This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pET His6 GFP TEV LIC cloning vector (1GFP)
catalog :
29663
citations: 23
Reference
Carlson D, Kowalewski M, Bodoor K, Lietzan A, Hughes P, Gooden D, et al. Targeting Borrelia burgdorferi HtpG with a berserker molecule, a strategy for anti-microbial development. Cell Chem Biol. 2023;: pubmed publisher
Landeros A, Wallace D, Rahi A, Magdongon C, Suraneni P, Amin M, et al. Nuclear lamin A-associated proteins are required for centromere assembly. bioRxiv. 2023;: pubmed publisher
Enders L, Siklos M, Borggr xe4 fe J, Gaussmann S, Koren A, Malik M, et al. Pharmacological perturbation of the phase-separating protein SMNDC1. Nat Commun. 2023;14:4504 pubmed publisher
Hamilton S, Shea D, Ibsen S, Brasino M. On-chip dielectrophoretic recovery and detection of a lactate sensing probiotic from model human saliva. Electrophoresis. 2023;44:442-449 pubmed publisher
Eaton S, Ronnebaum T, Roose B, Christianson D. Structural Basis of Substrate Promiscuity and Catalysis by the Reverse Prenyltransferase N-Dimethylallyl-l-tryptophan Synthase from Fusarium fujikuroi. Biochemistry. 2022;61:2025-2035 pubmed publisher
Wolff I, Hollis J, Wignall S. Acentrosomal spindle assembly and maintenance in Caenorhabditis elegans oocytes requires a kinesin-12 nonmotor microtubule interaction domain. Mol Biol Cell. 2022;33:ar71 pubmed publisher
Ebrahim N, Al Saihati H, Shaman A, Dessouky A, Farid A, Hussien N, et al. Bone marrow-derived mesenchymal stem cells combined with gonadotropin therapy restore postnatal oogenesis of chemo-ablated ovaries in rats via enhancing very small embryonic-like stem cells. Stem Cell Res Ther. 2021;12:517 pubmed publisher
Walinda E, Morimoto D, Sorada T, Iwai K, Sugase K. Expression, solubility monitoring, and purification of the co-folded LUBAC LTM domain by structure-guided tandem folding in autoinducing cultures. Protein Expr Purif. 2021;:105953 pubmed publisher
Ebrahim N, Dessouky A, Mostafa O, Hassouna A, Yousef M, Seleem Y, et al. Adipose mesenchymal stem cells combined with platelet-rich plasma accelerate diabetic wound healing by modulating the Notch pathway. Stem Cell Res Ther. 2021;12:392 pubmed publisher
Hambarde S, Tsai C, Pandita R, Bacolla A, Maitra A, Charaka V, et al. EXO5-DNA structure and BLM interactions direct DNA resection critical for ATR-dependent replication restart. Mol Cell. 2021;81:2989-3006.e9 pubmed publisher
Sell M, Alcorta D, Padilla A, Nollner D, Hasenkampf N, Lambert H, et al. Visualizing Borrelia burgdorferi Infection Using a Small-Molecule Imaging Probe. J Clin Microbiol. 2021;59:e0231320 pubmed publisher
Wirth R, Gao P, Nienhaus G, Sunbul M, Jäschke A. Confocal and Super-resolution Imaging of RNA in Live Bacteria Using a Fluorogenic Silicon Rhodamine-binding Aptamer. Bio Protoc. 2020;10:e3603 pubmed publisher
Popelka H, Reinhart E, Metur S, Leary K, Ragusa M, Klionsky D. Membrane Binding and Homodimerization of Atg16 Via Two Distinct Protein Regions is Essential for Autophagy in Yeast. J Mol Biol. 2021;433:166809 pubmed publisher
Lu S, Ye Q, Singh D, Cao Y, Diedrich J, Yates J, et al. The SARS-CoV-2 nucleocapsid phosphoprotein forms mutually exclusive condensates with RNA and the membrane-associated M protein. Nat Commun. 2021;12:502 pubmed publisher
Zemerov S, Roose B, Farenhem K, Zhao Z, Stringer M, Goldman A, et al. 129Xe NMR-Protein Sensor Reveals Cellular Ribose Concentration. Anal Chem. 2020;92:12817-12824 pubmed publisher
Steink xfc hler J, Knorr R, Zhao Z, Bhatia T, Bartelt S, Wegner S, et al. Controlled division of cell-sized vesicles by low densities of membrane-bound proteins. Nat Commun. 2020;11:905 pubmed publisher
Sharma H, Anand B. Ribosome assembly defects subvert initiation Factor3 mediated scrutiny of bona fide start signal. Nucleic Acids Res. 2019;47:11368-11386 pubmed publisher
Acharya S, Mishra A, Paul D, Ansari A, Azhar M, Kumar M, et al. Francisella novicida Cas9 interrogates genomic DNA with very high specificity and can be used for mammalian genome editing. Proc Natl Acad Sci U S A. 2019;116:20959-20968 pubmed publisher
Parker M, Bell M, Mir M, Kao J, Darzacq X, Botchan M, et al. A new class of disordered elements controls DNA replication through initiator self-assembly. elife. 2019;8: pubmed publisher
Sharma M, Tyagi J, Poluri K. Quantifying bacterial cell lysis using GFP based fluorimetric assay. Int J Biol Macromol. 2019;138:881-889 pubmed publisher
Zhang Y, Song G, Lal N, Nagalakshmi U, Li Y, Zheng W, et al. TurboID-based proximity labeling reveals that UBR7 is a regulator of N NLR immune receptor-mediated immunity. Nat Commun. 2019;10:3252 pubmed publisher
Weiss M, Frohnmayer J, Benk L, Haller B, Janiesch J, Heitkamp T, et al. Sequential bottom-up assembly of mechanically stabilized synthetic cells by microfluidics. Nat Mater. 2018;17:89-96 pubmed publisher
Rahmani K, Dean D. Leptomycin B alters the subcellular distribution of CRM1 (Exportin 1). Biochem Biophys Res Commun. 2017;488:253-258 pubmed publisher
product information
Catalog Number :
29663
Product Name :
pET His6 GFP TEV LIC cloning vector (1GFP)
article :
doi
id4179
pubmed_id
bacterial resistance :
Kanamycin
cloning :
backbonepET
backbone_mutationThe GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.
backbone_origin
backbone_size6075
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth notes :
This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/macrolab/
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3LIC tag
cloning_site_5LIC tag
promoter
sequencing_primer_3T7 reverse
sequencing_primer_5GFP forward (5'cagctcgccgaccacta)
site_3_destroyed1
site_5_destroyed1
entrez_gene
genbank_ids
mutation
name
shRNA_sequence
size
species
tags
locationN terminal on backbone
tagHis6-GFP-TEV
resistance markers :
956
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA