This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO-1: shALAS-1
catalog :
22750
citations: 1
product information
Catalog Number :
22750
Product Name :
pLKO-1: shALAS-1
article :
| doi | 10.1073/pnas.0912533106 |
| id | 3153 |
| pubmed_id | 20018698 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pLKO.1 | |||
| backbone_mutation | ||||
| backbone_origin | Available at Addgene (#8453) | |||
| backbone_size | 7000 | |||
| promoter | ||||
| sequencing_primer_3 | ||||
| sequencing_primer_5 | ||||
| vector_types |
|
growth notes :
targeting sequence: CCAAGATAGTAGCATTTGAAA
origin :
37
pi :
|
resistance markers :
| 495 |
tags :
Unknown
terms :
| Puromycin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
