This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCXLE-hOCT3/4-shp53-F
catalog :
27077
citations: 232
Reference
Lau H, Krentz N, Abaitua F, Perez Alcantara M, Chan J, Ajeian J, et al. PAX4 loss of function increases diabetes risk by altering human pancreatic endocrine cell development. Nat Commun. 2023;14:6119 pubmed publisher
Saito Y, Nose N, Iida T, Akazawa K, Kanno T, Fujimoto Y, et al. In vivo tracking transplanted cardiomyocytes derived from human induced pluripotent stem cells using nuclear medicine imaging. Front Cardiovasc Med. 2023;10:1261330 pubmed publisher
Rani S, Thamodaran V, Nandy K, Fouzia N, Maddali M, Rajesh P, et al. Establishment and characterization of CSCRi006-A: an induced pluripotent stem cell line generated from a patient with Diamond-Blackfan Anemia (DBA) carrying ribosomal protein S19 (RPS19) mutation. Hum Cell. 2023;36:2204-2213 pubmed publisher
Arber C, Casey J, Crawford S, Rambarack N, Yaman U, Wiethoff S, et al. Microglia produce the amyloidogenic ABri peptide in familial British dementia. bioRxiv. 2023;: pubmed publisher
Guo L, Salian S, Xue J, Rath N, Rousseau J, Kim H, et al. Null and missense mutations of ERI1 cause a recessive phenotypic dichotomy in humans. Am J Hum Genet. 2023;110:1068-1085 pubmed publisher
Liu Y, Cafiero T, Park D, Biswas A, Winer B, Cho C, et al. Targeted viral adaptation generates a simian-tropic hepatitis B virus that infects marmoset cells. Nat Commun. 2023;14:3582 pubmed publisher
Naama M, Rahamim M, Zayat V, Sebban S, Radwan A, Orzech D, et al. Pluripotency-independent induction of human trophoblast stem cells from fibroblasts. Nat Commun. 2023;14:3359 pubmed publisher
Cheung W, Johnson A, Rowell W, Farrow E, Hall R, Cohen A, et al. Direct haplotype-resolved 5-base HiFi sequencing for genome-wide profiling of hypermethylation outliers in a rare disease cohort. Nat Commun. 2023;14:3090 pubmed publisher
Hedges E, Cocks G, Shaw C, Nishimura A. Generation of an Open-Access Patient-Derived iPSC Biobank for Amyotrophic Lateral Sclerosis Disease Modelling. Genes (Basel). 2023;14: pubmed publisher
Patlolla N, Ponnachan P, Jamora C, Abbey D. Generation of control human iPSC line INSTEMi001-A from PBMCs of a healthy Indian donor. Stem Cell Res. 2023;69:103112 pubmed publisher
Penttinen K, Prajapati C, Shah D, Rajan D, Cherian R, Swan H, et al. HiPSC-derived cardiomyocyte to model Brugada syndrome: both asymptomatic and symptomatic mutation carriers reveal increased arrhythmogenicity. BMC Cardiovasc Disord. 2023;23:208 pubmed publisher
Perdig xe3 o P, Ollington B, Sai H, Leung A, Sacristán Reviriego A, van der Spuy J. Retinal Organoids from an AIPL1 CRISPR/Cas9 Knockout Cell Line Successfully Recapitulate the Molecular Features of LCA4 Disease. Int J Mol Sci. 2023;24: pubmed publisher
Cao R, Lv Y, Lu G, Liu H, Wang W, Tan C, et al. Extracellular vesicles from iPSC-MSCs alleviate chemotherapy-induced mouse ovarian damage via the ILK-PI3K/AKT pathway. Zool Res. 2023;44:620-635 pubmed publisher
Gopurappilly R, Musthafa T, Sukumaran S, Viswanath B, Hasan G. Generation of feeder-independent transgene-free iPSC lines from a young-onset Parkinson's disease (YOPD) patient with a homozygous PLA2G6: c.2222G>A (p. Arg741Gln) mutation (NCBSi003-A) and unaffected heterozygous parent (NCBSi004-A). Stem Cell Res. 2023;67:103033 pubmed publisher
Wongkummool W, Tong Ngam P, Munkongdee T, Tangprasittipap A, Paiboonsukwong K, Hongeng S, et al. Generation of human induced pluripotent stem cell line (MUi034-A) from an unusual case of hydrops fetalis associated with homozygous hemoglobin Constant Spring. Stem Cell Res. 2022;65:102979 pubmed publisher
Xu J, Fang S, Deng S, Li H, Lin X, Huang Y, et al. Generation of neural organoids for spinal-cord regeneration via the direct reprogramming of human astrocytes. Nat Biomed Eng. 2022;: pubmed publisher
Florentino R, Morita K, Haep N, Motomura T, Díaz Aragon R, Faccioli L, et al. Biofabrication of synthetic human liver tissue with advanced programmable functions. iScience. 2022;25:105503 pubmed publisher
Pongpaksupasin P, Wongkummool W, Tong Ngam P, Jearawiriyapaisarn N, Paiboonsukwong K, Sangkitporn S, et al. A generation of human-induced pluripotent stem cell line (MUi032-A) from a Choroideremia disease patient carrying a hemizygous mutation on the CHM gene. Stem Cell Res. 2022;65:102964 pubmed publisher
Tian H, Chen Z, Zhu X, Ou Q, Wang Z, Wu B, et al. Induced retinal pigment epithelial cells with anti-epithelial-to-mesenchymal transition ability delay retinal degeneration. iScience. 2022;25:105050 pubmed publisher
Regha K, Bhargava M, Al Mubaarak A, Chai C, Parikh B, Liu Z, et al. Customized strategies for high-yield purification of retinal pigment epithelial cells differentiated from different stem cell sources. Sci Rep. 2022;12:15563 pubmed publisher
Song L, Bekdash R, Morikawa K, Quejada J, Klein A, Aina Badejo D, et al. Sigma non-opioid receptor 1 is a potential therapeutic target for long QT syndrome. Nat Cardiovasc Res. 2022;1:142-156 pubmed publisher
Perriot S, Canales M, Mathias A, Du Pasquier R. Generation of transgene-free human induced pluripotent stem cells from erythroblasts in feeder-free conditions. STAR Protoc. 2022;3:101620 pubmed publisher
Pearson G, Song C, Hohmann S, Prokhorova T, Sheldrick Michel T, Kn xf6 pfel T. DNA Methylation Profiles of GAD1 in Human Cerebral Organoids of Autism Indicate Disrupted Epigenetic Regulation during Early Development. Int J Mol Sci. 2022;23: pubmed publisher
Oliveira A, Martins S, Cammarata G, Martins M, Cardoso A, Almeida M, et al. Generation and Characterization of Novel iPSC Lines from a Portuguese Family Bearing Heterozygous and Homozygous GRN Mutations. Biomedicines. 2022;10: pubmed publisher
Eintracht J, Harding P, Lima Cunha D, Moosajee M. Efficient embryoid-based method to improve generation of optic vesicles from human induced pluripotent stem cells. F1000Res. 2022;11:324 pubmed publisher
D Anzi A, Perciballi E, Ruotolo G, Ferrari D, Notaro A, Lombardi I, et al. Production of CSSi013-A (9360) iPSC line from an asymptomatic subject carrying an heterozygous mutation in TDP-43 protein. Stem Cell Res. 2022;63:102835 pubmed publisher
Rosebrock D, Arora S, Mutukula N, Volkman R, Gralinska E, Balaskas A, et al. Enhanced cortical neural stem cell identity through short SMAD and WNT inhibition in human cerebral organoids facilitates emergence of outer radial glial cells. Nat Cell Biol. 2022;24:981-995 pubmed publisher
Wakita S, Hara M, Kitabatake Y, Kawatani K, Kurahashi H, Hashizume R. Experimental method for haplotype phasing across the entire length of chromosome 21 in trisomy 21 cells using a chromosome elimination technique. J Hum Genet. 2022;: pubmed publisher
Linn A, Maneepitasut W, Tubsuwan A, Kitiyanant N, Phakdeekitcharoen B, Borwornpinyo S, et al. Establishment and Characterization of MUi027-A: A Novel Patient-Derived Cell Line of Polycystic Kidney Disease with PKD1 Mutation. J Pers Med. 2022;12: pubmed publisher
Giffin Rao Y, Sheng J, Strand B, Xu K, Huang L, Medo M, et al. Altered patterning of trisomy 21 interneuron progenitors. Stem Cell Reports. 2022;17:1366-1379 pubmed publisher
Scrima R, Agriesti F, Pacelli C, Piccoli C, Pucci P, Amoresano A, et al. Myoglobin expression by alternative transcript in different mesenchymal stem cells compartments. Stem Cell Res Ther. 2022;13:209 pubmed publisher
Molugu K, Battistini G, Heaster T, Rouw J, Guzman E, Skala M, et al. Label-Free Imaging to Track Reprogramming of Human Somatic Cells. GEN Biotechnol. 2022;1:176-191 pubmed publisher
Ejlersen M, Ilieva M, Michel T. Superoxide dismutase isozymes in cerebral organoids from autism spectrum disorder patients. J Neural Transm (Vienna). 2022;129:617-626 pubmed publisher
Yu Y, Shen H, Zhu J, Cao X, Li Q, Shao L, et al. Generation of Marfan patient specific iPSCs (ICSSUi001-A) carrying a novel heterozygous mutation in FBN1 gene. Stem Cell Res. 2022;60:102720 pubmed publisher
Martinez Moreno R, Pérez Serra A, Carreras D, Aran B, Kuebler B, Brugada R, et al. Generation of an induced pluripotent stem cell line from a healthy Caucasian male. Stem Cell Res. 2022;60:102717 pubmed publisher
Pornsukjantra T, Kangboonruang K, Tong Ngam P, Tim Aroon T, Wattanasirichaigoon D, Anurathapan U, et al. A generation of human induced pluripotent stem cell line (MUi031-A) from a type-3 Gaucher disease patient carrying homozygous mutation on GBA1 gene. Stem Cell Res. 2022;60:102698 pubmed publisher
LaForce G, Farr J, Liu J, Akesson C, Gumus E, Pinkard O, et al. Suppression of premature transcription termination leads to reduced mRNA isoform diversity and neurodegeneration. Neuron. 2022;110:1340-1357.e7 pubmed publisher
Chumchuen S, Satirapod C, Tangprasittipap A, Hongeng S. Establishment of human induced pluripotent stem cell line MUi028-A from normal fetal skin fibroblasts. Stem Cell Res. 2022;60:102675 pubmed publisher
Guo Z, Tong C, Jack xf3 w J, Doucet Y, Abaci H, Zeng W, et al. Engineering human skin model innervated with itch sensory neuron-like cells differentiated from induced pluripotent stem cells. Bioeng Transl Med. 2022;7:e10247 pubmed publisher
Sokka J, Yoshihara M, Kvist J, Laiho L, Warren A, Stadelmann C, et al. CRISPR activation enables high-fidelity reprogramming into human pluripotent stem cells. Stem Cell Reports. 2022;17:413-426 pubmed publisher
Nash B, Loi T, Fernando M, Sabri A, Robinson J, Cheng A, et al. Evaluation for Retinal Therapy for RPE65 Variation Assessed in hiPSC Retinal Pigment Epithelial Cells. Stem Cells Int. 2021;2021:4536382 pubmed publisher
Jalil S, Keskinen T, Maldonado R, Sokka J, Trokovic R, Otonkoski T, et al. Simultaneous high-efficiency base editing and reprogramming of patient fibroblasts. Stem Cell Reports. 2021;16:3064-3075 pubmed publisher
Choi N, Lee Y, Park Y, Ko K, Park B, Koh Y. Establishment of an integration-free human induced pluripotent stem cell line (TJCi001-A) from normal bone marrow-derived mesenchymal stem cells. Stem Cell Res. 2021;55:102484 pubmed publisher
Klaihmon P, Luanpitpong S, Lorthongpanich C, Laowtammathron C, Waeteekul S, Terbto P, et al. Episomal vector reprogramming of human umbilical cord blood natural killer cells to an induced pluripotent stem cell line MUSIi013-A. Stem Cell Res. 2021;55:102472 pubmed publisher
Martins S, Hacheney I, Teichweyde N, Hildebrandt B, Krutmann J, Rossi A. Generation of an induced pluripotent stem cell line (IUFi001) from a Cockayne syndrome patient carrying a mutation in the ERCC6 gene. Stem Cell Res. 2021;55:102456 pubmed publisher
Laberthonnière C, Novoa Del Toro E, Chevalier R, Broucqsault N, Rao V, Trani J, et al. AKT Signaling Modifies the Balance between Cell Proliferation and Migration in Neural Crest Cells from Patients Affected with Bosma Arhinia and Microphthalmia Syndrome. Biomedicines. 2021;9: pubmed publisher
Yoshimatsu S, Qian E, Sato T, Yamamoto M, Ishikawa M, Okano H. Establishing an induced pluripotent stem cell line from neonatal common marmoset fibroblasts by an all-in-one episomal vector approach. Stem Cell Res. 2021;53:102380 pubmed publisher
D Anzi A, Altieri F, Perciballi E, Ferrari D, Torres B, Bernardini L, et al. Generation of an induced pluripotent stem cell line (CSS012-A (7672)) carrying the p.G376D heterozygous mutation in the TARDBP protein. Stem Cell Res. 2021;53:102356 pubmed publisher
Mullegama S, Klein S, Williams S, Innis J, Probst F, Haldeman Englert C, et al. Transcriptome analysis of MBD5-associated neurodevelopmental disorder (MAND) neural progenitor cells reveals dysregulation of autism-associated genes. Sci Rep. 2021;11:11295 pubmed publisher
Low B, Lim C, Ding S, Tan Y, Ng N, Krishnan V, et al. Decreased GLUT2 and glucose uptake contribute to insulin secretion defects in MODY3/HNF1A hiPSC-derived mutant β cells. Nat Commun. 2021;12:3133 pubmed publisher
Ghila L, Legøy T, Mathisen A, Abadpour S, Paulo J, Scholz H, et al. Chronically Elevated Exogenous Glucose Elicits Antipodal Effects on the Proteome Signature of Differentiating Human iPSC-Derived Pancreatic Progenitors. Int J Mol Sci. 2021;22: pubmed publisher
Kumar M, Wadhwa S, Tyagi N, Ahmad I, Kumar S, Sagar S, et al. Generation of induced pluripotent stem cell line (IGIBi007-A) from a patient with a novel acromesomelic dysplasia, PRKG2 type (AMDP). Stem Cell Res. 2021;53:102340 pubmed publisher
Ribeiro J, Procyk C, West E, O Hara Wright M, Martins M, Khorasani M, et al. Restoration of visual function in advanced disease after transplantation of purified human pluripotent stem cell-derived cone photoreceptors. Cell Rep. 2021;35:109022 pubmed publisher
Ma Y, Wang Z, Gao M, Liu X, Sun W, Gong Y, et al. Generation of two induced pluripotent stem cell lines from patients with X-linked Alport syndrome. Stem Cell Res. 2021;53:102343 pubmed publisher
Maneepitasut W, Wongkummool W, Tong Ngam P, Promthep K, Tubsuwan A, Khine Linn A, et al. Generation of human induced pluripotent stem cell line (MUi026-A) from a patient with autosomal dominant polycystic kidney disease carrying PKD1 point mutation. Stem Cell Res. 2021;53:102306 pubmed publisher
Manian K, Galloway C, Dalvi S, Emanuel A, Mereness J, Black W, et al. 3D iPSC modeling of the retinal pigment epithelium-choriocapillaris complex identifies factors involved in the pathology of macular degeneration. Cell Stem Cell. 2021;28:846-862.e8 pubmed publisher
Wen J, He C, Feng Y, Song J, Liu J, Liu X, et al. Establishment of an iPSC line (CSUXHi004-A) from a patient with Waardenburg syndrome type I caused by a PAX3 splice mutation. Stem Cell Res. 2021;53:102300 pubmed publisher
Konala V, Nandakumar S, Surendran H, Pal R. Derivation of Induced Pluripotent Stem Cell (iPSC) Lines from Patient-Specific Peripheral Blood Mononuclear Cells (PBMC) Using Episomal Vectors. Methods Mol Biol. 2021;: pubmed publisher
Li X, Mou Y, Milton C, Chen Z. Monitoring Axonal Degeneration in Human Pluripotent Stem Cell Models of Hereditary Spastic Paraplegias. Methods Mol Biol. 2021;: pubmed publisher
Hedges E, Topp S, Shaw C, Nishimura A. Generation of six induced pluripotent stem cell lines from patients with amyotrophic lateral sclerosis with associated genetic mutations in either FUS or ANXA11. Stem Cell Res. 2021;52:102246 pubmed publisher
Tangprasittipap A, Chumchuen S, Pornratananont G, Kitiyanant N, Hongeng S. Generation of a human induced pluripotent stem cells (MUi015-A) from skin fibroblast of retinoblastoma patient with 13q deletion syndrome. Stem Cell Res. 2021;52:102211 pubmed publisher
Tang C, Han J, Dalvi S, Manian K, Winschel L, Volland S, et al. A human model of Batten disease shows role of CLN3 in phagocytosis at the photoreceptor-RPE interface. Commun Biol. 2021;4:161 pubmed publisher
Kamand M, Forsberg S, Thomassen M, Ilieva M, Meyer M, Svenningsen A, et al. Establishment of an induced pluripotent stem (iPS) cell line (SDUKIi006-A) from a 21-year old male patient diagnosed with atypical autism disorder. Stem Cell Res. 2021;51:102185 pubmed publisher
Rabinski T, Sagiv S, Hausman Kedem M, Fattal Valevski A, Rubinstein M, Avraham K, et al. Reprogramming of two induced pluripotent stem cell lines from a heterozygous GRIN2D developmental and epileptic encephalopathy (DEE) patient (BGUi011-A) and from a healthy family relative (BGUi012-A). Stem Cell Res. 2021;51:102178 pubmed publisher
Wen J, Song J, He C, Ling J, Liu Y, Chen H, et al. Establishment of an iPSC line (CSUXHi003-A) from a patient with Waardenburg syndrome type Ⅱ caused by a MITF mutation. Stem Cell Res. 2021;51:102157 pubmed publisher
Cui Y, Wang J, Zhang G, Luan J, Han J. Generation of an induced pluripotent stem cell line SMBCi010-A from a male with Multiple Osteochondroma carrying a EXT1 mutation. Stem Cell Res. 2020;50:102111 pubmed publisher
Ji X, Tang Q, Tang C, Wu Z, Ma L, Guo X, et al. Generation of an induced pluripotent stem cell line from an Alström Syndrome patient with ALMS1 mutation (c.3902C > A, c.6436C > T) and a gene correction isogenic iPSC line. Stem Cell Res. 2020;49:102089 pubmed publisher
Febbraro F, Chen M, Denham M. Generation of Human iPSCs by Episomal Reprogramming of Skin Fibroblasts and Peripheral Blood Mononuclear Cells. Methods Mol Biol. 2021;2239:135-151 pubmed publisher
Roth J, Muench K, Asokan A, Mallett V, Gai H, Verma Y, et al. 16p11.2 microdeletion imparts transcriptional alterations in human iPSC-derived models of early neural development. elife. 2020;9: pubmed publisher
Ahn L, Coatti G, Liu J, Gumus E, Schaffer A, Miranda H. An epilepsy-associated ACTL6B variant captures neuronal hyperexcitability in a human induced pluripotent stem cell model. J Neurosci Res. 2021;99:110-123 pubmed publisher
Kamand M, Ilieva M, Forsberg S, Thomassen M, Svenningsen A, Meyer M, et al. Generation of autism spectrum disorder patient-derived iPSC line SDUKIi004-A. Stem Cell Res. 2020;49:102038 pubmed publisher
Kamand M, Ilieva M, Louise Forsberg S, Thomassen M, Meyer M, Fex Svenningsen A, et al. Derivation of induced pluripotent stem cells (SDUKIi003-A) from a 20-year-old male patient diagnosed with Asperger syndrome. Stem Cell Res. 2020;48:101974 pubmed publisher
Zlotnik D, Rabinski T, Ofir R, Hershkovitz E, Vatine G. Generation of iPSC lines from two (BGUi002-A and BGUi003-A) homozygous p450 oxidoreductase-deficient patients and from one (BGUi001-A) heterozygous healthy family relative. Stem Cell Res. 2020;48:101975 pubmed publisher
Wang K, Lin R, Hong X, Ng A, Lee C, Neumeyer J, et al. Robust differentiation of human pluripotent stem cells into endothelial cells via temporal modulation of ETV2 with modified mRNA. Sci Adv. 2020;6:eaba7606 pubmed publisher
Falik D, Rabinski T, Zlotnik D, Eshel R, Zorsky M, Garin Shkolnik T, et al. Generation and characterization of iPSC lines (BGUi004-A, BGUi005-A) from two identical twins with polyalanine expansion in the paired-like homeobox 2B (PHOX2B) gene. Stem Cell Res. 2020;48:101955 pubmed publisher
Lee M, Choi N, Park S, Bang J, Lee Y, Jeong D, et al. Generation of OCT4-EGFP, NANOG-tdTomato dual reporter human induced pluripotent stem cell line, KKUi001-A, using the CRISPR/Cas9 system. Stem Cell Res. 2020;48:101943 pubmed publisher
Amaral M, Goulart E, Caires Júnior L, Morales Vicente D, Soares Schanoski A, Gomes R, et al. Differential gene expression elicited by ZIKV infection in trophoblasts from congenital Zika syndrome discordant twins. PLoS Negl Trop Dis. 2020;14:e0008424 pubmed publisher
Ibrahim M, Medhat W, El Fakahany H, Abdel Raouf H, Snyder E. Deriving Keratinocyte Progenitor Cells and Keratinocytes from Human-Induced Pluripotent Stem Cells. Curr Protoc Stem Cell Biol. 2020;54:e119 pubmed publisher
D Anzi A, Altieri F, Perciballi E, Ferrari D, Bernardini L, Goldoni M, et al. Generation of an induced pluripotent stem cell line, CSSi011-A (6534), from an Amyotrophic lateral sclerosis patient with heterozygous L145F mutation in SOD1 gene. Stem Cell Res. 2020;47:101924 pubmed publisher
Geisinger J, Stearns T. CRISPR/Cas9 treatment causes extended TP53-dependent cell cycle arrest in human cells. Nucleic Acids Res. 2020;48:9067-9081 pubmed publisher
Klofas L, Short B, Snow J, Sinnaeve J, Rushing G, Westlake G, et al. DEPDC5 haploinsufficiency drives increased mTORC1 signaling and abnormal morphology in human iPSC-derived cortical neurons. Neurobiol Dis. 2020;143:104975 pubmed publisher
Grzela D, Marciniak B, Pulaski L. Characterization of an induced pluripotent stem cell line (IMBPASi001-A) derived from fibroblasts of a patient affected by Wolfram Syndrome. Stem Cell Res. 2020;46:101858 pubmed publisher
Dang L, Glanowska K, Iffland Ii P, Barnes A, Baybis M, Liu Y, et al. Multimodal Analysis of STRADA Function in Brain Development. Front Cell Neurosci. 2020;14:122 pubmed publisher
Toombs J, Panther L, Ornelas L, Liu C, Gomez E, Martín Ibáñez R, et al. Generation of twenty four induced pluripotent stem cell lines from twenty four members of the Lothian Birth Cohort 1936. Stem Cell Res. 2020;46:101851 pubmed publisher
Kamand M, Ilieva M, Forsberg S, Thomassen M, Fex Svenningsen A, Holst B, et al. Generation of human induced pluripotent stem cells (SDUKIi002-A) from a 22-year-old male diagnosed with autism spectrum disorder. Stem Cell Res. 2020;46:101834 pubmed publisher
Sawada T, Benjamin K, Brandtjen A, Tietze E, Allen S, Paquola A, et al. Generation of four postmortem dura-derived iPS cell lines from four control individuals with genotypic and brain-region-specific transcriptomic data available through the BrainSEQ consortium. Stem Cell Res. 2020;46:101806 pubmed publisher
Norbnop P, Ingrungruanglert P, Israsena N, Suphapeetiporn K, Shotelersuk V. Generation and characterization of HLA-universal platelets derived from induced pluripotent stem cells. Sci Rep. 2020;10:8472 pubmed publisher
Snow J, Westlake G, Klofas L, Jeon S, Armstrong L, Swoboda K, et al. Neuronal modeling of alternating hemiplegia of childhood reveals transcriptional compensation and replicates a trigger-induced phenotype. Neurobiol Dis. 2020;141:104881 pubmed publisher
Hübscher D, Rebs S, Maurer W, Ghadri J, Dressel R, Templin C, et al. Generation of iPSC-lines from two independent Takotsubo syndrome patients with recurrent Takotsubo events. Stem Cell Res. 2020;44:101746 pubmed publisher
Konala V, Nandakumar S, Battu R, Pal R. Derivation of three induced pluripotent stem cell lines under feeder-free culture conditions from peripheral blood mononuclear cells (PBMC) of Indian patients suffering from inherited retinal diseases carrying different mutations. Stem Cell Res. 2020;45:101757 pubmed publisher
He S, Hu J, Zheng Z, Wang J, Chen J, Zhang C, et al. Establishment of an induced pluripotent stem cell line from a patient with CHARGE syndrome carrying a CHD7 (p.L1151Gfs*17) mutation. Stem Cell Res. 2020;45:101774 pubmed publisher
Ahmed T, Shousha W, Abdo S, Mohamed I, El Badri N. Human Adipose-Derived Pericytes: Biological Characterization and Reprogramming into Induced Pluripotent Stem Cells. Cell Physiol Biochem. 2020;54:271-286 pubmed publisher
Wang P, Wang J, Xing Y, Wang H, Yu D, Feng Y, et al. Establishment of an iPSC line (JTUi002-A) from a patient with Waardenburg syndrome caused by a SOX10 mutation and carrying a GJB2 mutation. Stem Cell Res. 2020;44:101756 pubmed publisher
Legøy T, Mathisen A, Salim Z, Vethe H, Bjørlykke Y, Abadpour S, et al. In vivo Environment Swiftly Restricts Human Pancreatic Progenitors Toward Mono-Hormonal Identity via a HNF1A/HNF4A Mechanism. Front Cell Dev Biol. 2020;8:109 pubmed publisher
Kitajima R, Nakai R, Imamura T, Kameda T, Kozuka D, Hirai H, et al. Modeling of early neural development in vitro by direct neurosphere formation culture of chimpanzee induced pluripotent stem cells. Stem Cell Res. 2020;44:101749 pubmed publisher
Mong E, Yang Y, Akat K, Canfield J, VanWye J, Lockhart J, et al. Chromosome 19 microRNA cluster enhances cell reprogramming by inhibiting epithelial-to-mesenchymal transition. Sci Rep. 2020;10:3029 pubmed publisher
Jin P, Wang S, Jiang X, Shan X, Jiang S, Quan Y, et al. Generation of human induced pluripotent stem cell line (WMUi001-A) from a patient with aortic dissection. Stem Cell Res. 2020;43:101730 pubmed publisher
Wang J, Cui Y, Xing K, Luan J, Han J. Generation and characterization of a human iPSC line derived from congenital clubfoot amniotic fluid cells. Stem Cell Res. 2020;43:101712 pubmed publisher
Wages P, Joshi P, Tallman K, Kim H, Bowman A, Porter N. Screening ToxCast™ for Chemicals That Affect Cholesterol Biosynthesis: Studies in Cell Culture and Human Induced Pluripotent Stem Cell-Derived Neuroprogenitors. Environ Health Perspect. 2020;128:17014 pubmed publisher
Piers T, Cosker K, Mallach A, Johnson G, Guerreiro R, Hardy J, et al. A locked immunometabolic switch underlies TREM2 R47H loss of function in human iPSC-derived microglia. FASEB J. 2020;34:2436-2450 pubmed publisher
Bjørlykke Y, Søviknes A, Hoareau L, Vethe H, Mathisen A, Chera S, et al. Reprogrammed Cells Display Distinct Proteomic Signatures Associated with Colony Morphology Variability. Stem Cells Int. 2019;2019:8036035 pubmed publisher
Chen M, Maimaitili M, Buchholdt S, Jensen U, Febbraro F, Denham M. Generation of eight human induced pluripotent stem cell lines from Parkinson's disease patients carrying familial mutations. Stem Cell Res. 2019;42:101657 pubmed publisher
Liu G, David B, Trawczynski M, Fessler R. Advances in Pluripotent Stem Cells: History, Mechanisms, Technologies, and Applications. Stem Cell Rev Rep. 2019;: pubmed publisher
Hey C, Larsen L, Tumer Z, Brøndum Nielsen K, Grønskov K, Hjortshøj T, et al. Generation and characterization of three isogenic induced pluripotent stem cell lines from a patient with Bardet-Biedl syndrome and homozygous for the BBS5 variant. Stem Cell Res. 2019;41:101594 pubmed publisher
Martins G, Paredes B, Sampaio G, Nonaka C, da Silva K, Allahdadi K, et al. Generation of human iPS cell line CBTCi001-A from dermal fibroblasts obtained from a healthy donor. Stem Cell Res. 2019;41:101630 pubmed publisher
Molugu K, Harkness T, Carlson Stevermer J, Prestil R, Piscopo N, Seymour S, et al. Tracking and Predicting Human Somatic Cell Reprogramming Using Nuclear Characteristics. Biophys J. 2019;: pubmed publisher
Bidollari E, Rotundo G, Altieri F, Amicucci M, Wiquel D, Ferrari D, et al. Generation of induced pluripotent stem cell line CSSi008-A (4698) from a patient affected by advanced stage of Dentato-Rubral-Pallidoluysian atrophy (DRPLA). Stem Cell Res. 2019;40:101551 pubmed publisher
Tang C, Lu C, Ji X, Ma L, Zhou Q, Xiong M, et al. Generation of two induced pluripotent stem cell (iPSC) lines from human breast milk using episomal reprogramming system. Stem Cell Res. 2019;39:101511 pubmed publisher
Suzuki K, Koyanagi Aoi M, Uehara K, Hinata N, Fujisawa M, Aoi T. Directed differentiation of human induced pluripotent stem cells into mature stratified bladder urothelium. Sci Rep. 2019;9:10506 pubmed publisher
Low J, Li P, Chew E, Zhou B, Suzuki K, Zhang T, et al. Generation of Human PSC-Derived Kidney Organoids with Patterned Nephron Segments and a De Novo Vascular Network. Cell Stem Cell. 2019;25:373-387.e9 pubmed publisher
Arber C, Toombs J, Lovejoy C, Ryan N, Paterson R, Willumsen N, et al. Familial Alzheimer's disease patient-derived neurons reveal distinct mutation-specific effects on amyloid beta. Mol Psychiatry. 2019;: pubmed publisher
Yin Y, Petersen A, Soref C, Richards W, Ludwig T, Taapken S, et al. Generation of seven induced pluripotent stem cell lines from neonates of different ethnic backgrounds. Stem Cell Res. 2019;34:101365 pubmed publisher
Najar A, Sneha K, Ashok A, Babu S, Subramaniam A, Kannan R, et al. Derivation of iPSC lines from two patients with familial Alzheimer's disease from India. Stem Cell Res. 2019;34:101370 pubmed publisher
Dai S, Shen T, Zheng T, Pu J, Chen X. Plasmid-based generation of neural cells from human fibroblasts using non-integrating episomal vectors. Neural Regen Res. 2019;14:501-505 pubmed publisher
Lo Sardo V, Chubukov P, Ferguson W, Kumar A, Teng E, Duran M, et al. Unveiling the Role of the Most Impactful Cardiovascular Risk Locus through Haplotype Editing. Cell. 2018;175:1796-1810.e20 pubmed publisher
Moro L, Amin G, Furmento V, Waisman A, Garate X, Neiman G, et al. MicroRNA characterization in equine induced pluripotent stem cells. PLoS ONE. 2018;13:e0207074 pubmed publisher
Jaffer S, Goh P, Abbasian M, Nathwani A. Mbd3 Promotes Reprogramming of Primary Human Fibroblasts. Int J Stem Cells. 2018;11:235-241 pubmed publisher
Bang J, Choi N, Lee M, Ko K, Lee H, Park Y, et al. Optimization of episomal reprogramming for generation of human induced pluripotent stem cells from fibroblasts. Anim Cells Syst (Seoul). 2018;22:132-139 pubmed publisher
Zahid M, Feldman K, Garcia Borrero G, Feinstein T, Pogodzinski N, Xu X, et al. Cardiac Targeting Peptide, a Novel Cardiac Vector: Studies in Bio-Distribution, Imaging Application, and Mechanism of Transduction. Biomolecules. 2018;8: pubmed publisher
Lin H, Li Q, Du Q, Wang O, Wang Z, Akert L, et al. Integrated generation of induced pluripotent stem cells in a low-cost device. Biomaterials. 2018;189:23-36 pubmed publisher
Tandon R, Brändl B, Baryshnikova N, Landshammer A, Steenpaß L, Keminer O, et al. Generation of two human isogenic iPSC lines from fetal dermal fibroblasts. Stem Cell Res. 2018;33:120-124 pubmed publisher
Tidball A, Swaminathan P, Dang L, Parent J. Generating Loss-of-function iPSC Lines with Combined CRISPR Indel Formation and Reprogramming from Human Fibroblasts. Bio Protoc. 2018;8: pubmed publisher
Tebbenkamp A, Varela L, Choi J, Paredes M, Giani A, Song J, et al. The 7q11.23 Protein DNAJC30 Interacts with ATP Synthase and Links Mitochondria to Brain Development. Cell. 2018;175:1088-1104.e23 pubmed publisher
Hey C, Saltõkowa K, Larsen L, Tumer Z, Brøndum Nielsen K, Grønskov K, et al. Generation of induced pluripotent stem cells, KCi002-A derived from a patient with Bardet-Biedl syndrome homozygous for the BBS10 variant c.271insT. Stem Cell Res. 2018;33:46-50 pubmed publisher
Neureiter A, Brändl B, Hiber M, Tandon R, Muller F, Steenpass L. Generation of an iPSC line of a patient with Angelman syndrome due to an imprinting defect. Stem Cell Res. 2018;33:20-24 pubmed publisher
Martins G, Paredes B, Azevedo C, Sampaio G, Nonaka C, Cavalcante B, et al. Generation of integration-free iPS cell lines from three sickle cell disease patients from the state of Bahia, Brazil. Stem Cell Res. 2018;33:10-14 pubmed publisher
Shang Z, Chen D, Wang Q, Wang S, Deng Q, Wu L, et al. Single-cell RNA-seq reveals dynamic transcriptome profiling in human early neural differentiation. Gigascience. 2018;7: pubmed publisher
Yang G, Hong H, Torres A, Malloy K, Choudhury G, Kim J, et al. Standards for Deriving Nonhuman Primate-Induced Pluripotent Stem Cells, Neural Stem Cells and Dopaminergic Lineage. Int J Mol Sci. 2018;19: pubmed publisher
Rosati J, Ferrari D, Altieri F, Tardivo S, Ricciolini C, Fusilli C, et al. Establishment of stable iPS-derived human neural stem cell lines suitable for cell therapies. Cell Death Dis. 2018;9:937 pubmed publisher
Xiang X, Piers T, Wefers B, Zhu K, Mallach A, Brunner B, et al. The Trem2 R47H Alzheimer's risk variant impairs splicing and reduces Trem2 mRNA and protein in mice but not in humans. Mol Neurodegener. 2018;13:49 pubmed publisher
Hey C, Saltõkowa K, Larsen L, Tumer Z, Brøndum Nielsen K, Grønskov K, et al. Generation of induced pluripotent stem cells, KCi001-A derived from a Bardet-Biedl syndrome patient compound heterozygous for the BBS1 variants c.1169T>G/c.1135G>C. Stem Cell Res. 2018;31:235-239 pubmed publisher
Kumar D, Hussain A, Srivastava A, Mukerji M, Mukherjee O, Faruq M. Generation of three spinocerebellar ataxia type-12 patients derived induced pluripotent stem cell lines (IGIBi002-A, IGIBi003-A and IGIBi004-A). Stem Cell Res. 2018;31:216-221 pubmed publisher
Lee J, Jeong E, Lee J, Jung M, Shin E, Kim Y, et al. Directed evolution of CRISPR-Cas9 to increase its specificity. Nat Commun. 2018;9:3048 pubmed publisher
Li L, Tian E, Chen X, Chao J, Klein J, Qu Q, et al. GFAP Mutations in Astrocytes Impair Oligodendrocyte Progenitor Proliferation and Myelination in an hiPSC Model of Alexander Disease. Cell Stem Cell. 2018;23:239-251.e6 pubmed publisher
Melo U, de Souza Leite F, Costa S, Rosenberg C, Zatz M. A fast method to reprogram and CRISPR/Cas9 gene editing from erythroblasts. Stem Cell Res. 2018;31:52-54 pubmed publisher
Trevisan M, Alvisi G, Barbaro V, Barzon L, Raffa P, Migliorati A, et al. Oral Mucosa-Derived Induced Pluripotent Stem Cells from Patients with Ectrodactyly-Ectodermal Dysplasia-Clefting Syndrome. Cell Reprogram. 2018;20:215-224 pubmed publisher
Weltner J, Balboa D, Katayama S, Bespalov M, Krjutskov K, Jouhilahti E, et al. Human pluripotent reprogramming with CRISPR activators. Nat Commun. 2018;9:2643 pubmed publisher
Vallabhaneni H, Lynch P, Chen G, Park K, Liu Y, Goehe R, et al. High Basal Levels of γH2AX in Human Induced Pluripotent Stem Cells Are Linked to Replication-Associated DNA Damage and Repair. Stem Cells. 2018;36:1501-1513 pubmed publisher
Iyer S, Bhatia P, Rao M, Mukherjee O. Developing two reference control samples for the Indian population. Stem Cell Res. 2018;30:38-42 pubmed publisher
Rotundo G, Bidollari E, Ferrari D, Spasari I, Bernardini L, Consoli F, et al. Generation of the induced pluripotent stem cell line CSSi006-A (3681) from a patient affected by advanced-stage Juvenile Onset Huntington's Disease. Stem Cell Res. 2018;29:174-178 pubmed publisher
Manian K, Bharathan S, Maddali M, Srivastava V, Srivastava A, Velayudhan S. Generation of an integration-free iPSC line (CSCRi005-A) from erythroid progenitor cells of a healthy Indian male individual. Stem Cell Res. 2018;29:148-151 pubmed publisher
Hey C, Saltõkova K, Bisgaard H, Møller L. Comparison of two different culture conditions for derivation of early hiPSC. Cell Biol Int. 2018;42:1467-1473 pubmed publisher
Vögtle F, Brändl B, Larson A, Pendziwiat M, Friederich M, White S, et al. Mutations in PMPCB Encoding the Catalytic Subunit of the Mitochondrial Presequence Protease Cause Neurodegeneration in Early Childhood. Am J Hum Genet. 2018;102:557-573 pubmed publisher
Simmons C, Thompson C, Cawthon B, Westlake G, Swoboda K, Kiskinis E, et al. Direct evidence of impaired neuronal Na/K-ATPase pump function in alternating hemiplegia of childhood. Neurobiol Dis. 2018;115:29-38 pubmed publisher
Thekkeparambil Chandrabose S, Sriram S, Subramanian S, Cheng S, Ong W, Rozen S, et al. Amenable epigenetic traits of dental pulp stem cells underlie high capability of xeno-free episomal reprogramming. Stem Cell Res Ther. 2018;9:68 pubmed publisher
Alvisi G, Trevisan M, Masi G, Canel V, Caenazzo L, Nespeca P, et al. Generation of a transgene-free human induced pluripotent stem cell line (UNIPDi001-A) from oral mucosa epithelial stem cells. Stem Cell Res. 2018;28:177-180 pubmed publisher
Bidollari E, Rotundo G, Ferrari D, Candido O, Bernardini L, Consoli F, et al. Generation of induced pluripotent stem cell line, CSSi004-A (2962), from a patient diagnosed with Huntington's disease at the presymptomatic stage. Stem Cell Res. 2018;28:145-148 pubmed publisher
Trevisan M, Di Iorio E, Masi G, Riccetti S, Barzon L, Alvisi G, et al. Induced pluripotent stem cells line (UNIPDi003-A) from a patient affected by EEC syndrome carrying the R279H mutation in TP63 gene. Stem Cell Res. 2018;28:141-144 pubmed publisher
Birnbaum J, Wanner D, Gietl A, Saake A, Kundig T, Hock C, et al. Oxidative stress and altered mitochondrial protein expression in the absence of amyloid-β and tau pathology in iPSC-derived neurons from sporadic Alzheimer's disease patients. Stem Cell Res. 2018;27:121-130 pubmed publisher
Caires Júnior L, Goulart E, Melo U, Araujo B, Alvizi L, Soares Schanoski A, et al. Discordant congenital Zika syndrome twins show differential in vitro viral susceptibility of neural progenitor cells. Nat Commun. 2018;9:475 pubmed publisher
Rosati J, Bidollari E, Rotundo G, Ferrari D, Torres B, Bernardini L, et al. Generation of induced pluripotent stem cell line, CSSi002-A (2851), from a patient with juvenile Huntington Disease. Stem Cell Res. 2018;27:86-89 pubmed publisher
Parveen S. Establishment and characterization of induced pluripotent stem cells from placental mesenchymal stromal cells. Stem Cell Res. 2018;27:15-20 pubmed publisher
Yahata N, Matsumoto Y, Omi M, Yamamoto N, Hata R. TALEN-mediated shift of mitochondrial DNA heteroplasmy in MELAS-iPSCs with m.13513G>A mutation. Sci Rep. 2017;7:15557 pubmed publisher
Araújo B, Kaid C, de Souza J, Gomes da Silva S, Goulart E, Caires L, et al. Down Syndrome iPSC-Derived Astrocytes Impair Neuronal Synaptogenesis and the mTOR Pathway In Vitro. Mol Neurobiol. 2018;55:5962-5975 pubmed publisher
Son D, Kang P, Yun W, You S. Generation of induced pluripotent stem cell (iPSC) line from Charcot-Marie-Tooth disease patient with MPZ mutation (CMT1B). Stem Cell Res. 2017;24:5-7 pubmed publisher
Selga E, Sendfeld F, Martinez Moreno R, Medine C, Tura Ceide O, Wilmut S, et al. Sodium channel current loss of function in induced pluripotent stem cell-derived cardiomyocytes from a Brugada syndrome patient. J Mol Cell Cardiol. 2018;114:10-19 pubmed publisher
Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Stem Cell Res. 2017;22:16-19 pubmed publisher
Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Generation of an OCT4 reporter human induced pluripotent stem cell line using CRISPR/SpCas9. Stem Cell Res. 2017;23:105-108 pubmed publisher
Arber C, Angelova P, Wiethoff S, Tsuchiya Y, Mazzacuva F, Preza E, et al. iPSC-derived neuronal models of PANK2-associated neurodegeneration reveal mitochondrial dysfunction contributing to early disease. PLoS ONE. 2017;12:e0184104 pubmed publisher
Prasad A, Teh D, Blasiak A, Chai C, Wu Y, Gharibani P, et al. Static Magnetic Field Stimulation Enhances Oligodendrocyte Differentiation and Secretion of Neurotrophic Factors. Sci Rep. 2017;7:6743 pubmed publisher
Son D, Kang P, Yun W, You S. Generation of induced pluripotent stem cell (iPSC) line from a 36-year-old Charcot-Marie-Tooth disease patient with GJB1 mutation (CMTX). Stem Cell Res. 2017;21:9-12 pubmed publisher
Kajiwara K, Tanemoto T, Wada S, Karibe J, Ihara N, Ikemoto Y, et al. Fetal Therapy Model of Myelomeningocele with Three-Dimensional Skin Using Amniotic Fluid Cell-Derived Induced Pluripotent Stem Cells. Stem Cell Reports. 2017;8:1701-1713 pubmed publisher
Jeziorowska D, Fontaine V, Jouve C, Villard E, Dussaud S, Akbar D, et al. Differential Sarcomere and Electrophysiological Maturation of Human iPSC-Derived Cardiac Myocytes in Monolayer vs. Aggregation-Based Differentiation Protocols. Int J Mol Sci. 2017;18: pubmed publisher
Schmitt C, Morales B, Schmitz E, Hawkins J, Lizama C, Zape J, et al. Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming. Stem Cell Res Ther. 2017;8:132 pubmed publisher
Wong R, Lim S, Hung S, Jackson S, Khan S, Van Bergen N, et al. Mitochondrial replacement in an iPSC model of Leber's hereditary optic neuropathy. Aging (Albany NY). 2017;9:1341-1350 pubmed publisher
Li D, Secher J, Juhl M, Mashayekhi K, Nielsen T, Holst B, et al. Identification of SSEA-1 expressing enhanced reprogramming (SEER) cells in porcine embryonic fibroblasts. Cell Cycle. 2017;16:1070-1084 pubmed publisher
Parveen S, Panicker M, Gupta P. Generation of an induced pluripotent stem cell line from chorionic villi of a Turner syndrome spontaneous abortion. Stem Cell Res. 2017;19:12-16 pubmed publisher
Tangprasittipap A, Jittorntrum B, Wongkummool W, Kitiyanant N, Tubsuwan A. Generation of induced pluripotent stem cells from peripheral blood CD34+ hematopoietic progenitors of a 31year old healthy woman. Stem Cell Res. 2017;20:91-93 pubmed publisher
Wongkummool W, Maneepitasut W, Munkongdee T, Tong Ngam P, Tangprasittipap A, Svasti S, et al. Derivation of the human induced pluripotent stem cell line MUi017-A from a patient with homozygous Hemoglobin Constant Spring. Stem Cell Res. 2017;20:84-87 pubmed publisher
Wongkummool W, Maneepitasut W, Tong Ngam P, Tangprasittipap A, Munkongdee T, Boonchuay C, et al. Establishment of MUi009 - A human induced pluripotent stem cells from a 32year old male with homozygous β°-thalassemia coinherited with heterozygous α-thalassemia 2. Stem Cell Res. 2017;20:80-83 pubmed publisher
Ludtmann M, Arber C, Bartolomé F, de Vicente M, Preza E, Carro E, et al. Mutations in valosin-containing protein (VCP) decrease ADP/ATP translocation across the mitochondrial membrane and impair energy metabolism in human neurons. J Biol Chem. 2017;292:8907-8917 pubmed publisher
Miller E, Kobayashi G, Musso C, Allen M, Ishiy F, de Caires L, et al. EIF4A3 deficient human iPSCs and mouse models demonstrate neural crest defects that underlie Richieri-Costa-Pereira syndrome. Hum Mol Genet. 2017;26:2177-2191 pubmed publisher
Ramsden C, Nommiste B, R Lane A, Carr A, Powner M, J K Smart M, et al. Rescue of the MERTK phagocytic defect in a human iPSC disease model using translational read-through inducing drugs. Sci Rep. 2017;7:51 pubmed publisher
Aldana B, Zhang Y, Lihme M, Bak L, Nielsen J, Holst B, et al. Characterization of energy and neurotransmitter metabolism in cortical glutamatergic neurons derived from human induced pluripotent stem cells: A novel approach to study metabolism in human neurons. Neurochem Int. 2017;106:48-61 pubmed publisher
Zhang Y, Schmid B, Nikolaisen N, Rasmussen M, Aldana B, Agger M, et al. Patient iPSC-Derived Neurons for Disease Modeling of Frontotemporal Dementia with Mutation in CHMP2B. Stem Cell Reports. 2017;8:648-658 pubmed publisher
Wu J, Platero Luengo A, Sakurai M, Sugawara A, Gil M, Yamauchi T, et al. Interspecies Chimerism with Mammalian Pluripotent Stem Cells. Cell. 2017;168:473-486.e15 pubmed publisher
Secher J, Liu Y, Petkov S, Luo Y, Li D, Hall V, et al. Evaluation of porcine stem cell competence for somatic cell nuclear transfer and production of cloned animals. Anim Reprod Sci. 2017;178:40-49 pubmed publisher
Trevisan M, Desole G, Costanzi G, Lavezzo E, Palu G, Barzon L. Reprogramming Methods Do Not Affect Gene Expression Profile of Human Induced Pluripotent Stem Cells. Int J Mol Sci. 2017;18: pubmed publisher
Pei F, Jiang J, Bai S, Cao H, Tian L, Zhao Y, et al. Chemical-defined and albumin-free generation of human atrial and ventricular myocytes from human pluripotent stem cells. Stem Cell Res. 2017;19:94-103 pubmed publisher
Mizuguchi Y, Hatakeyama H, Sueoka K, Tanaka M, Goto Y. Low dose resveratrol ameliorates mitochondrial respiratory dysfunction and enhances cellular reprogramming. Mitochondrion. 2017;34:43-48 pubmed publisher
Bharathan S, Manian K, Aalam S, Palani D, Deshpande P, Pratheesh M, et al. Systematic evaluation of markers used for the identification of human induced pluripotent stem cells. Biol Open. 2017;6:100-108 pubmed publisher
Yokota M, Hatakeyama H, Ono Y, Kanazawa M, Goto Y. Mitochondrial respiratory dysfunction disturbs neuronal and cardiac lineage commitment of human iPSCs. Cell Death Dis. 2017;8:e2551 pubmed publisher
Ang Y, Rivas R, Ribeiro A, Srivas R, Rivera J, Stone N, et al. Disease Model of GATA4 Mutation Reveals Transcription Factor Cooperativity in Human Cardiogenesis. Cell. 2016;167:1734-1749.e22 pubmed publisher
Nimsanor N, Poulsen U, Rasmussen M, Clausen C, Mau Holzmann U, Nielsen J, et al. Generation of an isogenic, gene-corrected iPSC line from a pre-symptomatic 28-year-old woman with an R406W mutation in the microtubule associated protein tau (MAPT) gene. Stem Cell Res. 2016;17:600-602 pubmed publisher
Jung Klawitter S, Blau N, Sebe A, Ebersold J, Göhring G, Opladen T. Generation of an iPSC line from a patient with tyrosine hydroxylase (TH) deficiency: TH-1 iPSC. Stem Cell Res. 2016;17:580-583 pubmed publisher
Nimsanor N, Poulsen U, Rasmussen M, Clausen C, Mau Holzmann U, Nielsen J, et al. Generation of an isogenic, gene-corrected iPSC line from a symptomatic 59-year-old female patient with frontotemporal dementia caused by an R406W mutation in the microtubule associated protein tau (MAPT) gene. Stem Cell Res. 2016;17:576-579 pubmed publisher
Du J, Yanagida A, Knight K, Engel A, Vo A, Jankowski C, et al. Reductive carboxylation is a major metabolic pathway in the retinal pigment epithelium. Proc Natl Acad Sci U S A. 2016;113:14710-14715 pubmed publisher
Pires C, Schmid B, Petræus C, Poon A, Nimsanor N, Nielsen T, et al. Generation of a gene-corrected isogenic control cell line from an Alzheimer's disease patient iPSC line carrying a A79V mutation in PSEN1. Stem Cell Res. 2016;17:285-288 pubmed publisher
Lin M, Pedrosa E, Hrabovsky A, Chen J, Puliafito B, Gilbert S, et al. Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion. BMC Syst Biol. 2016;10:105 pubmed
Capetian P, Azmitia L, Pauly M, Krajka V, Stengel F, Bernhardi E, et al. Plasmid-Based Generation of Induced Neural Stem Cells from Adult Human Fibroblasts. Front Cell Neurosci. 2016;10:245 pubmed
Nimsanor N, Jørring I, Rasmussen M, Clausen C, Mau Holzmann U, Bus C, et al. Generation of induced pluripotent stem cells derived from a 77-year-old healthy woman as control for age related diseases. Stem Cell Res. 2016;17:550-552 pubmed publisher
Poon A, Li T, Pires C, Nielsen T, Nielsen J, Holst B, et al. Derivation of induced pluripotent stem cells from a familial Alzheimer's disease patient carrying the L282F mutation in presenilin 1. Stem Cell Res. 2016;17:470-473 pubmed publisher
Park C, Sung J, Choi S, Lee D, Park I, Kim D. Modeling and correction of structural variations in patient-derived iPSCs using CRISPR/Cas9. Nat Protoc. 2016;11:2154-2169 pubmed publisher
Zhang Y, Schmid B, Nielsen T, Nielsen J, Clausen C, Hyttel P, et al. Generation of a human induced pluripotent stem cell line via CRISPR-Cas9 mediated integration of a site-specific homozygous mutation in CHMP2B. Stem Cell Res. 2016;17:151-153 pubmed publisher
Zhang Y, Schmid B, Nielsen T, Nielsen J, Clausen C, Hyttel P, et al. Generation of a human induced pluripotent stem cell line via CRISPR-Cas9 mediated integration of a site-specific heterozygous mutation in CHMP2B. Stem Cell Res. 2016;17:148-150 pubmed publisher
Preininger M, Jha R, Maxwell J, Wu Q, Singh M, Wang B, et al. A human pluripotent stem cell model of catecholaminergic polymorphic ventricular tachycardia recapitulates patient-specific drug responses. Dis Model Mech. 2016;9:927-39 pubmed publisher
Li C, Ding L, Sun C, Wu L, Zhou D, Pawlik K, et al. Novel HDAd/EBV Reprogramming Vector and Highly Efficient Ad/CRISPR-Cas Sickle Cell Disease Gene Correction. Sci Rep. 2016;6:30422 pubmed publisher
Li T, Pires C, Nielsen T, Waldemar G, Hjermind L, Nielsen J, et al. Generation of induced pluripotent stem cells (iPSCs) from an Alzheimer's disease patient carrying a M146I mutation in PSEN1. Stem Cell Res. 2016;16:334-7 pubmed publisher
Li T, Pires C, Nielsen T, Waldemar G, Hjermind L, Nielsen J, et al. Generation of induced pluripotent stem cells (iPSCs) from an Alzheimer's disease patient carrying an A79V mutation in PSEN1. Stem Cell Res. 2016;16:229-32 pubmed publisher
Marthaler A, Tubsuwan A, Schmid B, Poulsen U, Engelbrecht A, Mau Holzmann U, et al. Generation of an isogenic, gene-corrected control cell line of the spinocerebellar ataxia type 2 patient-derived iPSC line H266. Stem Cell Res. 2016;16:202-5 pubmed publisher
Marthaler A, Schmid B, Tubsuwan A, Poulsen U, Hyttel P, Nielsen T, et al. Generation of spinocerebellar ataxia type 2 patient-derived iPSC line H196. Stem Cell Res. 2016;16:199-201 pubmed publisher
Marthaler A, Schmid B, Tubsuwan A, Poulsen U, Engelbrecht A, Mau Holzmann U, et al. Generation of an isogenic, gene-corrected control cell line of the spinocerebellar ataxia type 2 patient-derived iPSC line H271. Stem Cell Res. 2016;16:180-3 pubmed publisher
Marthaler A, Schmid B, Tubsuwan A, Poulsen U, Hyttel P, Nielsen T, et al. Generation of spinocerebellar ataxia type 2 patient-derived iPSC line H266. Stem Cell Res. 2016;16:166-9 pubmed publisher
Marthaler A, Schmid B, Tubsuwan A, Poulsen U, Engelbrecht A, Mau Holzmann U, et al. Generation of an isogenic, gene-corrected control cell line of the spinocerebellar ataxia type 2 patient-derived iPSC line H196. Stem Cell Res. 2016;16:162-5 pubmed publisher
Marthaler A, Tubsuwan A, Schmid B, Poulsen U, Hyttel P, Nielsen J, et al. Generation of spinocerebellar ataxia type 2 patient-derived iPSC line H271. Stem Cell Res. 2016;16:159-61 pubmed publisher
Tubsuwan A, Pires C, Rasmussen M, Schmid B, Nielsen J, Hjermind L, et al. Generation of induced pluripotent stem cells (iPSCs) from an Alzheimer's disease patient carrying a L150P mutation in PSEN-1. Stem Cell Res. 2016;16:110-2 pubmed publisher
Rasmussen M, Hjermind L, Hasholt L, Waldemar G, Nielsen J, Clausen C, et al. Induced pluripotent stem cells (iPSCs) derived from a pre-symptomatic carrier of a R406W mutation in microtubule-associated protein tau (MAPT) causing frontotemporal dementia. Stem Cell Res. 2016;16:105-9 pubmed publisher
Rasmussen M, Hjermind L, Hasholt L, Waldemar G, Nielsen J, Clausen C, et al. Induced pluripotent stem cells (iPSCs) derived from a patient with frontotemporal dementia caused by a R406W mutation in microtubule-associated protein tau (MAPT). Stem Cell Res. 2016;16:75-8 pubmed publisher
Rasmussen M, Hjermind L, Hasholt L, Waldemar G, Nielsen J, Clausen C, et al. Induced pluripotent stem cells (iPSCs) derived from a patient with frontotemporal dementia caused by a P301L mutation in microtubule-associated protein tau (MAPT). Stem Cell Res. 2016;16:70-4 pubmed publisher
Kim B, Jeong S, Lee S, Lee S, Gweon E, Ahn H, et al. Concurrent progress of reprogramming and gene correction to overcome therapeutic limitation of mutant ALK2-iPSC. Exp Mol Med. 2016;48:e237 pubmed publisher
Garreta E, de Oñate L, Fernández Santos M, Oria R, Tarantino C, Climent A, et al. Myocardial commitment from human pluripotent stem cells: Rapid production of human heart grafts. Biomaterials. 2016;98:64-78 pubmed publisher
Massa M, Gisevius B, Hirschberg S, Hinz L, Schmidt M, Gold R, et al. Multiple Sclerosis Patient-Specific Primary Neurons Differentiated from Urinary Renal Epithelial Cells via Induced Pluripotent Stem Cells. PLoS ONE. 2016;11:e0155274 pubmed publisher
Shinkuma S, Guo Z, Christiano A. Site-specific genome editing for correction of induced pluripotent stem cells derived from dominant dystrophic epidermolysis bullosa. Proc Natl Acad Sci U S A. 2016;113:5676-81 pubmed publisher
Li P, Sun X, Ma Z, Liu Y, Jin Y, Ge R, et al. Transcriptional Reactivation of OTX2, RX1 and SIX3 during Reprogramming Contributes to the Generation of RPE Cells from Human iPSCs. Int J Biol Sci. 2016;12:505-17 pubmed publisher
Tidball A, Neely M, Chamberlin R, Aboud A, Kumar K, Han B, et al. Genomic Instability Associated with p53 Knockdown in the Generation of Huntington's Disease Human Induced Pluripotent Stem Cells. PLoS ONE. 2016;11:e0150372 pubmed publisher
Nebel R, Zhao D, Pedrosa E, Kirschen J, Lachman H, Zheng D, et al. Reduced CYFIP1 in Human Neural Progenitors Results in Dysregulation of Schizophrenia and Epilepsy Gene Networks. PLoS ONE. 2016;11:e0148039 pubmed publisher
Chlon T, Ruiz Torres S, Maag L, Mayhew C, Wikenheiser Brokamp K, Davies S, et al. Overcoming Pluripotent Stem Cell Dependence on the Repair of Endogenous DNA Damage. Stem Cell Reports. 2016;6:44-54 pubmed publisher
Esanov R, Belle K, van Blitterswijk M, Belzil V, Rademakers R, Dickson D, et al. C9orf72 promoter hypermethylation is reduced while hydroxymethylation is acquired during reprogramming of ALS patient cells. Exp Neurol. 2016;277:171-177 pubmed publisher
Rooney G, Goodwin A, Depeille P, Sharir A, Schofield C, Yeh E, et al. Human iPS Cell-Derived Neurons Uncover the Impact of Increased Ras Signaling in Costello Syndrome. J Neurosci. 2016;36:142-52 pubmed publisher
Hatakeyama H, Katayama A, Komaki H, Nishino I, Goto Y. Molecular pathomechanisms and cell-type-specific disease phenotypes of MELAS caused by mutant mitochondrial tRNA(Trp). Acta Neuropathol Commun. 2015;3:52 pubmed publisher
Zhao D, Lin M, Chen J, Pedrosa E, Hrabovsky A, Fourcade H, et al. MicroRNA Profiling of Neurons Generated Using Induced Pluripotent Stem Cells Derived from Patients with Schizophrenia and Schizoaffective Disorder, and 22q11.2 Del. PLoS ONE. 2015;10:e0132387 pubmed publisher
Gallego Romero I, Pavlovic B, Hernando Herraez I, Zhou X, WARD M, Banovich N, et al. A panel of induced pluripotent stem cells from chimpanzees: a resource for comparative functional genomics. elife. 2015;4:e07103 pubmed publisher
Thomas S, Kagan C, Pavlovic B, Burnett J, Patterson K, Pritchard J, et al. Reprogramming LCLs to iPSCs Results in Recovery of Donor-Specific Gene Expression Signature. PLoS Genet. 2015;11:e1005216 pubmed publisher
Romani R, Pirisinu I, Calvitti M, Pallotta M, Gargaro M, Bistoni G, et al. Stem cells from human amniotic fluid exert immunoregulatory function via secreted indoleamine 2,3-dioxygenase1. J Cell Mol Med. 2015;19:1593-605 pubmed publisher
Brault J, Goutagny E, Telugu N, Shao K, Baquié M, Satre V, et al. Optimized Generation of Functional Neutrophils and Macrophages from Patient-Specific Induced Pluripotent Stem Cells: Ex Vivo Models of X(0)-Linked, AR22(0)- and AR47(0)- Chronic Granulomatous Diseases. Biores Open Access. 2014;3:311-26 pubmed publisher
McCracken K, Catá E, Crawford C, Sinagoga K, Schumacher M, Rockich B, et al. Modelling human development and disease in pluripotent stem-cell-derived gastric organoids. Nature. 2014;516:400-4 pubmed publisher
Rasmussen M, Holst B, Tümer Z, Johnsen M, Zhou S, Stummann T, et al. Transient p53 suppression increases reprogramming of human fibroblasts without affecting apoptosis and DNA damage. Stem Cell Reports. 2014;3:404-13 pubmed publisher
Burridge P, Matsa E, Shukla P, Lin Z, Churko J, Ebert A, et al. Chemically defined generation of human cardiomyocytes. Nat Methods. 2014;11:855-60 pubmed publisher
Goh P, Caxaria S, Casper C, Rosales C, Warner T, Coffey P, et al. A systematic evaluation of integration free reprogramming methods for deriving clinically relevant patient specific induced pluripotent stem (iPS) cells. PLoS ONE. 2013;8:e81622 pubmed publisher
Chen J, Lin M, Foxe J, Pedrosa E, Hrabovsky A, CARROLL R, et al. Transcriptome comparison of human neurons generated using induced pluripotent stem cells derived from dental pulp and skin fibroblasts. PLoS ONE. 2013;8:e75682 pubmed publisher
Kurian L, Sancho Martinez I, Nivet E, Aguirre A, Moon K, Pendaries C, et al. Conversion of human fibroblasts to angioblast-like progenitor cells. Nat Methods. 2013;10:77-83 pubmed publisher
Okita K, Matsumura Y, Sato Y, Okada A, Morizane A, Okamoto S, et al. A more efficient method to generate integration-free human iPS cells. Nat Methods. 2011;8:409-12 pubmed publisher
product information
Catalog Number :
27077
Product Name :
pCXLE-hOCT3/4-shp53-F
article :
doi10.1038/nmeth.1591
id4195
pubmed_id21460823
bacterial resistance :
Ampicillin
cloning :
backbonepCXLE
backbone_mutation
backbone_origin
backbone_size10180
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
shRNA: AGTAGATTACCACTGGAGTC
growth strain :
Integration-free (episomal) expression of human OCT3/4 and shRNA against p53
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5EcoRI
promoter
sequencing_primer_3WPRE-R
sequencing_primer_5pCAG-F
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesOCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4
genePOU5F1
id5460
genbank_ids
mutation
nameOCT3/4
shRNA_sequence
size1108
species
9606
Homo sapiens
tags
plasmid copy :
pCEP4 is from Invitrogen. CAG Promoter was from Dr. Jun-ichi Miyazaki of Osaka University Graduate School of Medicine. In publication using this plasmid, please cite: Efficient selection for high-expression transfectants with a novel eukaryotic vector. Gene 108:193-200, 1991. Niwa, H., Yamamura, K. & Miyazaki, J.
resistance markers :
596
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA