This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCMV4 p65
catalog :
21966
citations: 35
Reference
Nakano T, Sasahara Y, Kikuchi A, Moriya K, Niizuma H, Niihori T, et al. Novel POLE mutations identified in patients with IMAGE-I syndrome cause aberrant subcellular localisation and protein degradation in the nucleus. J Med Genet. 2022;: pubmed publisher
Morel K, Hamid A, Clohessy J, Pandell N, Ellis L, Sweeney C. NF-κB Blockade with Oral Administration of Dimethylaminoparthenolide (DMAPT), Delays Prostate Cancer Resistance to Androgen Receptor (AR) Inhibition and Inhibits AR Variants. Mol Cancer Res. 2021;19:1137-1145 pubmed publisher
Jabłońska E, Białopiotrowicz E, Szydłowski M, Prochorec Sobieszek M, Juszczyński P, Szumera Ciećkiewicz A. DEPTOR is a microRNA-155 target regulating migration and cytokine production in diffuse large B-cell lymphoma cells. Exp Hematol. 2020;: pubmed publisher
Bury M, Le Calve B, Lessard F, Dal Maso T, Saliba J, Michiels C, et al. NFE2L3 Controls Colon Cancer Cell Growth through Regulation of DUX4, a CDK1 Inhibitor. Cell Rep. 2019;29:1469-1481.e9 pubmed publisher
Johnston A, Simões Pires C, Thompson T, Suzuki M, Greally J. Functional genetic variants can mediate their regulatory effects through alteration of transcription factor binding. Nat Commun. 2019;10:3472 pubmed publisher
Mao G, Smyth S, Morris A. Regulation of PLPP3 gene expression by NF-κB family transcription factors. J Biol Chem. 2019;294:14009-14019 pubmed publisher
Jin X, Ding D, Yan Y, Li H, Wang B, Ma L, et al. Phosphorylated RB Promotes Cancer Immunity by Inhibiting NF-κB Activation and PD-L1 Expression. Mol Cell. 2019;73:22-35.e6 pubmed publisher
Wang X, Buechler N, Long D, Furdui C, Yoza B, McCall C, et al. Cysteine thiol oxidation on SIRT2 regulates inflammation in obese mice with sepsis. Inflammation. 2019;42:156-169 pubmed publisher
Xiang S, Zou P, Wu J, Zheng F, Tang Q, Zhou J, et al. Crosstalk of NF-κB/P65 and LncRNA HOTAIR-Mediated Repression of MUC1 Expression Contribute to Synergistic Inhibition of Castration-Resistant Prostate Cancer by Polyphyllin 1-Enzalutamide Combination Treatment. Cell Physiol Biochem. 2018;47:759-773 pubmed publisher
Intuyod K, Priprem A, Pairojkul C, Hahnvajanawong C, Vaeteewoottacharn K, Pinlaor P, et al. Anthocyanin complex exerts anti-cholangiocarcinoma activities and improves the efficacy of drug treatment in a gemcitabine-resistant cell line. Int J Oncol. 2018;: pubmed publisher
Shen Y, Kapfhamer D, Minnella A, Kim J, Won S, Chen Y, et al. Bioenergetic state regulates innate inflammatory responses through the transcriptional co-repressor CtBP. Nat Commun. 2017;8:624 pubmed publisher
Li M, Zhang M, Zhang Z, Liu N, Han X, Liu Q, et al. Induction of Apoptosis by Berberine in Hepatocellular Carcinoma HepG2 Cells via Downregulation of NF-?B. Oncol Res. 2017;25:233-239 pubmed publisher
Xiang S, Zhang Q, Tang Q, Zheng F, Wu J, Yang L, et al. Activation of AMPK? mediates additive effects of solamargine and metformin on suppressing MUC1 expression in castration-resistant prostate cancer cells. Sci Rep. 2016;6:36721 pubmed publisher
Wang X, Buechler N, Martin A, Wells J, Yoza B, McCall C, et al. Sirtuin-2 Regulates Sepsis Inflammation in ob/ob Mice. PLoS ONE. 2016;11:e0160431 pubmed publisher
Mao G, Jin J, Kunapuli S, Rao A. Nuclear factor-κB regulates expression of platelet phospholipase C-β2 (PLCB2). Thromb Haemost. 2016;116:931-940 pubmed
Kojima Y, Volkmer J, McKenna K, Civelek M, Lusis A, Miller C, et al. CD47-blocking antibodies restore phagocytosis and prevent atherosclerosis. Nature. 2016;536:86-90 pubmed
Li L, Wu J, Zheng F, Tang Q, Wu W, Hann S. Inhibition of EZH2 via activation of SAPK/JNK and reduction of p65 and DNMT1 as a novel mechanism in inhibition of human lung cancer cells by polyphyllin I. J Exp Clin Cancer Res. 2016;35:112 pubmed publisher
Cui X, Kong C, Zhu Y, Zeng Y, Zhang Z, Liu X, et al. miR-130b, an onco-miRNA in bladder cancer, is directly regulated by NF-?B and sustains NF-?B activation by decreasing Cylindromatosis expression. Oncotarget. 2016;7:48547-48561 pubmed publisher
de Andres M, Takahashi A, Oreffo R. Demethylation of an NF-?B enhancer element orchestrates iNOS induction in osteoarthritis and is associated with altered chondrocyte cell cycle. Osteoarthritis Cartilage. 2016;24:1951-1960 pubmed publisher
Harris D, Chandrasekharan U, Bandyopadhyay S, Willard B, DiCorleto P. PRMT5-Mediated Methylation of NF-κB p65 at Arg174 Is Required for Endothelial CXCL11 Gene Induction in Response to TNF-α and IFN-γ Costimulation. PLoS ONE. 2016;11:e0148905 pubmed publisher
Balasubramaniyan N, Ananthanarayanan M, Suchy F. Nuclear factor-?B regulates the expression of multiple genes encoding liver transport proteins. Am J Physiol Gastrointest Liver Physiol. 2016;310:G618-28 pubmed publisher
Chen Y, Tang Q, Wu J, Zheng F, Yang L, Hann S. Inactivation of PI3-K/Akt and reduction of SP1 and p65 expression increase the effect of solamargine on suppressing EP4 expression in human lung cancer cells. J Exp Clin Cancer Res. 2015;34:154 pubmed publisher
Rodrigues P, Afonso M, Simão A, Borralho P, Rodrigues C, Castro R. Inhibition of NF-κB by deoxycholic acid induces miR-21/PDCD4-dependent hepatocellular apoptosis. Sci Rep. 2015;5:17528 pubmed publisher
Shen N, Yan F, Pang J, Wu L, Al Kali A, Litzow M, et al. A nucleolin-DNMT1 regulatory axis in acute myeloid leukemogenesis. Oncotarget. 2014;5:5494-509 pubmed
Huang H, Joseph L, Gurin M, Thorp E, Morrow J. Extracellular signal-regulated kinase activation during cardiac hypertrophy reduces sarcoplasmic/endoplasmic reticulum calcium ATPase 2 (SERCA2) transcription. J Mol Cell Cardiol. 2014;75:58-63 pubmed publisher
Boyd M, Coskun M, Lilje B, Andersson R, Hoof I, Bornholdt J, et al. Identification of TNF-?-responsive promoters and enhancers in the intestinal epithelial cell model Caco-2. DNA Res. 2014;21:569-83 pubmed publisher
Harris D, Bandyopadhyay S, Maxwell T, Willard B, DiCorleto P. Tumor necrosis factor (TNF)-? induction of CXCL10 in endothelial cells requires protein arginine methyltransferase 5 (PRMT5)-mediated nuclear factor (NF)-?B p65 methylation. J Biol Chem. 2014;289:15328-39 pubmed publisher
Park E, Min K, Choi K, Kwon T. Dicoumarol sensitizes renal cell carcinoma Caki cells to TRAIL-induced apoptosis through down-regulation of Bcl-2, Mcl-1 and c-FLIP in a NQO1-independent manner. Exp Cell Res. 2014;323:144-54 pubmed publisher
Laprairie R, Warford J, Hutchings S, Robertson G, Kelly M, Denovan Wright E. The cytokine and endocannabinoid systems are co-regulated by NF-?B p65/RelA in cell culture and transgenic mouse models of Huntington's disease and in striatal tissue from Huntington's disease patients. J Neuroimmunol. 2014;267:61-72 pubmed publisher
Kassan M, Choi S, Galán M, Bishop A, Umezawa K, Trebak M, et al. Enhanced NF-?B activity impairs vascular function through PARP-1-, SP-1-, and COX-2-dependent mechanisms in type 2 diabetes. Diabetes. 2013;62:2078-87 pubmed publisher
Teng Y, Chuang P, Liu Y. Nuclear factor-?B (NF-?B) regulates the expression of human testis-enriched Leucine-rich repeats and WD repeat domain containing 1 (LRWD1) gene. Int J Mol Sci. 2012;14:625-39 pubmed publisher
de Andrés M, Imagawa K, Hashimoto K, Gonzalez A, Roach H, Goldring M, et al. Loss of methylation in CpG sites in the NF-?B enhancer elements of inducible nitric oxide synthase is responsible for gene induction in human articular chondrocytes. Arthritis Rheum. 2013;65:732-42 pubmed publisher
Malátková P, Ebert B, Wsol V, Maser E. Expression of human carbonyl reductase 3 (CBR3; SDR21C2) is inducible by pro-inflammatory stimuli. Biochem Biophys Res Commun. 2012;420:368-73 pubmed publisher
Schuhmann K, Pfaller C, Conzelmann K. The measles virus V protein binds to p65 (RelA) to suppress NF-kappaB activity. J Virol. 2011;85:3162-71 pubmed publisher
Ballard D, Dixon E, Peffer N, Bogerd H, Doerre S, Stein B, et al. The 65-kDa subunit of human NF-kappa B functions as a potent transcriptional activator and a target for v-Rel-mediated repression. Proc Natl Acad Sci U S A. 1992;89:1875-9 pubmed
product information
Catalog Number :
21966
Product Name :
pCMV4 p65
article :
doi10.1073/pnas.89.5.1875
id2813
pubmed_id1542686
bacterial resistance :
Ampicillin
cloning :
backbonepCMV4
backbone_mutation
backbone_originAndersson,S. et al, J. Biol. Chem. 264 (14), 8222-8229 (1989)
backbone_size4874
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
origin :
37
pi :
alt_names
RelA
cloning
clone_methodRestriction Enzyme
cloning_site_3HindIII
cloning_site_5HindIII
promoter
sequencing_primer_3
sequencing_primer_5CMV forward: cgcaaatgggcggtaggcgtg
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesAIF3BL3, CMCU, NFKB3, p65
geneRELA
id5970
genbank_ids
mutationThis construct was the product of 3 subcloning procedures: 1. XbaI-EcoRI-p65-EcoRI-KpnI from pBluescript II SK +/- was digested with XbaI/KpnI, and subcloned to M13 mp19. 2. HindIII-XbaI-p65-HindIII-KpnI from the M13 mp19 construct was digested with HindIII, then subcloned into pCMV4. 3. The resulting pCMV4 p65 plasmid can be liberated using HindIII, with a size of ~2.5 kb. The large size (p65 is only 1.5kb) is due to the inclusion of multiple polylinkers from pBluescript and M13mp19 as well as non-coding regions of p65.
nameNFkB p65 subunit
shRNA_sequence
size2500
species
9606
Homo sapiens
tags
resistance markers :
176
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA