pcDNA3 mCherry LIC cloning vector (6B) | Addgene 30125 product information

This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.

product summary

company name :

Addgene

product type :

cDNA

product name :

pcDNA3 mCherry LIC cloning vector (6B)

catalog :

30125

citations: 13

Reference
Sorenson A, Schaeffer P. Real-Time Temperature Sensing Using a Ratiometric Dual Fluorescent Protein Biosensor. Biosensors (Basel). 2023;13: pubmed publisher
Olmos Carre xf1 o C, Figueres O xf1 ate M, Scicolone G, L xf3 pez Mascaraque L. Cell Fate of Retinal Progenitor Cells: In Ovo UbC-StarTrack Analysis. Int J Mol Sci. 2022;23: pubmed publisher
Torrens Mas M, Perell xf3 Reus C, Trias Ferrer N, Ibarg xfc en Gonz xe1 lez L, Cresp xed C, Galmes Panades A, et al. GDF15 and ACE2 stratify COVID-19 patients according to severity while ACE2 mutations increase infection susceptibility. Front Cell Infect Microbiol. 2022;12:942951 pubmed publisher
Callegari I, Schneider M, Berloffa G, Mühlethaler T, Holdermann S, Galli E, et al. Potent neutralization by monoclonal human IgM against SARS-CoV-2 is impaired by class switch. EMBO Rep. 2022;23:e53956 pubmed publisher
Keyes Scott N, Lajevardi A, Swade K, Brown M, Paluzzi J, Vogel K. The Peptide Hormone CNMa Influences Egg Production in the Mosquito Aedes aegypti. Insects. 2022;13: pubmed publisher
Ghosh S, Liu H, Yazdankhah M, Stepicheva N, Shang P, Vaidya T, et al. βA1-crystallin regulates glucose metabolism and mitochondrial function in mouse retinal astrocytes by modulating PTP1B activity. Commun Biol. 2021;4:248 pubmed publisher
Rocco D, Paluzzi J. Expression Profiling, Downstream Signaling, and Inter-subunit Interactions of GPA2/GPB5 in the Adult Mosquito Aedes aegypti. Front Endocrinol (Lausanne). 2020;11:158 pubmed publisher
Espino Saldaña A, Durán Ríos K, Olivares Hernandez E, Rodríguez Ortiz R, Arellano Carbajal F, Martinez Torres A. Temporal and spatial expression of zebrafish mctp genes and evaluation of frameshift alleles of mctp2b. Gene. 2020;738:144371 pubmed publisher
Haslinger D, Waltes R, Yousaf A, Lindlar S, Schneider I, Lim C, et al. Loss of the Chr16p11.2 ASD candidate gene QPRT leads to aberrant neuronal differentiation in the SH-SY5Y neuronal cell model. Mol Autism. 2018;9:56 pubmed publisher
Stanczyk P, Seidel M, White J, Viero C, George C, Zissimopoulos S, et al. Association of cardiac myosin-binding protein-C with the ryanodine receptor channel - putative retrograde regulation?. J Cell Sci. 2018;131: pubmed publisher
Mavuluri J, Beesetti S, Surabhi R, Kremerskothen J, Venkatraman G, Rayala S. Phosphorylation-Dependent Regulation of the DNA Damage Response of Adaptor Protein KIBRA in Cancer Cells. Mol Cell Biol. 2016;36:1354-65 pubmed publisher
Ullio C, Brunk U, Urani C, Melchioretto P, Bonelli G, Baccino F, et al. Autophagy of metallothioneins prevents TNF-induced oxidative stress and toxicity in hepatoma cells. Autophagy. 2015;11:2184-98 pubmed publisher
Kinoshita Y, Hori M, Taguchi M, Fukumoto S. Functional analysis of mutant FAM20C in Raine syndrome with FGF23-related hypophosphatemia. Bone. 2014;67:145-51 pubmed publisher

product information

Catalog Number :

30125

Product Name :

pcDNA3 mCherry LIC cloning vector (6B)

article :

doi
id	4218
pubmed_id

bacterial resistance :

Ampicillin

cloning :

backbone

pcDNA3

backbone_mutation

backbone_origin

backbone_size

6136

promoter

sequencing_primer_3

sequencing_primer_5

vector_types

Mammalian Expression

growth notes :

This is an empty LIC vector derived from pcDNA3. It adds an mCherry gene to the C-terminus of your protein of interest. mCherry has a excitation max of 587 nm and an emission max of 610 nm. To clone into this vector, add the following tags to your PCR primers: LIC vKoz Forward tag 5 -TACTTCCAATCCAATGCCACC(ATG) LIC vGFP Reverse tag 5 -CTCCCACTACCAATGCC Do NOT include a stop codon with your reverse primer. T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI. For more information, please see our website: http://qb3.berkeley.edu/qb3/macrolab/

growth strain :

Empty LIC vector; adds an mCherry gene to the C-terminus of your protein of interest.

origin :

pi :

alt_names

cloning

clone_method	Restriction Enzyme
cloning_site_3	LIC site vKoz/GFP
cloning_site_5	LIC site vKoz/GFP
promoter
sequencing_primer_3	mCherry reverse (5'gcaccttgaagcgcatgaact)
sequencing_primer_5	CMV F (5'cgcaaatgggcggtaggcgtg)
site_3_destroyed	1
site_5_destroyed	1

entrez_gene

genbank_ids

mutation

name

shRNA_sequence

size

species