lung cancer cells. Commun Biol. 2023;6:805 pubmed publisher
Tangudu N, Buj R, Wang J, Cole A, Uboveja A, Fang R, et al. De novo purine metabolism is a metabolic vulnerability of cancers with low p16 expression. bioRxiv. 2023;: pubmed publisher
Wang L, Gao P, Li C, Liu Q, Yao Z, Li Y, et al. A single-cell atlas of bovine skeletal muscle reveals mechanisms regulating intramuscular adipogenesis and fibrogenesis. J Cachexia Sarcopenia Muscle. 2023;: pubmed publisher
Liu Q, Li C, Deng B, Gao P, Wang L, Li Y, et al. Tcf21 marks visceral adipose mesenchymal progenitors and functions as a rate-limiting factor during visceral adipose tissue development. Cell Rep. 2023;42:112166 pubmed publisher
Kim B, Gwak J, Kim M, Yang S, Hwang S, Shin S, et al. Suppression of fatty acid oxidation supports pancreatic cancer growth and survival under hypoxic conditions through autophagy induction. Cancer Gene Ther. 2023;30:878-889 pubmed publisher
Collins S, Wiegand M, Werner A, Brown I, Mundo M, Swango D, et al. Ras-mediated activation of mTORC2 promotes breast epithelial cell migration and invasion. Mol Biol Cell. 2023;34:ar9 pubmed publisher
Hebron K, Wan X, Roth J, Liewehr D, Sealover N, Frye W, et al. The combination of trametinib and ganitumab is effective in RAS-mutated PAX-fusion negative rhabdomyosarcoma models. Clin Cancer Res. 2022;: pubmed publisher
Yan Q, Wu Y, Li D, Li Y. A-Kinase Anchoring Protein 9 Promotes Gastric Cancer Progression as a Downstream Effector of Cadherin 1. J Oncol. 2022;2022:2830634 pubmed publisher
Zhou H, Guan Q, Hou X, Liu L, Zhou L, Li W, et al. Epithelial-mesenchymal reprogramming by KLF4-regulated Rictor expression contributes to metastasis of non-small cell lung cancer cells. Int J Biol Sci. 2022;18:4869-4883 pubmed publisher
Hsu Y, Yin Y, Tsai K, Jian C, Liang Z, Hsu C, et al. TGFBR3 supports anoikis through suppressing ATF4 signaling. J Cell Sci. 2022;135: pubmed publisher
Rehman H, Chandrashekar D, Balabhadrapatruni C, Nepal S, Balasubramanya S, Shelton A, et al. ARID1A-deficient bladder cancer is dependent on PI3K signaling and sensitive to EZH2 and PI3K inhibitors. JCI Insight. 2022;7: pubmed publisher
Liu W, Ma Z, Wu Y, Yuan C, Zhang Y, Liang Z, et al. MST4 negatively regulates type I interferons production via targeting MAVS-mediated pathway. Cell Commun Signal. 2022;20:103 pubmed publisher
Han S, Liu Q, Yang Z, Ma J, Liu D, Yan C, et al. Identification of Ferroptosis-Related Gene Prognostic Signature and HSF1 for Reversing Doxorubicin and Gemcitabine Resistance in Uterine Carcinosarcoma. Dis Markers. 2022;2022:6400227 pubmed publisher
Kawabata H, Ono Y, Tamamura N, Oyama K, Ueda J, Sato H, et al. Mutant GNAS limits tumor aggressiveness in established pancreatic cancer via antagonizing the KRAS-pathway. J Gastroenterol. 2022;: pubmed publisher
Feng L, Feng S, Nie Z, Deng Y, Xuan Y, Chen X, et al. TRAF6 Promoted Tumor Glycolysis in Non-Small-Cell Lung Cancer by Activating the Akt-HIFα Pathway. Biomed Res Int. 2021;2021:3431245 pubmed publisher
Huang H, Gont A, Kee L, Dries R, Pfeifer K, Sharma B, et al. Extracellular domain shedding of the ALK receptor mediates neuroblastoma cell migration. Cell Rep. 2021;36:109363 pubmed publisher
Yoo Y, Park S, Jo E, Choi M, Lee K, Hong D, et al. Overexpression of Replication-Dependent Histone Signifies a Subset of Dedifferentiated Liposarcoma with Increased Aggressiveness. Cancers (Basel). 2021;13: pubmed publisher
Kaban K, Hinterleitner C, Zhou Y, Salva E, Kantarci A, Salih H, et al. Therapeutic Silencing of BCL-2 Using NK Cell-Derived Exosomes as a Novel Therapeutic Approach in Breast Cancer. Cancers (Basel). 2021;13: pubmed publisher
Yang C, Jividen K, Kamata T, Dworak N, Oostdyk L, Remlein B, et al. Androgen signaling uses a writer and a reader of ADP-ribosylation to regulate protein complex assembly. Nat Commun. 2021;12:2705 pubmed publisher
Goldfarb A, Freeman K, Sahu R, Elagib K, Holy M, Arneja A, et al. Iron control of erythroid microtubule cytoskeleton as a potential target in treatment of iron-restricted anemia. Nat Commun. 2021;12:1645 pubmed publisher
Sayedyahossein S, Huang K, Li Z, Zhang C, Kozlov A, Johnston D, et al. Pannexin 1 binds β-catenin to modulate melanoma cell growth and metabolism. J Biol Chem. 2021;296:100478 pubmed publisher
Zhu H, Li J, Li Y, Zheng Z, Guan H, Wang H, et al. Glucocorticoid counteracts cellular mechanoresponses by LINC01569-dependent glucocorticoid receptor-mediated mRNA decay. Sci Adv. 2021;7: pubmed publisher
Zheng J, Lin Y, Tang F, Guo H, Yan L, Hu S, et al. Promotive Role of CircATRNL1 on Chondrogenic Differentiation of BMSCs Mediated by miR-338-3p. Arch Med Res. 2021;52:514-522 pubmed publisher
Buj R, Leon K, Anguelov M, Aird K. Suppression of p16 alleviates the senescence-associated secretory phenotype. Aging (Albany NY). 2021;13:3290-3312 pubmed publisher
Naffar Abu Amara S, Kuiken H, Selfors L, Butler T, Leung M, Leung C, et al. Transient commensal clonal interactions can drive tumor metastasis. Nat Commun. 2020;11:5799 pubmed publisher
Zeng J, Dong S, Luo Z, Xie X, Fu B, Li P, et al. The Zika Virus Capsid Disrupts Corticogenesis by Suppressing Dicer Activity and miRNA Biogenesis. Cell Stem Cell. 2020;27:618-632.e9 pubmed publisher
VanDeusen H, Ramroop J, Morel K, Bae S, Sheahan A, Sychev Z, et al. Targeting RET Kinase in Neuroendocrine Prostate Cancer. Mol Cancer Res. 2020;: pubmed publisher
Deng M, Tam J, Wang L, Liang K, Li S, Zhang L, et al. TRAF3IP3 negatively regulates cytosolic RNA induced anti-viral signaling by promoting TBK1 K48 ubiquitination. Nat Commun. 2020;11:2193 pubmed publisher
Zhao L, Ke H, Xu H, Wang G, Zhang H, Zou L, et al. TDP-43 facilitates milk lipid secretion by post-transcriptional regulation of Btn1a1 and Xdh. Nat Commun. 2020;11:341 pubmed publisher
Matthew Onabanjo A, Janusis J, Mercado Matos J, Carlisle A, Kim D, Levine F, et al. Beclin 1 promotes endosome recruitment of hepatocyte growth factor tyrosine kinase substrate (HRS) to suppress tumor proliferation. Cancer Res. 2019;: pubmed publisher
Yang L, Hong Q, Xu S, Kuang X, Di G, Liu G, et al. Downregulation of transgelin 2 promotes breast cancer metastasis by activating the reactive oxygen species/nuclear factor‑κB signaling pathway. Mol Med Rep. 2019;20:4045-4258 pubmed publisher
Debruyne D, Dries R, Sengupta S, Seruggia D, Gao Y, Sharma B, et al. BORIS promotes chromatin regulatory interactions in treatment-resistant cancer cells. Nature. 2019;572:676-680 pubmed publisher
Haque M, Li J, Huang Y, Almowaled M, Barger C, Karpf A, et al. NPM-ALK Is a Key Regulator of the Oncoprotein FOXM1 in ALK-Positive Anaplastic Large Cell Lymphoma. Cancers (Basel). 2019;11: pubmed publisher
Bochnakian A, Zhen A, Zisoulis D, Idica A, Kewalramani V, Neel N, et al. Interferon-Inducible MicroRNA miR-128 Modulates HIV-1 Replication by Targeting TNPO3 mRNA. J Virol. 2019;93: pubmed publisher
Li X, Deng M, Petrucelli A, Zhu C, Mo J, Zhang L, et al. Viral DNA Binding to NLRC3, an Inhibitory Nucleic Acid Sensor, Unleashes STING, a Cyclic Dinucleotide Receptor that Activates Type I Interferon. Immunity. 2019;50:591-599.e6 pubmed publisher
Santana Codina N, Gableske S, Quiles Del Rey M, Małachowska B, Jedrychowski M, Biancur D, et al. NCOA4 maintains murine erythropoiesis via cell autonomous and non-autonomous mechanisms. Haematologica. 2019;: pubmed publisher
Wörthmüller J, Blum W, Pecze L, Salicio V, Schwaller B. Calretinin promotes invasiveness and EMT in malignant mesothelioma cells involving the activation of the FAK signaling pathway. Oncotarget. 2018;9:36256-36272 pubmed publisher
Wörthmüller J, Oberson A, Salicio V, Blum W, Schwaller B. Calretinin Functions in Malignant Mesothelioma Cells Cannot Be Replaced by the Closely Related Ca2+-Binding Proteins Calbindin-D28k and Parvalbumin. Int J Mol Sci. 2018;19: pubmed publisher
Santana Codina N, Roeth A, Zhang Y, Yang A, Mashadova O, Asara J, et al. Oncogenic KRAS supports pancreatic cancer through regulation of nucleotide synthesis. Nat Commun. 2018;9:4945 pubmed publisher
Li W, Yu X, Xia Z, Yu X, Xie L, Ma X, et al. Repression of Noxa by Bmi1 contributes to deguelin-induced apoptosis in non-small cell lung cancer cells. J Cell Mol Med. 2018;22:6213-6227 pubmed publisher
Li W, Yu X, Ma X, Xie L, Xia Z, Liu L, et al. Deguelin attenuates non-small cell lung cancer cell metastasis through inhibiting the CtsZ/FAK signaling pathway. Cell Signal. 2018;50:131-141 pubmed publisher
Sullivan L, Luengo A, Danai L, Bush L, Diehl F, Hosios A, et al. Aspartate is an endogenous metabolic limitation for tumour growth. Nat Cell Biol. 2018;20:782-788 pubmed publisher
Takahashi N, Chen H, Harris I, Stover D, Selfors L, Bronson R, et al. Cancer Cells Co-opt the Neuronal Redox-Sensing Channel TRPA1 to Promote Oxidative-Stress Tolerance. Cancer Cell. 2018;33:985-1003.e7 pubmed publisher
Yosefzon Y, Soteriou D, Feldman A, Kostić L, Koren E, Brown S, et al. Caspase-3 Regulates YAP-Dependent Cell Proliferation and Organ Size. Mol Cell. 2018;70:573-587.e4 pubmed publisher
Snijders Blok L, Hiatt S, Bowling K, Prokop J, Engel K, Cochran J, et al. De novo mutations in MED13, a component of the Mediator complex, are associated with a novel neurodevelopmental disorder. Hum Genet. 2018;137:375-388 pubmed publisher
Mao X, Zhu H, Luo D, Ye L, Yin H, Zhang J, et al. Capsaicin inhibits glycolysis in esophageal squamous cell carcinoma by regulating hexokinase‑2 expression. Mol Med Rep. 2018;17:6116-6121 pubmed publisher
Li M, Yu X, Li W, Liu T, Deng G, Liu W, et al. Deguelin suppresses angiogenesis in human hepatocellular carcinoma by targeting HGF-c-Met pathway. Oncotarget. 2018;9:152-166 pubmed publisher
Fok J, Hedayat S, Zhang L, Aronson L, Mirabella F, Pawlyn C, et al. HSF1 Is Essential for Myeloma Cell Survival and A Promising Therapeutic Target. Clin Cancer Res. 2018;24:2395-2407 pubmed publisher
Yu X, Liang Q, Liu W, Zhou L, Li W, Liu H. Deguelin, an Aurora B Kinase Inhibitor, Exhibits Potent Anti-Tumor Effect in Human Esophageal Squamous Cell Carcinoma. EBioMedicine. 2017;26:100-111 pubmed publisher
Ni T, Li X, Lu N, An T, Liu Z, Fu R, et al. Snail1-dependent p53 repression regulates expansion and activity of tumour-initiating cells in breast cancer. Nat Cell Biol. 2016;18:1221-1232 pubmed publisher
Park S, Choi M, Park D, Jeong M, Ahn K, Lee J, et al. AEG-1 promotes mesenchymal transition through the activation of Rho GTPases in human glioblastoma cells. Oncol Rep. 2016;36:2641-2646 pubmed publisher
Liu H, Li W, Yu X, Gao F, Duan Z, Ma X, et al. EZH2-mediated Puma gene repression regulates non-small cell lung cancer cell proliferation and cisplatin-induced apoptosis. Oncotarget. 2016;7:56338-56354 pubmed publisher
Wang S, Wuputra K, Liu C, Lin Y, Chen Y, Chai C, et al. Oncogenic function of the homeobox A13-long noncoding RNA HOTTIP-insulin growth factor-binding protein 3 axis in human gastric cancer. Oncotarget. 2016;7:36049-36064 pubmed publisher
Hecht V, Sullivan L, Kimmerling R, Kim D, Hosios A, Stockslager M, et al. Biophysical changes reduce energetic demand in growth factor-deprived lymphocytes. J Cell Biol. 2016;212:439-47 pubmed publisher
Prior K, Wittig I, Leisegang M, Groenendyk J, Weissmann N, Michalak M, et al. The Endoplasmic Reticulum Chaperone Calnexin Is a NADPH Oxidase NOX4 Interacting Protein. J Biol Chem. 2016;291:7045-59 pubmed publisher
Yuen K, Xu B, Krantz I, Gerton J. NIPBL Controls RNA Biogenesis to Prevent Activation of the Stress Kinase PKR. Cell Rep. 2016;14:93-102 pubmed publisher
Chandrani P, Upadhyay P, Iyer P, Tanna M, Shetty M, Raghuram G, et al. Integrated genomics approach to identify biologically relevant alterations in fewer samples. BMC Genomics. 2015;16:936 pubmed publisher
Mancias J, Pontano Vaites L, Nissim S, Biancur D, Kim A, Wang X, et al. Ferritinophagy via NCOA4 is required for erythropoiesis and is regulated by iron dependent HERC2-mediated proteolysis. elife. 2015;4: pubmed publisher
Langsfeld E, Bodily J, Laimins L. The Deacetylase Sirtuin 1 Regulates Human Papillomavirus Replication by Modulating Histone Acetylation and Recruitment of DNA Damage Factors NBS1 and Rad51 to Viral Genomes. PLoS Pathog. 2015;11:e1005181 pubmed publisher
Kruse C, Kurz A, Pálfi K, Humbert P, Sperandio M, Brandes R, et al. Polarity Protein Scrib Facilitates Endothelial Inflammatory Signaling. Arterioscler Thromb Vasc Biol. 2015;35:1954-62 pubmed publisher
Zhang X, Cheng S, Bian K, Wang L, Zhang X, Yan B, et al. MicroRNA-26a promotes anoikis in human hepatocellular carcinoma cells by targeting alpha5 integrin. Oncotarget. 2015;6:2277-89 pubmed
Mancias J, Wang X, Gygi S, Harper J, Kimmelman A. Quantitative proteomics identifies NCOA4 as the cargo receptor mediating ferritinophagy. Nature. 2014;509:105-9 pubmed publisher
Wang C, Qin L, Manes T, Kirkiles Smith N, Tellides G, Pober J. Rapamycin antagonizes TNF induction of VCAM-1 on endothelial cells by inhibiting mTORC2. J Exp Med. 2014;211:395-404 pubmed publisher
Blum W, Schwaller B. Calretinin is essential for mesothelioma cell growth/survival in vitro: a potential new target for malignant mesothelioma therapy?. Int J Cancer. 2013;133:2077-88 pubmed publisher
Wang C, Yi T, Qin L, Maldonado R, von Andrian U, Kulkarni S, et al. Rapamycin-treated human endothelial cells preferentially activate allogeneic regulatory T cells. J Clin Invest. 2013;123:1677-93 pubmed publisher
Qin Y, Ouyang H, Liu J, Xie Y. Proteome identification of proteins interacting with histone methyltransferase SET8. Acta Biochim Biophys Sin (Shanghai). 2013;45:303-8 pubmed publisher
Sancak Y, Peterson T, Shaul Y, Lindquist R, Thoreen C, Bar Peled L, et al. The Rag GTPases bind raptor and mediate amino acid signaling to mTORC1. Science. 2008;320:1496-501 pubmed publisher
product information
Catalog Number :
30323
Product Name :
pLKO.1 GFP shRNA
article :
doi10.1126/science.1157535
id2268
pubmed_id18497260
bacterial resistance :
Ampicillin
cloning :
backbonepLKO.1 puro
backbone_mutation
backbone_originAvailable at Addgene (#8453)
backbone_size7000
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
RNAi
growth notes :
shRNA directed against GFP (Target sequence: 5'GCAAGCTGACCCTGAAGTTCAT3'). Used as control shRNA.
origin :
37
pi :
alt_names
shGFP
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5AgeI
promoter
sequencing_primer_3
sequencing_primer_5LKO.1 5'
site_3_destroyed
site_5_destroyed1
entrez_gene
genbank_ids
mutation
nameGFP shRNA
shRNA_sequence
size
species
tags
resistance markers :
432
tags :
High Copy
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA