This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
HRE-luciferase
catalog :
26731
citations: 65
Reference
Guo J, Sun D, Zhang J, Guo J, Wu Z, Chen Y, et al. The E3 ubiquitin ligase RBCK1: Implications in the tumor immune microenvironment and antiangiogenic therapy of glioma. Comput Struct Biotechnol J. 2023;21:5212-5227 pubmed publisher
Nan Y, Liu S, Luo Q, Wu X, Zhao P, Chang W, et al. m6A demethylase FTO stabilizes LINK-A to exert oncogenic roles via MCM3-mediated cell-cycle progression and HIF-1α activation. Cell Rep. 2023;42:113273 pubmed publisher
Campero Romero A, Real F, Santana Mart xed nez R, Molina Villa T, Aranda C, R xed os Castro E, et al. Extracellular vesicles from neural progenitor cells promote functional recovery after stroke in mice with pharmacological inhibition of neurogenesis. Cell Death Discov. 2023;9:272 pubmed publisher
Jehanno C, Le Page Y, Flouriot G, Le Goff P, Michel D. Synergistic activation of genes promoting invasiveness by dual deprivation in oxygen and nutrients. Int J Exp Pathol. 2023;104:64-75 pubmed publisher
Chinn H, Gardell J, Matsumoto L, Labadie K, Mihailovic T, Lieberman N, et al. Hypoxia-inducible lentiviral gene expression in engineered human macrophages. J Immunother Cancer. 2022;10: pubmed publisher
Wu Y, Tang X, Lee S, Hong H, Cao X, Lau C, et al. Endothelial PPARδ facilitates the post-ischemic vascular repair through interaction with HIF1α. Theranostics. 2022;12:1855-1869 pubmed publisher
Gao W, Hu L, Zhang M, Liu S, Xu S, Chow V, et al. Mitochondrial DHODH regulates hypoxia-inducible factor 1 expression in OTSCC. Am J Cancer Res. 2022;12:48-67 pubmed
Vanderhaeghen T, Timmermans S, Watts D, Paakinaho V, Eggermont M, Vandewalle J, et al. Reprogramming of glucocorticoid receptor function by hypoxia. EMBO Rep. 2022;23:e53083 pubmed publisher
Lv C, Wang S, Lin L, Wang C, Zeng K, Meng Y, et al. USP14 maintains HIF1-α stabilization via its deubiquitination activity in hepatocellular carcinoma. Cell Death Dis. 2021;12:803 pubmed publisher
Ju S, Lim L, Wi K, Park C, Ki Y, Choi D, et al. LRP5 Regulates HIF-1α Stability via Interaction with PHD2 in Ischemic Myocardium. Int J Mol Sci. 2021;22: pubmed publisher
Chow H, Sun J, Hart R, Cheng K, Hung C, Lau T, et al. Low-Density Lipoprotein Receptor-Related Protein 6 Cell Surface Availability Regulates Fuel Metabolism in Astrocytes. Adv Sci (Weinh). 2021;:e2004993 pubmed publisher
Ivanova E, Sharma S, Brichkina A, Pfefferle P, Keber U, Pagenstecher A, et al. DYRK3 contributes to differentiation and hypoxic control in neuroblastoma. Biochem Biophys Res Commun. 2021;567:215-221 pubmed publisher
Preda M, Neculachi C, Fenyo I, Vacaru A, Publik M, Simionescu M, et al. Short lifespan of syngeneic transplanted MSC is a consequence of in vivo apoptosis and immune cell recruitment in mice. Cell Death Dis. 2021;12:566 pubmed publisher
Kim G, Ng H, Chan E, Mahabeleshwar G. Macrophage-Hypoxia-Inducible Factor-1α Signaling in Carotid Artery Stenosis. Am J Pathol. 2021;191:1118-1134 pubmed publisher
Yang X, Zhong D, Gao W, Liao Z, Chen Y, Zhang S, et al. Conditional ablation of MAPK7 expression in chondrocytes impairs endochondral bone formation in limbs and adaptation of chondrocytes to hypoxia. Cell Biosci. 2020;10:103 pubmed publisher
Sulaiman A, McGarry S, Chambers J, Al Kadi E, Phan A, Li L, et al. Targeting Hypoxia Sensitizes TNBC to Cisplatin and Promotes Inhibition of Both Bulk and Cancer Stem Cells. Int J Mol Sci. 2020;21: pubmed publisher
Preda M, Lupan A, Neculachi C, Leti L, Fenyo I, Popescu S, et al. Evidence of mesenchymal stromal cell adaptation to local microenvironment following subcutaneous transplantation. J Cell Mol Med. 2020;24:10889-10897 pubmed publisher
Yu S, Li Q, Yu Y, Cui Y, Li W, Liu T, et al. Activated HIF1α of tumor cells promotes chemoresistance development via recruiting GDF15-producing tumor-associated macrophages in gastric cancer. Cancer Immunol Immunother. 2020;: pubmed publisher
Lucia K, Wu Y, Garcia J, Barlier A, Buchfelder M, Saeger W, et al. Hypoxia and the hypoxia inducible factor 1α activate protein kinase A by repressing RII beta subunit transcription. Oncogene. 2020;39:3367-3380 pubmed publisher
Persson C, von Stedingk K, Fredlund E, Bexell D, Påhlman S, Wigerup C, et al. ARNT-dependent HIF-2 transcriptional activity is not sufficient to regulate downstream target genes in neuroblastoma. Exp Cell Res. 2020;388:111845 pubmed publisher
Lopez Rodriguez D, Kirillov V, Krug L, Mesri E, Andreansky S. A role of hypoxia-inducible factor 1 alpha in Murine Gammaherpesvirus 68 (MHV68) lytic replication and reactivation from latency. PLoS Pathog. 2019;15:e1008192 pubmed publisher
Benej M, Danchenko M, Oveckova I, Červenák F, Tomaska L, Grossmannova K, et al. Quantitative Proteomics Reveal Peroxiredoxin Perturbation Upon Persistent Lymphocytic Choriomeningitis Virus Infection in Human Cells. Front Microbiol. 2019;10:2438 pubmed publisher
Jung J, Zhang Y, Celiku O, Zhang W, Song H, Williams B, et al. Mitochondrial NIX Promotes Tumor Survival in the Hypoxic Niche of Glioblastoma. Cancer Res. 2019;79:5218-5232 pubmed publisher
Jin J, Qiu S, Wang P, Liang X, Huang F, Wu H, et al. Cardamonin inhibits breast cancer growth by repressing HIF-1α-dependent metabolic reprogramming. J Exp Clin Cancer Res. 2019;38:377 pubmed publisher
Xiong G, Stewart R, Chen J, Gao T, Scott T, Samayoa L, et al. Collagen prolyl 4-hydroxylase 1 is essential for HIF-1α stabilization and TNBC chemoresistance. Nat Commun. 2018;9:4456 pubmed publisher
Kim M, Kim K. CRISPR/Cas9-mediated knockout of HIF-1α gene in epithelioma papulosum cyprini (EPC) cells inhibited apoptosis and viral hemorrhagic septicemia virus (VHSV) growth. Arch Virol. 2018;163:3395-3402 pubmed publisher
Tong B, Pantazopoulou V, Johansson E, Pietras A. The p75 neurotrophin receptor enhances HIF-dependent signaling in glioma. Exp Cell Res. 2018;371:122-129 pubmed publisher
Pyo J, Ryu J, Kim W, Choi J, Jeong J, Kim J. The Protein Phosphatase PPM1G Destabilizes HIF-1α Expression. Int J Mol Sci. 2018;19: pubmed publisher
Zhang B, Wu J, Cai Y, Luo M, Wang B, Gu Y. AAED1 modulates proliferation and glycolysis in gastric cancer. Oncol Rep. 2018;40:1156-1164 pubmed publisher
Li Q, Li Y, Liang L, Li J, Luo D, Liu Q, et al. Klotho negatively regulated aerobic glycolysis in colorectal cancer via ERK/HIF1α axis. Cell Commun Signal. 2018;16:26 pubmed publisher
Xiang J, Hu Q, Qin Y, Ji S, Xu W, Liu W, et al. TCF7L2 positively regulates aerobic glycolysis via the EGLN2/HIF-1α axis and indicates prognosis in pancreatic cancer. Cell Death Dis. 2018;9:321 pubmed publisher
Sallais J, Alahari S, Tagliaferro A, Bhattacharjee J, Post M, Caniggia I. Factor inhibiting HIF1-A novel target of SUMOylation in the human placenta. Oncotarget. 2017;8:114002-114018 pubmed publisher
Zhang J, Zhang Q, Lou Y, Fu Q, Chen Q, Wei T, et al. Hypoxia-inducible factor-1α/interleukin-1β signaling enhances hepatoma epithelial-mesenchymal transition through macrophages in a hypoxic-inflammatory microenvironment. Hepatology. 2018;67:1872-1889 pubmed publisher
Silagi E, Schoepflin Z, Seifert E, Merceron C, Schipani E, Shapiro I, et al. Bicarbonate Recycling by HIF-1-Dependent Carbonic Anhydrase Isoforms 9 and 12 Is Critical in Maintaining Intracellular pH and Viability of Nucleus Pulposus Cells. J Bone Miner Res. 2018;33:338-355 pubmed publisher
Zhang Q, Lou Y, Zhang J, Fu Q, Wei T, Sun X, et al. Hypoxia-inducible factor-2? promotes tumor progression and has crosstalk with Wnt/?-catenin signaling in pancreatic cancer. Mol Cancer. 2017;16:119 pubmed publisher
Liu W, Zhang B, Hu Q, Qin Y, Xu W, Shi S, et al. A new facet of NDRG1 in pancreatic ductal adenocarcinoma: Suppression of glycolytic metabolism. Int J Oncol. 2017;50:1792-1800 pubmed publisher
Li H, Zhou L, Dai J. Retinoic acid receptor-related orphan receptor RORα regulates differentiation and survival of keratinocytes during hypoxia. J Cell Physiol. 2018;233:641-650 pubmed publisher
Park E, Lee Y, Oh T, Kim B, Lim B, Lim J. Vanillin Suppresses Cell Motility by Inhibiting STAT3-Mediated HIF-1? mRNA Expression in Malignant Melanoma Cells. Int J Mol Sci. 2017;18: pubmed publisher
Sharma S, Wang J, Cortes Gomez E, TAGGART R, Baysal B. Mitochondrial complex II regulates a distinct oxygen sensing mechanism in monocytes. Hum Mol Genet. 2017;26:1328-1339 pubmed publisher
Mikami H, Saito Y, Okamoto N, Kakihana A, Kuga T, Nakayama Y. Requirement of Hsp105 in CoCl2-induced HIF-1? accumulation and transcriptional activation. Exp Cell Res. 2017;352:225-233 pubmed publisher
Huang R, Yu Y, Zong X, Li X, Ma L, Zheng Q. Monomethyltransferase SETD8 regulates breast cancer metabolism via stabilizing hypoxia-inducible factor 1α. Cancer Lett. 2017;390:1-10 pubmed publisher
Cai X, Ding H, Liu Y, Pan G, Li Q, Yang Z, et al. Expression of HMGB2 indicates worse survival of patients and is required for the maintenance of Warburg effect in pancreatic cancer. Acta Biochim Biophys Sin (Shanghai). 2017;49:119-127 pubmed publisher
Zingg J, Azzi A, Meydani M. α-Tocopheryl Phosphate Induces VEGF Expression via CD36/PI3Kγ in THP-1 Monocytes. J Cell Biochem. 2017;118:1855-1867 pubmed publisher
Lee K, Yim H, Shin J, Lee C, Lee J, Jeong J. FGF11 induced by hypoxia interacts with HIF-1? and enhances its stability. FEBS Lett. 2017;591:348-357 pubmed publisher
Cacace A, Sboarina M, Vazeille T, Sonveaux P. Glutamine activates STAT3 to control cancer cell proliferation independently of glutamine metabolism. Oncogene. 2017;36:2074-2084 pubmed publisher
Wang X, Lockhart S, Rathjen T, Albadawi H, Sørensen D, O Neill B, et al. Insulin Downregulates the Transcriptional Coregulator CITED2, an Inhibitor of Proangiogenic Function in Endothelial Cells. Diabetes. 2016;65:3680-3690 pubmed
Suyama K, Silagi E, Choi H, Sakabe K, Mochida J, Shapiro I, et al. Circadian factors BMAL1 and ROR? control HIF-1? transcriptional activity in nucleus pulposus cells: implications in maintenance of intervertebral disc health. Oncotarget. 2016;7:23056-71 pubmed publisher
Shi S, Xu J, Zhang B, Ji S, Xu W, Liu J, et al. VEGF Promotes Glycolysis in Pancreatic Cancer via HIF1α Up-Regulation. Curr Mol Med. 2016;16:394-403 pubmed
Shi R, Qu N, Liao T, Wang Y, Wang Y, Sun G, et al. Expression, clinical significance and mechanism of Slit2 in papillary thyroid cancer. Int J Oncol. 2016;48:2055-62 pubmed publisher
Ji S, Zhang B, Liu J, Qin Y, Liang C, Shi S, et al. ALDOA functions as an oncogene in the highly metastatic pancreatic cancer. Cancer Lett. 2016;374:127-135 pubmed publisher
Alam M, Persson C, Reinbothe S, Kazi J, Rönnstrand L, Wigerup C, et al. HIF2α contributes to antiestrogen resistance via positive bilateral crosstalk with EGFR in breast cancer cells. Oncotarget. 2016;7:11238-50 pubmed publisher
Lee S, Kim W, Jeong J, Park J, Kim J. AK-1, a SIRT2 inhibitor, destabilizes HIF-1α and diminishes its transcriptional activity during hypoxia. Cancer Lett. 2016;373:138-145 pubmed publisher
Schoepflin Z, Shapiro I, Risbud M. Class I and IIa HDACs Mediate HIF-1? Stability Through PHD2-Dependent Mechanism, While HDAC6, a Class IIb Member, Promotes HIF-1? Transcriptional Activity in Nucleus Pulposus Cells of the Intervertebral Disc. J Bone Miner Res. 2016;31:1287-99 pubmed publisher
Wong A, Loots G, Yellowley C, Dosé A, Genetos D. Parathyroid hormone regulation of hypoxia-inducible factor signaling in osteoblastic cells. Bone. 2015;81:97-103 pubmed publisher
Li J, Yuan W, Jiang S, Ye W, Yang H, Shapiro I, et al. Prolyl-4-hydroxylase domain protein 2 controls NF-κB/p65 transactivation and enhances the catabolic effects of inflammatory cytokines on cells of the nucleus pulposus. J Biol Chem. 2015;290:7195-207 pubmed publisher
Xu H, Zhao L, Fang Q, Sun J, Zhang S, Zhan C, et al. MiR-338-3p inhibits hepatocarcinoma cells and sensitizes these cells to sorafenib by targeting hypoxia-induced factor 1α. PLoS ONE. 2014;9:e115565 pubmed publisher
Santoyo Ramos P, Likhatcheva M, García Zepeda E, Castañeda Patlán M, Robles Flores M. Hypoxia-inducible factors modulate the stemness and malignancy of colon cancer cells by playing opposite roles in canonical Wnt signaling. PLoS ONE. 2014;9:e112580 pubmed publisher
Hirose Y, Johnson Z, Schoepflin Z, Markova D, Chiba K, Toyama Y, et al. FIH-1-Mint3 axis does not control HIF-1 transcriptional activity in nucleus pulposus cells. J Biol Chem. 2014;289:20594-605 pubmed
Aga M, Bentz G, Raffa S, Torrisi M, Kondo S, Wakisaka N, et al. Exosomal HIF1α supports invasive potential of nasopharyngeal carcinoma-associated LMP1-positive exosomes. Oncogene. 2014;33:4613-22 pubmed publisher
Fujita N, Hirose Y, Tran C, Chiba K, Miyamoto T, Toyama Y, et al. HIF-1-PHD2 axis controls expression of syndecan 4 in nucleus pulposus cells. FASEB J. 2014;28:2455-65 pubmed publisher
Kalhori V, Kemppainen K, Asghar M, Bergelin N, Jaakkola P, Törnquist K. Sphingosine-1-Phosphate as a Regulator of Hypoxia-Induced Factor-1? in Thyroid Follicular Carcinoma Cells. PLoS ONE. 2013;8:e66189 pubmed publisher
Tran C, Fujita N, Huang B, Ong J, Lyons K, Shapiro I, et al. Hypoxia-inducible factor (HIF)-1? and CCN2 form a regulatory circuit in hypoxic nucleus pulposus cells: CCN2 suppresses HIF-1? level and transcriptional activity. J Biol Chem. 2013;288:12654-66 pubmed publisher
Fujita N, Markova D, Anderson D, Chiba K, Toyama Y, Shapiro I, et al. Expression of prolyl hydroxylases (PHDs) is selectively controlled by HIF-1 and HIF-2 proteins in nucleus pulposus cells of the intervertebral disc: distinct roles of PHD2 and PHD3 proteins in controlling HIF-1? activity in hypoxia. J Biol Chem. 2012;287:16975-86 pubmed publisher
Wanyin W, Liwei D, Lin J, Hailiang X, Changquan L, Min L. Ethanol extract of Portulaca oleracea L. protects against hypoxia-induced neuro damage through modulating endogenous erythropoietin expression. J Nutr Biochem. 2012;23:385-91 pubmed publisher
Emerling B, Weinberg F, Liu J, Mak T, Chandel N. PTEN regulates p300-dependent hypoxia-inducible factor 1 transcriptional activity through Forkhead transcription factor 3a (FOXO3a). Proc Natl Acad Sci U S A. 2008;105:2622-7 pubmed publisher
product information
Catalog Number :
26731
Product Name :
HRE-luciferase
article :
doi10.1073/pnas.0706790105
id3752
pubmed_id18268343
bacterial resistance :
Ampicillin
cloning :
backbonepGL2
backbone_mutation
backbone_originPromega
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Luciferase
growth notes :
Three hypoxia response elements (24-mers) from the Pgk-1 gene upstream of firefly luciferase. HRE: TGTCACGTCCTGCACGACTCTAGT Note that one of the elements is a 22/24 match for the above sequence. This difference is not known to affect function.
growth strain :
Luciferase reporter construct containing three hypoxia response elements (24-mers) from the Pgk-1 gene.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3NheI
cloning_site_5SacI
promoter
sequencing_primer_3Luc_N_Rev
sequencing_primer_5unknown
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameHypoxia Responsive Elements (3)
shRNA_sequence
size
species
tags
locationC terminal on backbone
tagLuciferase
resistance markers :
831
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA