This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO-PTEN-shRNA-1320
catalog :
25638
citations: 7
| Reference |
|---|
Kim J, Lee C, Bonifant C, Ressom H, Waldman T. Activation of p53-dependent growth suppression in human cells by mutations in PTEN or PIK3CA. Mol Cell Biol. 2007;27:662-77 pubmed
|
product information
Catalog Number :
25638
Product Name :
pLKO-PTEN-shRNA-1320
article :
| doi | 10.1128/MCB.00537-06 |
| id | 3464 |
| pubmed_id | 17060456 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pLKO.1 puro | |||
| backbone_mutation | ||||
| backbone_origin | ||||
| backbone_size | 7032 | |||
| promoter | ||||
| sequencing_primer_3 | ||||
| sequencing_primer_5 | ||||
| vector_types |
|
origin :
37
pi :
sapienstags
TEP1gene PTEN
id 5728 <
/tr> >genbank_ids
tr>mutation <
tr>name PTEN-shRNA-1320 >shRNA_sequence CC
GGCCACAGCTAGAACTTATCAAACTCGAGTTTGATAAGT
TCTAGCTGTGGTTTTT size<
/td> 42 species >
TEP1
/tr>
| nm_000314 |
tr>
tr>
GGCCACAGCTAGAACTTATCAAACTCGAGTTTGATAAGT
TCTAGCTGTGGTTTTT
/td>
|
