This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
LV-GFP
catalog :
25999
citations: 48
Reference
Basbous S, Dif L, Dantzer C, Di Tommaso S, Dupuy J, Bioulac Sage P, et al. Loss of RND3/RHOE controls entosis through LAMP1 expression in hepatocellular carcinoma. Cell Death Dis. 2024;15:46 pubmed publisher
Yusupova M, Ankawa R, Yosefzon Y, Meiri D, Bachelet I, Fuchs Y. Apoptotic dysregulation mediates stem cell competition and tissue regeneration. Nat Commun. 2023;14:7547 pubmed publisher
Maniv I, Sarji M, Bdarneh A, Feldman A, Ankawa R, Koren E, et al. Altered ubiquitin signaling induces Alzheimer's disease-like hallmarks in a three-dimensional human neural cell culture model. Nat Commun. 2023;14:5922 pubmed publisher
Wu Z, Thierry K, Bachy S, Zhang X, Gamradt P, Hernandez Vargas H, et al. Pericyte stem cells induce Ly6G+ cell accumulation and immunotherapy resistance in pancreatic cancer. EMBO Rep. 2023;24:e56524 pubmed publisher
Tsujino T, Takai T, Hinohara K, Gui F, Tsutsumi T, Bai X, et al. CRISPR screens reveal genetic determinants of PARP inhibitor sensitivity and resistance in prostate cancer. Nat Commun. 2023;14:252 pubmed publisher
Palmiero M, Cantarosso I, di Blasio L, Monica V, Peracino B, Primo L, et al. Collective directional migration drives the formation of heteroclonal cancer cell clusters. Mol Oncol. 2023;: pubmed publisher
Coetzee A, Carter E, Rodr xed guez Fern xe1 ndez L, Heward J, Wang Q, Karim S, et al. Nuclear FGFR1 promotes pancreatic stellate cell-driven invasion through up-regulation of Neuregulin 1. Oncogene. 2022;: pubmed publisher
Kantzer C, Yang W, Grommisch D, Vikhe Patil K, Mak K, Shirokova V, et al. ID1 and CEBPA coordinate epidermal progenitor cell differentiation. Development. 2022;149: pubmed publisher
Pogacar Z, Johnson J, Krenning L, De Conti G, Jochems F, Lieftink C, et al. Indisulam synergizes with palbociclib to induce senescence through inhibition of CDK2 kinase activity. PLoS ONE. 2022;17:e0273182 pubmed publisher
Harmon R, Devany J, Gardel M. Dia1 coordinates differentiation and cell sorting in a stratified epithelium. J Cell Biol. 2022;221: pubmed publisher
Fan Y, Fan X, Yan H, Liu Z, Wang X, Yuan Q, et al. Long non-coding ROR promotes the progression of papillary thyroid carcinoma through regulation of the TESC/ALDH1A1/TUBB3/PTEN axis. Cell Death Dis. 2022;13:157 pubmed publisher
Bachy S, Wu Z, Gamradt P, Thierry K, Milani P, Chlasta J, et al. βig-h3-structured collagen alters macrophage phenotype and function in pancreatic cancer. iScience. 2022;25:103758 pubmed publisher
Feldman D, Funk L, Le A, Carlson R, Leiken M, Tsai F, et al. Pooled genetic perturbation screens with image-based phenotypes. Nat Protoc. 2022;17:476-512 pubmed publisher
Guo Y, Wang J, Benedict B, Yang C, van Gemert F, Ma X, et al. Targeting CDC7 potentiates ATR-CHK1 signaling inhibition through induction of DNA replication stress in liver cancer. Genome Med. 2021;13:166 pubmed publisher
Xin R, Qu D, Su S, Zhao B, Chen D. Downregulation of miR-23b by transcription factor c-Myc alleviates ischemic brain injury by upregulating Nrf2. Int J Biol Sci. 2021;17:3659-3671 pubmed publisher
Lei Y, Jin X, Sun M, Ji Z. miR-129-5p Ameliorates Ischemic Brain Injury by Binding to SIAH1 and Activating the mTOR Signaling Pathway. J Mol Neurosci. 2021;: pubmed publisher
Iaia I, Gammaitoni L, Cattaneo G, Giraudo L, Donini C, Fiorino E, et al. Recruitment, Infiltration, and Cytotoxicity of HLA-Independent Killer Lymphocytes in Three-Dimensional Melanoma Models. Cancers (Basel). 2021;13: pubmed publisher
Deng Y, Ma G, Gao F, Sun X, Liu L, Mo D, et al. SOX9 Knockdown-Mediated FOXO3 Downregulation Confers Neuroprotection Against Ischemic Brain Injury. Front Cell Dev Biol. 2020;8:555175 pubmed publisher
Xiao L, Gong D, Liang L, Liang A, Liang H, Xu X, et al. Inhibition of HDAC4 by GSK3β leads to downregulation of KLF5 and ASK1 and prevents the progression of intravertebral disc degeneration. Clin Epigenetics. 2021;13:53 pubmed publisher
Uneda A, Kurozumi K, Fujimura A, Fujii K, Ishida J, Shimazu Y, et al. Differentiated glioblastoma cells accelerate tumor progression by shaping the tumor microenvironment via CCN1-mediated macrophage infiltration. Acta Neuropathol Commun. 2021;9:29 pubmed publisher
Jung E, Osswald M, Ratliff M, Dogan H, Xie R, Weil S, et al. Tumor cell plasticity, heterogeneity, and resistance in crucial microenvironmental niches in glioma. Nat Commun. 2021;12:1014 pubmed publisher
Fang H, Li H, Yan J, Yang M, Zhang J. Dexmedetomidine-up-regulated microRNA-381 exerts anti-inflammatory effects in rats with cerebral ischaemic injury via the transcriptional factor IRF4. J Cell Mol Med. 2020;: pubmed publisher
Song W, Wang T, Shi B, Wu Z, Wang W, Yang Y. Neuroprotective effects of microRNA-140-5p on ischemic stroke in mice via regulation of the TLR4/NF-κB axis. Brain Res Bull. 2021;168:8-16 pubmed publisher
Masschelein E, D Hulst G, Zvick J, Hinte L, Soro Arnaiz I, Gorski T, et al. Exercise promotes satellite cell contribution to myofibers in a load-dependent manner. Skelet Muscle. 2020;10:21 pubmed publisher
Zhou T, Damsky W, Weizman O, McGeary M, Hartmann K, Rosen C, et al. IL-18BP is a secreted immune checkpoint and barrier to IL-18 immunotherapy. Nature. 2020;583:609-614 pubmed publisher
Xue H, Liu J, Shi L, Yang H. Overexpressed microRNA-539-5p inhibits inflammatory response of neurons to impede the progression of cerebral ischemic injury by histone deacetylase 1. Am J Physiol Cell Physiol. 2020;: pubmed publisher
Nunes V, Dantas M, Castro D, Vitiello E, Wang I, Carpi N, et al. Centrosome-nuclear axis repositioning drives the assembly of a bipolar spindle scaffold to ensure mitotic fidelity. Mol Biol Cell. 2020;31:1675-1690 pubmed publisher
Vecera J, Prochazkova J, Šumberová V, Pánská V, Paculova H, Lánová M, et al. Hypoxia/Hif1α prevents premature neuronal differentiation of neural stem cells through the activation of Hes1. Stem Cell Res. 2020;45:101770 pubmed publisher
Álvarez Salamero C, Castillo González R, Pastor Fernández G, Mariblanca I, Pino J, Cibrian D, et al. IL-23 signaling regulation of pro-inflammatory T-cell migration uncovered by phosphoproteomics. PLoS Biol. 2020;18:e3000646 pubmed publisher
Chopra S, Jenney A, Palmer A, Niepel M, Chung M, Mills C, et al. Torin2 Exploits Replication and Checkpoint Vulnerabilities to Cause Death of PI3K-Activated Triple-Negative Breast Cancer Cells. Cell Syst. 2019;: pubmed publisher
Wang C, Vegna S, Jin H, Benedict B, Lieftink C, Ramirez C, et al. Inducing and exploiting vulnerabilities for the treatment of liver cancer. Nature. 2019;: pubmed publisher
Nehama D, Di Ianni N, Musio S, Du H, Patanè M, Pollo B, et al. B7-H3-redirected chimeric antigen receptor T cells target glioblastoma and neurospheres. EBioMedicine. 2019;47:33-43 pubmed publisher
Puliafito A, Ricciardi S, Pirani F, Čermochová V, Boarino L, De Leo N, et al. Driving Cells with Light-Controlled Topographies. Adv Sci (Weinh). 2019;6:1801826 pubmed publisher
Antao N, Marcet Ortega M, Cifani P, Kentsis A, Foley E. A Cancer-Associated Missense Mutation in PP2A-Aα Increases Centrosome Clustering during Mitosis. iScience. 2019;19:74-82 pubmed publisher
Sastre Perona A, Hoang Phou S, Leitner M, Okuniewska M, Meehan S, Schober M. De Novo PITX1 Expression Controls Bi-Stable Transcriptional Circuits to Govern Self-Renewal and Differentiation in Squamous Cell Carcinoma. Cell Stem Cell. 2019;24:390-404.e8 pubmed publisher
Deygas M, Gadet R, Gillet G, Rimokh R, Gonzalo P, Mikaelian I. Redox regulation of EGFR steers migration of hypoxic mammary cells towards oxygen. Nat Commun. 2018;9:4545 pubmed publisher
Huang Q, Chen L, Yang L, Xie X, Gan L, Cleveland J, et al. MDMX acidic domain inhibits p53 DNA binding in vivo and regulates tumorigenesis. Proc Natl Acad Sci U S A. 2018;115:E3368-E3377 pubmed publisher
Sapoznik E, Niu G, Zhou Y, Prim P, Criswell T, Soker S. A real-time monitoring platform of myogenesis regulators using double fluorescent labeling. PLoS ONE. 2018;13:e0192654 pubmed publisher
Santamaria P, Floristán A, Fontanals Cirera B, Vázquez Naharro A, Santos V, Morales S, et al. Lysyl oxidase-like 3 is required for melanoma cell survival by maintaining genomic stability. Cell Death Differ. 2018;25:935-950 pubmed publisher
Rhys A, Monteiro P, Smith C, Vaghela M, Arnandis T, Kato T, et al. Loss of E-cadherin provides tolerance to centrosome amplification in epithelial cancer cells. J Cell Biol. 2018;217:195-209 pubmed publisher
Bove A, Gradeci D, Fujita Y, Banerjee S, Charras G, Lowe A. Local cellular neighborhood controls proliferation in cell competition. Mol Biol Cell. 2017;28:3215-3228 pubmed publisher
Weil S, Osswald M, Solecki G, Grosch J, Jung E, Lemke D, et al. Tumor microtubes convey resistance to surgical lesions and chemotherapy in gliomas. Neuro Oncol. 2017;19:1316-1326 pubmed publisher
Grabocka E, Bar Sagi D. Mutant KRAS Enhances Tumor Cell Fitness by Upregulating Stress Granules. Cell. 2016;167:1803-1813.e12 pubmed publisher
Mallarino R, Henegar C, Mirasierra M, Manceau M, Schradin C, Vallejo M, et al. Developmental mechanisms of stripe patterns in rodents. Nature. 2016;539:518-523 pubmed publisher
Osswald M, Blaes J, Liao Y, Solecki G, Gömmel M, Berghoff A, et al. Impact of Blood-Brain Barrier Integrity on Tumor Growth and Therapy Response in Brain Metastases. Clin Cancer Res. 2016;22:6078-6087 pubmed
Blum W, Pecze L, Felley Bosco E, Schwaller B. Overexpression or absence of calretinin in mouse primary mesothelial cells inversely affects proliferation and cell migration. Respir Res. 2015;16:153 pubmed publisher
Siegle J, Basin A, Sastre Perona A, Yonekubo Y, Brown J, Sennett R, et al. SOX2 is a cancer-specific regulator of tumour initiating potential in cutaneous squamous cell carcinoma. Nat Commun. 2014;5:4511 pubmed publisher
Beronja S, Livshits G, Williams S, Fuchs E. Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos. Nat Med. 2010;16:821-7 pubmed publisher
product information
Catalog Number :
25999
Product Name :
LV-GFP
article :
doi10.1038/nm.2167
id3578
pubmed_id20526348
bacterial resistance :
Ampicillin
cloning :
backbonepLKO.1
backbone_mutation
backbone_origin
backbone_size6380
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
growth notes :
Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment or SphI-SacII fragment.
growth temp :
Stbl3
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3NsiI
cloning_site_5BamHI
promoter
sequencing_primer_3
sequencing_primer_5CCTTCACCGAGGGCCTATTTC
site_3_destroyed
site_5_destroyed1
entrez_gene
aliasesGL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE
geneH2BC21
id8349
genbank_ids
mutation
nameH2B-GFP
shRNA_sequence
size1131
species
9606
Homo sapiens
A. victoria
tags
resistance markers :
783
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA