This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Tet-pLKO-puro
catalog :
21915
citations: 309
Reference
Panja S, Truica M, Yu C, Saggurthi V, Craige M, Whitehead K, et al. Mechanism-centric regulatory network identifies NME2 and MYC programs as markers of Enzalutamide resistance in CRPC. Nat Commun. 2024;15:352 pubmed publisher
Daimon T, Bhattacharya A, Wang K, Haratake N, Nakashoji A, Ozawa H, et al. MUC1-C is a target of salinomycin in inducing ferroptosis of cancer stem cells. Cell Death Discov. 2024;10:9 pubmed publisher
Vaid R, Thombare K, Méndez A, Burgos Panadero R, Djos A, Jachimowicz D, et al. METTL3 drives telomere targeting of TERRA lncRNA through m6A-dependent R-loop formation: a therapeutic target for ALT-positive neuroblastoma. Nucleic Acids Res. 2024;: pubmed publisher
Hauck J, Moon D, Jiang X, Wang M, Zhao Y, Xu L, et al. Heat shock factor 1 directly regulates transsulfuration pathway to promote prostate cancer proliferation and survival. Commun Biol. 2024;7:9 pubmed publisher
Yu Z, Dong X, Song M, Xu A, He Q, Li H, et al. Targeting UBR5 inhibits postsurgical breast cancer lung metastases by inducing CDC73 and p53 mediated apoptosis. Int J Cancer. 2024;154:723-737 pubmed publisher
Wang J, Calizo A, Zhang L, Pino J, Lyu Y, Pollard K, et al. CDK4/6 inhibition enhances SHP2 inhibitor efficacy and is dependent upon RB function in malignant peripheral nerve sheath tumors. Sci Adv. 2023;9:eadg8876 pubmed publisher
Yamashita N, Withers H, Morimoto Y, Bhattacharya A, Haratake N, Daimon T, et al. MUC1-C integrates aerobic glycolysis with suppression of oxidative phosphorylation in triple-negative breast cancer stem cells. iScience. 2023;26:108168 pubmed publisher
McRee S, Bayer A, Pietruska J, Tsichlis P, Hinds P. AKT2 Loss Impairs BRAF-Mutant Melanoma Metastasis. Cancers (Basel). 2023;15: pubmed publisher
Chen Y, Han L, Dufour C, Alfonso A, Giguere V. Canonical and nuclear mTOR specify distinct transcriptional programs in androgen-dependent prostate cancer cells. Mol Cancer Res. 2023;: pubmed publisher
Fala M, Ros S, Sawle A, Rao J, Tsyben A, Tronci L, et al. The role of branched-chain aminotransferase 1 in driving glioblastoma cell proliferation and invasion varies with tumor subtype. Neurooncol Adv. 2023;5:vdad120 pubmed publisher
Taylor K, Piasecka A, Kajdasz A, Brz x119 k A, Polay Espinoza M, Bourgeois C, et al. Modulatory role of RNA helicases in MBNL-dependent alternative splicing regulation. Cell Mol Life Sci. 2023;80:335 pubmed publisher
Bhattacharya A, Fushimi A, Wang K, Yamashita N, Morimoto Y, Ishikawa S, et al. MUC1-C intersects chronic inflammation with epigenetic reprogramming by regulating the set1a compass complex in cancer progression. Commun Biol. 2023;6:1030 pubmed publisher
Topchu I, Bychkov I, Gursel D, Makhov P, Boumber Y. NSD1 supports cell growth and regulates autophagy in HPV-negative head and neck squamous cell carcinoma. bioRxiv. 2023;: pubmed publisher
Tan K, Lu W, Chen F, Shi H, Ma Y, Chen Z, et al. CRISPR-Cas9 knockout screening identifies KIAA1429 as an essential gene in Ewing sarcoma. J Exp Clin Cancer Res. 2023;42:250 pubmed publisher
Nokkeaw A, Thamjamrassri P, Chantaravisoot N, Tangkijvanich P, Ariyachet C. Long non-coding RNA H19 promotes proliferation in hepatocellular carcinoma cells via H19/miR-107/CDK6 axis. Oncol Res. 2023;31:989-1005 pubmed publisher
Mukhopadhyay S, Huang H, Lin Z, Ranieri M, Li S, Sahu S, et al. Genome-Wide CRISPR Screens Identify Multiple Synthetic Lethal Targets That Enhance KRASG12C Inhibitor Efficacy. Cancer Res. 2023;83:4095-4111 pubmed publisher
Krishnan R, Lapierre M, Gautreau B, Nixon K, El Ghamrasni S, Patel P, et al. RNF8 ubiquitylation of XRN2 facilitates R-loop resolution and restrains genomic instability in BRCA1 mutant cells. Nucleic Acids Res. 2023;51:10484-10505 pubmed publisher
Einig E, Jin C, Andrioletti V, Macek B, Popov N. RNAPII-dependent ATM signaling at collisions with replication forks. Nat Commun. 2023;14:5147 pubmed publisher
Minderman M, Lantermans H, van der Zwaan C, Hoogendijk A, van den Biggelaar M, Kersten M, et al. The oncogenic human B-cell lymphoma MYD88 L265P mutation genocopies activation by phosphorylation at the Toll/interleukin-1 receptor (TIR) domain. Blood Cancer J. 2023;13:125 pubmed publisher
Garc xed a V xed lchez R, A xf1 azco Guenkova A, Dietmann S, L xf3 pez J, Mor xf3 n Calvente V, D Ambrosi S, et al. METTL1 promotes tumorigenesis through tRNA-derived fragment biogenesis in prostate cancer. Mol Cancer. 2023;22:119 pubmed publisher
Lin C, Chang T, Wang Y, Guo L, Gao Y, Bikorimana E, et al. Protein arginine methyltransferase 5 (PRMT5) is an actionable therapeutic target in CDK4/6 inhibitor-resistant ER+/RB-deficient breast cancer. Res Sq. 2023;: pubmed publisher
Niederauer C, Nguyen C, Wang Henderson M, Stein J, Strauss S, Cumberworth A, et al. Dual-color DNA-PAINT single-particle tracking enables extended studies of membrane protein interactions. Nat Commun. 2023;14:4345 pubmed publisher
Gao R, Lv S, Chen A, Huang J, Wang L, Feng Y, et al. Cancer cell employs a microenvironmental neural signal trans-activating nucleus-mitochondria coordination to acquire stemness. Signal Transduct Target Ther. 2023;8:275 pubmed publisher
Chen Y, Dufour C, Han L, Li T, Xia H, Giguere V. Hierarchical phosphorylation of HOXB13 by mTOR dictates its activity and oncogenic function in prostate cancer. Mol Cancer Res. 2023;: pubmed publisher
Bychkov I, Deneka A, Topchu I, Pangeni R, Lengner C, Karanicolas J, et al. Musashi-2 (MSI2) regulation of DNA damage response in lung cancer. bioRxiv. 2023;: pubmed publisher
Shimizu S, Kondo J, Onuma K, Coppo R, Ota K, Kamada M, et al. Inhibition of the bone morphogenetic protein pathway suppresses tumor growth through downregulation of epidermal growth factor receptor in MEK/ERK-dependent colorectal cancer. Cancer Sci. 2023;: pubmed publisher
Acharya B, Fang J, Jeffery E, Chavkin N, Genet G, Vasavada H, et al. Connexin 37 sequestering of activated-ERK in the cytoplasm promotes p27-mediated endothelial cell cycle arrest. Life Sci Alliance. 2023;6: pubmed publisher
Sugarman A, Huynh L, Shabro A, Di Cristofano A. Anaplastic Thyroid Cancer Cells Upregulate Mitochondrial One-Carbon Metabolism To Meet Purine Demand, Eliciting A Critical Targetable Vulnerability. bioRxiv. 2023;: pubmed publisher
Ma H, Sukonina V, Zhang W, Meng F, Subhash S, Palmgren H, et al. The transcription factor Foxp1 regulates aerobic glycolysis in adipocytes and myocytes. J Biol Chem. 2023;299:104795 pubmed publisher
Bagheri M, Mohamed G, Ashick M, Saleem M, Ognjenovic N, Lu H, et al. Pharmacological Induction of mesenchymal-epithelial transition chemosensitizes breast cancer cells and prevents metastatic progression. bioRxiv. 2023;: pubmed publisher
Shah A, Guo L, Morales M, Jaichander P, Chen K, Huang H, et al. TWIST2-mediated chromatin remodeling promotes fusion-negative rhabdomyosarcoma. Sci Adv. 2023;9:eade8184 pubmed publisher
Wang L, Paudel B, McKnight R, Janes K. Nucleocytoplasmic transport of active HER2 causes fractional escape from the DCIS-like state. Nat Commun. 2023;14:2110 pubmed publisher
Chen B, Das N, Talukder I, Singhal R, Castillo C, Andren A, et al. PTEN-induced kinase PINK1 supports colorectal cancer growth by regulating the labile iron pool. J Biol Chem. 2023;299:104691 pubmed publisher
Ghosh A, Su Y, Forman M, Keyes R, Smith B, Hu X, et al. Harnessing the Noncanonical Keap1-Nrf2 Pathway for Human Cytomegalovirus Control. J Virol. 2023;97:e0016023 pubmed publisher
Patel P, Algouneh A, Krishnan R, Reynolds J, Nixon K, Hao J, et al. Excessive transcription-replication conflicts are a vulnerability of BRCA1-mutant cancers. Nucleic Acids Res. 2023;51:4341-4362 pubmed publisher
Xu X, Chang C, Li M, Omabe K, Le N, Chen Y, et al. DNA replication initiation factor RECQ4 possesses a role in antagonizing DNA replication initiation. Nat Commun. 2023;14:1233 pubmed publisher
Wang J, Calizo A, Zhang L, Pino J, Lyu Y, Pollard K, et al. CDK4/6 inhibition enhances SHP2 inhibitor efficacy and is dependent upon restoration of RB function in malignant peripheral nerve sheath tumors. bioRxiv. 2023;: pubmed publisher
Kirstein N, Dokaneheifard S, Cingaram P, Valencia M, Beckedorff F, Gomes Dos Santos H, et al. The Integrator complex regulates microRNA abundance through RISC loading. Sci Adv. 2023;9:eadf0597 pubmed publisher
Morimoto Y, Yamashita N, Daimon T, Hirose H, Yamano S, Haratake N, et al. MUC1-C is a master regulator of MICA/B NKG2D ligand and exosome secretion in human cancer cells. J Immunother Cancer. 2023;11: pubmed publisher
Andrades E, Toll A, Deza G, Segura S, Gimeno R, Espadas G, et al. Loss of dyskerin facilitates the acquisition of metastatic traits by altering the mevalonate pathway. Life Sci Alliance. 2023;6: pubmed publisher
Tan K, Mo J, Li M, Dong Y, Han Y, Sun X, et al. SMAD9-MYCN positive feedback loop represents a unique dependency for MYCN-amplified neuroblastoma. J Exp Clin Cancer Res. 2022;41:352 pubmed publisher
Devlin A, Shukla A, Ruiz J, Barnes S, Govindan A, Hunter O, et al. The PNUTS-PP1 complex acts as an intrinsic barrier to herpesvirus KSHV gene expression and replication. Nat Commun. 2022;13:7447 pubmed publisher
Sun Y, Hu L, Tao Z, Jarugumilli G, Erb H, Singh A, et al. Pharmacological blockade of TEAD-YAP reveals its therapeutic limitation in cancer cells. Nat Commun. 2022;13:6744 pubmed publisher
Heijink A, Stok C, Porubský D, Manolika E, de Kanter J, Kok Y, et al. Sister chromatid exchanges induced by perturbed replication can form independently of BRCA1, BRCA2 and RAD51. Nat Commun. 2022;13:6722 pubmed publisher
Crow J, Samuel G, Farrow E, Gibson M, Johnston J, Guest E, et al. MicroRNA Content of Ewing Sarcoma Derived Extracellular Vesicles Leads to Biomarker Potential and Identification of a Previously Undocumented EWS-FLI1 Translocation. Biomark Insights. 2022;17:11772719221132693 pubmed publisher
Zimmerli D, Brambillasca C, Talens F, Bhin J, Linstra R, Romanens L, et al. MYC promotes immune-suppression in triple-negative breast cancer via inhibition of interferon signaling. Nat Commun. 2022;13:6579 pubmed publisher
Zhou F, Aroua N, Liu Y, Rohde C, Cheng J, Wirth A, et al. A dynamic rRNA ribomethylome drives stemness in acute myeloid leukemia. Cancer Discov. 2022;: pubmed publisher
Sasaya T, Kubo T, Murata K, Mizue Y, Sasaki K, Yanagawa J, et al. Cisplatin-induced HSF1-HSP90 axis enhances the expression of functional PD-L1 in oral squamous cell carcinoma. Cancer Med. 2022;: pubmed publisher
Liao H, Gaur A, McConie H, Shekar A, Wang K, Chang J, et al. Human NOP2/NSUN1 regulates ribosome biogenesis through non-catalytic complex formation with box C/D snoRNPs. Nucleic Acids Res. 2022;50:10695-10716 pubmed publisher
Field M, Kuznetsoff J, Zhang M, Dollar J, Durante M, Sayegh Y, et al. RB1 loss triggers dependence on ESRRG in retinoblastoma. Sci Adv. 2022;8:eabm8466 pubmed publisher
Di Magno L, Coluccia A, Bufano M, Ripa S, La Regina G, Nalli M, et al. Discovery of novel human lactate dehydrogenase inhibitors: Structure-based virtual screening studies and biological assessment. Eur J Med Chem. 2022;240:114605 pubmed publisher
Kerk S, Lin L, Myers A, Sutton D, Andren A, Sajjakulnukit P, et al. Metabolic requirement for GOT2 in pancreatic cancer depends on environmental context. elife. 2022;11: pubmed publisher
Lehmusvaara S, Haikarainen T, Saarikettu J, Martínez Nieto G, Silvennoinen O. Inhibition of RNA Binding in SND1 Increases the Levels of miR-1-3p and Sensitizes Cancer Cells to Navitoclax. Cancers (Basel). 2022;14: pubmed publisher
Chavan S, Khuperkar D, Lonare A, Panigrahi S, Bellare J, Rapole S, et al. RanGTPase links nucleo-cytoplasmic transport to the recruitment of cargoes into small extracellular vesicles. Cell Mol Life Sci. 2022;79:392 pubmed publisher
Liu H, Lin J, Zhou W, Moses R, Dai Z, Kossenkov A, et al. KDM5A Inhibits Antitumor Immune Responses Through Downregulation of the Antigen-Presentation Pathway in Ovarian Cancer. Cancer Immunol Res. 2022;:OF1-OF11 pubmed publisher
Verma M, Loh N, Sabaratnam R, Vasan S, van Dam A, Todorcević M, et al. TCF7L2 plays a complex role in human adipose progenitor biology, which might contribute to genetic susceptibility to type 2 diabetes. Metabolism. 2022;133:155240 pubmed publisher
Morimoto Y, Fushimi A, Yamashita N, Hagiwara M, Bhattacharya A, Cheng J, et al. Addiction of Merkel cell carcinoma to MUC1-C identifies a potential new target for treatment. Oncogene. 2022;41:3511-3523 pubmed publisher
Yang H, Ting X, Geng Y, Xie Y, Nierenberg J, Huo Y, et al. The risk variant rs11836367 contributes to breast cancer onset and metastasis by attenuating Wnt signaling via regulating NTN4 expression. Sci Adv. 2022;8:eabn3509 pubmed publisher
Yamashita N, Fushimi A, Morimoto Y, Bhattacharya A, Hagiwara M, Yamamoto M, et al. Targeting MUC1-C Suppresses Chronic Activation of Cytosolic Nucleotide Receptors and STING in Triple-Negative Breast Cancer. Cancers (Basel). 2022;14: pubmed publisher
LI Y, Fahrmann J, Aftabizadeh M, Zhao Q, Tripathi S, Zhang C, et al. Fatty acid oxidation protects cancer cells from apoptosis by increasing mitochondrial membrane lipids. Cell Rep. 2022;39:110870 pubmed publisher
Gulyurtlu S, Magoń M, Guest P, Papavasiliou P, Morrison K, Prescott A, et al. Condensation properties of stress granules and processing bodies are compromised in Myotonic Dystrophy Type 1. Dis Model Mech. 2022;: pubmed publisher
Khodeer S, Klungland A, Dahl J. ALKBH5 regulates somatic cell reprogramming in a phase-specific manner. J Cell Sci. 2022;135: pubmed publisher
Tan K, Wu W, Zhu K, Lu L, Lv Z. Identification and Characterization of a Glucometabolic Prognostic Gene Signature in Neuroblastoma based on N6-methyladenosine Eraser ALKBH5. J Cancer. 2022;13:2105-2125 pubmed publisher
Mukha D, Fokra M, Feldman A, Sarvin B, Sarvin N, Nevo Dinur K, et al. Glycine decarboxylase maintains mitochondrial protein lipoylation to support tumor growth. Cell Metab. 2022;34:775-782.e9 pubmed publisher
Haddock S, Alban T, Turcan S, Husic H, Rosiek E, Ma X, et al. Phenotypic and molecular states of IDH1 mutation-induced CD24-positive glioma stem-like cells. Neoplasia. 2022;28:100790 pubmed publisher
Fessler E, Krumwiede L, Jae L. DELE1 tracks perturbed protein import and processing in human mitochondria. Nat Commun. 2022;13:1853 pubmed publisher
Sala M, Allain N, Moreau M, Jabouille A, Henriet E, Abou Hammoud A, et al. Discoidin Domain Receptor 2 orchestrates melanoma resistance combining phenotype switching and proliferation. Oncogene. 2022;41:2571-2586 pubmed publisher
Jiang T, Yang J, Yang H, Chen W, Ji K, Xu Y, et al. SLC35B4 Stabilizes c-MYC Protein by O-GlcNAcylation in HCC. Front Pharmacol. 2022;13:851089 pubmed publisher
Szewczyk M, Luciani G, Vu V, Murison A, Dilworth D, Barghout S, et al. PRMT5 regulates ATF4 transcript splicing and oxidative stress response. Redox Biol. 2022;51:102282 pubmed publisher
Sun T, Ding C, Zhang Y, Zhang Y, Lin C, Wu J, et al. MESH1 knockdown triggers proliferation arrest through TAZ repression. Cell Death Dis. 2022;13:221 pubmed publisher
Vaidyanathan S, Salmi T, Sathiqu R, McConville M, Cox A, Brown K. YAP regulates an SGK1/mTORC1/SREBP-dependent lipogenic program to support proliferation and tissue growth. Dev Cell. 2022;57:719-731.e8 pubmed publisher
Wang J, Yu X, Gong W, Liu X, Park K, Ma A, et al. EZH2 noncanonically binds cMyc and p300 through a cryptic transactivation domain to mediate gene activation and promote oncogenesis. Nat Cell Biol. 2022;24:384-399 pubmed publisher
Blaha C, Ramakrishnan G, Jeon S, Nogueira V, Rho H, Kang S, et al. A non-catalytic scaffolding activity of hexokinase 2 contributes to EMT and metastasis. Nat Commun. 2022;13:899 pubmed publisher
Czarnek M, Stalinska K, Sarad K, Bereta J. shRNAs targeting mouse Adam10 diminish cell response to proinflammatory stimuli independently of Adam10 silencing. Biol Open. 2022;11: pubmed publisher
Sementino E, Kadariya Y, Cheung M, Menges C, Tan Y, Kukuyan A, et al. Inactivation of p21-Activated Kinase 2 (Pak2) Inhibits the Development of Nf2-Deficient Tumors by Restricting Downstream Hedgehog and Wnt Signaling. Mol Cancer Res. 2022;20:699-711 pubmed publisher
Xu Y, Yu Q, Wang P, Wu Z, Zhang L, Wu S, et al. A Selective Small-Molecule c-Myc Degrader Potently Regresses Lethal c-Myc Overexpressing Tumors. Adv Sci (Weinh). 2022;9:e2104344 pubmed publisher
Bhattacharya A, Fushimi A, Yamashita N, Hagiwara M, Morimoto Y, Rajabi H, et al. MUC1-C Dictates JUN and BAF-Mediated Chromatin Remodeling at Enhancer Signatures in Cancer Stem Cells. Mol Cancer Res. 2022;20:556-567 pubmed publisher
Togami K, Chung S, Madan V, Booth C, Kenyon C, Cabal Hierro L, et al. Sex-Biased ZRSR2 Mutations in Myeloid Malignancies Impair Plasmacytoid Dendritic Cell Activation and Apoptosis. Cancer Discov. 2022;12:522-541 pubmed publisher
Bleijs M, Pleijte C, Engels S, Ringnalda F, Meyer Wentrup F, van de Wetering M, et al. EWSR1-WT1 Target Genes and Therapeutic Options Identified in a Novel DSRCT In Vitro Model. Cancers (Basel). 2021;13: pubmed publisher
Krantz S, Kim Y, Srivastava S, Leasure J, Toth P, Marsboom G, et al. Mitophagy mediates metabolic reprogramming of induced pluripotent stem cells undergoing endothelial differentiation. J Biol Chem. 2021;297:101410 pubmed publisher
Li J, Wu X, Schiffmann L, MacVicar T, Zhou C, Wang Z, et al. IL-17B/RB Activation in Pancreatic Stellate Cells Promotes Pancreatic Cancer Metabolism and Growth. Cancers (Basel). 2021;13: pubmed publisher
Yu L, Zhou D, Zhang G, Ren Z, Luo X, Liu P, et al. Co-occurrence of BAP1 and SF3B1 mutations in uveal melanoma induces cellular senescence. Mol Oncol. 2021;: pubmed publisher
Luan Z, Morimoto Y, Fushimi A, Yamashita N, Suo W, Bhattacharya A, et al. MUC1-C Dictates Neuroendocrine Lineage Specification in Pancreatic Ductal Adenocarcinomas. Carcinogenesis. 2021;: pubmed publisher
Junqueira Alves C, Dariolli R, Haydak J, Kang S, Hannah T, Wiener R, et al. Plexin-B2 orchestrates collective stem cell dynamics via actomyosin contractility, cytoskeletal tension and adhesion. Nat Commun. 2021;12:6019 pubmed publisher
Bhutda S, Ghosh S, Sinha A, Santra S, Hiray A, Banerjee A. Differential ubiquitination as an effective strategy employed by the Blood-Brain Barrier for prevention of bacterial transcytosis. J Bacteriol. 2021;:JB0045621 pubmed publisher
Li J, Ohmura S, Marchetto A, Orth M, Imle R, Dallmayer M, et al. Therapeutic targeting of the PLK1-PRC1-axis triggers cell death in genomically silent childhood cancer. Nat Commun. 2021;12:5356 pubmed publisher
Gong Z, Xue L, Wei M, Liu Z, Vlantis A, van Hasselt C, et al. The Knockdown of Nrf2 Suppressed Tumor Growth and Increased the Sensitivity to Lenvatinib in Anaplastic Thyroid Cancer. Oxid Med Cell Longev. 2021;2021:3900330 pubmed publisher
Jaiswal A, Murakami K, Elia A, Shibahara Y, Done S, Wood S, et al. Therapeutic inhibition of USP9x-mediated Notch signaling in triple-negative breast cancer. Proc Natl Acad Sci U S A. 2021;118: pubmed publisher
Camacho L, Zabala Letona A, Cortázar A, Astobiza I, Dominguez Herrera A, Ercilla A, et al. Identification of Androgen Receptor Metabolic Correlome Reveals the Repression of Ceramide Kinase by Androgens. Cancers (Basel). 2021;13: pubmed publisher
Villot R, Poirier A, Bakan I, Boulay K, Fernández E, Devillers R, et al. ZNF768 links oncogenic RAS to cellular senescence. Nat Commun. 2021;12:4841 pubmed publisher
Kremer D, Nelson B, Lin L, Yarosz E, Halbrook C, Kerk S, et al. GOT1 inhibition promotes pancreatic cancer cell death by ferroptosis. Nat Commun. 2021;12:4860 pubmed publisher
Raisch J, Côté Biron A, Langlois M, Leblanc C, Rivard N. Unveiling the Roles of Low-Density Lipoprotein Receptor-Related Protein 6 in Intestinal Homeostasis, Regeneration and Oncogenesis. Cells. 2021;10: pubmed publisher
Giuliani V, Miller M, Liu C, Hartono S, Class C, Bristow C, et al. PRMT1-dependent regulation of RNA metabolism and DNA damage response sustains pancreatic ductal adenocarcinoma. Nat Commun. 2021;12:4626 pubmed publisher
Kang H, Seo Y, Yun J, Song S, Han D, Cho E, et al. Metformin and Niclosamide Synergistically Suppress Wnt and YAP in APC-Mutated Colorectal Cancer. Cancers (Basel). 2021;13: pubmed publisher
Richter W, Shah R, Ruthenburg A. Non-canonical H3K79me2-dependent pathways promote the survival of MLL-rearranged leukemia. elife. 2021;10: pubmed publisher
Riscal R, Bull C, Mesaros C, Finan J, Carens M, Ho E, et al. Cholesterol auxotrophy as a targetable vulnerability in clear cell renal cell carcinoma. Cancer Discov. 2021;: pubmed publisher
Kharin L, Bychkov I, Karnaukhov N, Voloshin M, Fazliyeva R, Deneka A, et al. Prognostic role and biologic features of Musashi-2 expression in colon polyps and during colorectal cancer progression. PLoS ONE. 2021;16:e0252132 pubmed publisher
Doubleday P, Fornelli L, Ntai I, Kelleher N. Oncogenic KRAS creates an aspartate metabolism signature in colorectal cancer cells. FEBS J. 2021;288:6683-6699 pubmed publisher
Masurkar S, Deogharkar A, Bharambe H, Shirsat N. Downregulation of CRX, a Group 3-specific oncogenic transcription factor, inhibits TGF-β/activin signaling in medulloblastoma cells. Biochem Biophys Res Commun. 2021;568:76-82 pubmed publisher
Zhang S, Rehling D, Jemth A, Throup A, Landazuri N, Almlöf I, et al. NUDT15-mediated hydrolysis limits the efficacy of anti-HCMV drug ganciclovir. Cell Chem Biol. 2021;: pubmed publisher
Hagiwara M, Fushimi A, Yamashita N, Bhattacharya A, Rajabi H, Long M, et al. MUC1-C activates the PBAF chromatin remodeling complex in integrating redox balance with progression of human prostate cancer stem cells. Oncogene. 2021;40:4930-4940 pubmed publisher
Devenport S, Singhal R, Radyk M, Taranto J, Kerk S, Chen B, et al. Colorectal cancer cells utilize autophagy to maintain mitochondrial metabolism for cell proliferation under nutrient stress. JCI Insight. 2021;6: pubmed publisher
Cotter K, Gallon J, Uebersax N, Rubin P, Meyer K, Piscuoglio S, et al. Mapping of m6A and Its Regulatory Targets in Prostate Cancer Reveals a METTL3-Low Induction of Therapy Resistance. Mol Cancer Res. 2021;19:1398-1411 pubmed publisher
Sacchetti A, Teeuwssen M, Verhagen M, Joosten R, Xu T, Stabile R, et al. Phenotypic plasticity underlies local invasion and distant metastasis in colon cancer. elife. 2021;10: pubmed publisher
Tao Y, Zhang J, Chen L, Liu X, Yao M, Zhang H. LncRNA CD27-AS1 promotes acute myeloid leukemia progression through the miR-224-5p/PBX3 signaling circuit. Cell Death Dis. 2021;12:510 pubmed publisher
Xu Q, Zhang J, Telfer B, Zhang H, Ali N, Chen F, et al. The extracellular-regulated protein kinase 5 (ERK5) enhances metastatic burden in triple-negative breast cancer through focal adhesion protein kinase (FAK)-mediated regulation of cell adhesion. Oncogene. 2021;40:3929-3941 pubmed publisher
Kim Y, Krantz S, Jambusaria A, Toth P, Moon H, Gunarathna I, et al. Mitofusin-2 stabilizes adherens junctions and suppresses endothelial inflammation via modulation of β-catenin signaling. Nat Commun. 2021;12:2736 pubmed publisher
Orzalli M, Prochera A, Payne L, Smith A, Garlick J, Kagan J. Virus-mediated inactivation of anti-apoptotic Bcl-2 family members promotes Gasdermin-E-dependent pyroptosis in barrier epithelial cells. Immunity. 2021;54:1447-1462.e5 pubmed publisher
Qiu R, Wu J, Gudenas B, Northcott P, Wechsler Reya R, Lu Q. Depletion of kinesin motor KIF20A to target cell fate control suppresses medulloblastoma tumour growth. Commun Biol. 2021;4:552 pubmed publisher
Deogharkar A, Singh S, Bharambe H, Paul R, Moiyadi A, Goel A, et al. Downregulation of ARID1B, a tumor-suppressor in the WNT subgroup medulloblastoma, activates multiple oncogenic signaling pathways. Hum Mol Genet. 2021;: pubmed publisher
Navinés Ferrer A, Ainsua Enrich E, Serrano Candelas E, Proaño Pérez E, Muñoz Cano R, Gastaminza G, et al. MYO1F Regulates IgE and MRGPRX2-Dependent Mast Cell Exocytosis. J Immunol. 2021;206:2277-2289 pubmed publisher
Supper E, Rudat S, Iyer V, Droop A, Wong K, Spinella J, et al. Cut-like homeobox 1 (CUX1) tumor suppressor gene haploinsufficiency induces apoptosis evasion to sustain myeloid leukemia. Nat Commun. 2021;12:2482 pubmed publisher
Dai J, He Y, Jiang M, Niu M, Li B, Wu Z, et al. Reg4 regulates pancreatic regeneration following pancreatitis via modulating the Notch signaling. J Cell Physiol. 2021;: pubmed publisher
Miyahara K, Takano N, Yamada Y, Kazama H, Tokuhisa M, Hino H, et al. BRCA1 degradation in response to mitochondrial damage in breast cancer cells. Sci Rep. 2021;11:8735 pubmed publisher
Vallejo A, Erice O, Entrialgo Cadierno R, Feliu I, Guruceaga E, Perugorria M, et al. FOSL1 promotes cholangiocarcinoma via transcriptional effectors that could be therapeutically targeted. J Hepatol. 2021;75:363-376 pubmed publisher
Zheng T, Ghasemi D, Okonechnikov K, Korshunov A, Sill M, Maass K, et al. Cross-species genomics reveals oncogenic dependencies in ZFTA/C11orf95 fusion-positive supratentorial ependymomas. Cancer Discov. 2021;: pubmed publisher
Huang H, Hu J, Maryam A, Huang Q, Zhang Y, Ramakrishnan S, et al. Defining super-enhancer landscape in triple-negative breast cancer by multiomic profiling. Nat Commun. 2021;12:2242 pubmed publisher
Corbin J, Georgescu C, Wren J, Xu C, Asch A, Ruiz Echevarría M. Seed-mediated RNA interference of androgen signaling and survival networks induces cell death in prostate cancer cells. Mol Ther Nucleic Acids. 2021;24:337-351 pubmed publisher
Cui Y, Yang S, Wei J, Shea C, Zhong W, Wang F, et al. Autophagy of the m6A mRNA demethylase FTO is impaired by low-level arsenic exposure to promote tumorigenesis. Nat Commun. 2021;12:2183 pubmed publisher
Niu Y, Lin Z, Wan A, Sun L, Yan S, Liang H, et al. Loss-of-function genetic screening identifies ALDOA as an essential driver for liver cancer cell growth under hypoxia. Hepatology. 2021;: pubmed publisher
Liu Y, Xu W, Xu X, Tan Z, Xu J, Ma L, et al. Loss of BRMS2 induces cell growth inhibition and translation capacity reduction in colorectal cancer cells. Am J Cancer Res. 2021;11:930-944 pubmed
Rashid M, Shah S, Verma T, Chaudhary N, Rauniyar S, Patel V, et al. Tumor-specific overexpression of histone gene, H3C14 in gastric cancer is mediated through EGFR-FOXC1 axis. Biochim Biophys Acta Gene Regul Mech. 2021;1864:194703 pubmed publisher
Makhov P, Bychkov I, Faezov B, Deneka A, Kudinov A, Nicolas E, et al. Musashi-2 (MSI2) regulates epidermal growth factor receptor (EGFR) expression and response to EGFR inhibitors in EGFR-mutated non-small cell lung cancer (NSCLC). Oncogenesis. 2021;10:29 pubmed publisher
Tang D, Zhang Z, Zboril E, Wetzel M, Xu X, Zhang W, et al. Pontin Functions as A Transcriptional Co-activator for Retinoic Acid-induced HOX Gene Expression. J Mol Biol. 2021;433:166928 pubmed publisher
Crowe M, Zavorotinskaya T, Voliva C, Shirley M, Wang Y, Ruddy D, et al. RAF-Mutant Melanomas Differentially Depend on ERK2 Over ERK1 to Support Aberrant MAPK Pathway Activation and Cell Proliferation. Mol Cancer Res. 2021;19:1063-1075 pubmed publisher
Li J, Ullah M, Jin H, Liang Y, Lin L, Wang J, et al. ORMDL3 Functions as a Negative Regulator of Antigen-Mediated Mast Cell Activation via an ATF6-UPR-Autophagy-Dependent Pathway. Front Immunol. 2021;12:604974 pubmed publisher
Gehmeyr J, Maghnouj A, Tjaden J, Vorgerd M, Hahn S, Matschke V, et al. Disabling VEGF-Response of Purkinje Cells by Downregulation of KDR via miRNA-204-5p. Int J Mol Sci. 2021;22: pubmed publisher
Kennedy A, Myers K, Bowman J, Gibson C, Camarda N, Furutani E, et al. Distinct genetic pathways define pre-malignant versus compensatory clonal hematopoiesis in Shwachman-Diamond syndrome. Nat Commun. 2021;12:1334 pubmed publisher
Day E, Zhong Q, Purow B, Lazzara M. Data-driven computational modeling identifies determinants of glioblastoma response to SHP2 inhibition. Cancer Res. 2021;: pubmed publisher
Patel P, Abraham K, Guturi K, Halaby M, Khan Z, Palomero L, et al. RNF168 regulates R-loop resolution and genomic stability in BRCA1/2-deficient tumors. J Clin Invest. 2021;131: pubmed publisher
Tameni A, Sauta E, Mularoni V, Torricelli F, Manzotti G, Inghirami G, et al. The DNA-helicase HELLS drives ALK- ALCL proliferation by the transcriptional control of a cytokinesis-related program. Cell Death Dis. 2021;12:130 pubmed publisher
Matsui H, Shirakawa K, Konishi Y, Hirabayashi S, Sarca A, Fukuda H, et al. CAGE-seq reveals that HIV-1 latent infection does not trigger unique cellular responses in a Jurkat T cell model. J Virol. 2021;: pubmed publisher
Yamashita N, Long M, Fushimi A, Yamamoto M, Hata T, Hagiwara M, et al. MUC1-C integrates activation of the IFN-γ pathway with suppression of the tumor immune microenvironment in triple-negative breast cancer. J Immunother Cancer. 2021;9: pubmed publisher
Larrue C, Guiraud N, Mouchel P, Dubois M, Farge T, Gotanègre M, et al. Adrenomedullin-CALCRL axis controls relapse-initiating drug tolerant acute myeloid leukemia cells. Nat Commun. 2021;12:422 pubmed publisher
Zhang Y, Gao X, Yi J, Sang X, Dai Z, Tao Z, et al. BTF3 confers oncogenic activity in prostate cancer through transcriptional upregulation of Replication Factor C. Cell Death Dis. 2021;12:12 pubmed publisher
Alpsoy A, Utturkar S, Carter B, Dhiman A, Torregrosa Allen S, Currie M, et al. BRD9 is a critical regulator of androgen receptor signaling and prostate cancer progression. Cancer Res. 2020;: pubmed publisher
Hagiwara M, Yasumizu Y, Yamashita N, Rajabi H, Fushimi A, Long M, et al. MUC1-C ACTIVATES THE BAF (mSWI/SNF) COMPLEX IN PROSTATE CANCER STEM CELLS. Cancer Res. 2020;: pubmed publisher
Hsieh A, Pitarresi J, Lerner J, Donahue G, Hsiehchen D, Rustgi A, et al. Growth of pancreatic cancers with hemizygous chromosomal 17p loss of MYBBP1A can be preferentially targeted by PARP inhibitors. Sci Adv. 2020;6: pubmed publisher
Parsels L, Engelke C, Parsels J, Flanagan S, Zhang Q, Tanska D, et al. Combinatorial Efficacy of Olaparib with Radiation and ATR Inhibitor Requires PARP1 Protein in Homologous Recombination-Proficient Pancreatic Cancer. Mol Cancer Ther. 2021;20:263-273 pubmed publisher
Wu B, Gan Y, Xu Y, Wu Z, Xu G, Wang P, et al. Identification of the novel Np17 oncogene in human leukemia. Aging (Albany NY). 2020;12:23647-23667 pubmed publisher
Sun H, Zhu A, Gao Y, Terajima H, Fei Q, Liu S, et al. Stabilization of ERK-Phosphorylated METTL3 by USP5 Increases m6A Methylation. Mol Cell. 2020;80:633-647.e7 pubmed publisher
Sviderskiy V, Blumenberg L, Gorodetsky E, Karakousi T, Hirsh N, Alvarez S, et al. Hyperactive CDK2 Activity in Basal-like Breast Cancer Imposes a Genome Integrity Liability that Can Be Exploited by Targeting DNA Polymerase ε. Mol Cell. 2020;80:682-698.e7 pubmed publisher
Baraibar I, Roman M, Rodriguez Remirez M, Lopez I, Vilalta A, Guruceaga E, et al. Id1 and PD-1 Combined Blockade Impairs Tumor Growth and Survival of KRAS-mutant Lung Cancer by Stimulating PD-L1 Expression and Tumor Infiltrating CD8+ T Cells. Cancers (Basel). 2020;12: pubmed publisher
Saliakoura M, Rossi Sebastiano M, Pozzato C, Heidel F, Schnöder T, Savic Prince S, et al. PLCγ1 suppression promotes the adaptation of KRAS-mutant lung adenocarcinomas to hypoxia. Nat Cell Biol. 2020;22:1382-1395 pubmed publisher
Kuznetsoff J, Owens D, Lopez A, Rodriguez D, Chee N, Kurtenbach S, et al. Dual Screen for Efficacy and Toxicity Identifies HDAC Inhibitor with Distinctive Activity Spectrum for BAP1-Mutant Uveal Melanoma. Mol Cancer Res. 2021;19:215-222 pubmed publisher
Kok Y, Guerrero Llobet S, Schoonen P, Everts M, Bhattacharya A, Fehrmann R, et al. Overexpression of Cyclin E1 or Cdc25A leads to replication stress, mitotic aberrancies, and increased sensitivity to replication checkpoint inhibitors. Oncogenesis. 2020;9:88 pubmed publisher
Ros S, Wright A, D Santos P, Hu D, Hesketh R, Lubling Y, et al. Metabolic Imaging Detects Resistance to PI3Kα Inhibition Mediated by Persistent FOXM1 Expression in ER+ Breast Cancer. Cancer Cell. 2020;38:516-533.e9 pubmed publisher
Kim K, Kim Y, Rivard C, Kim D, Park K. FGFR1 Is Critical for RBL2 Loss-Driven Tumor Development and Requires PLCG1 Activation for Continued Growth of Small Cell Lung Cancer. Cancer Res. 2020;80:5051-5062 pubmed publisher
Shahrouzi P, Astobiza I, Cortázar A, Torrano V, Macchia A, Flores J, et al. Genomic and Functional Regulation of TRIB1 Contributes to Prostate Cancer Pathogenesis. Cancers (Basel). 2020;12: pubmed publisher
Park S, Jo S, Kim J, Kim S, Ha J, Hwang J, et al. Combination Treatment with GSK126 and Pomalidomide Induces B-Cell Differentiation in EZH2 Gain-of-Function Mutant Diffuse Large B-Cell Lymphoma. Cancers (Basel). 2020;12: pubmed publisher
Wang Y, Chen Y, Bao L, Zhang B, Wang J, Kumar A, et al. CHD4 promotes breast cancer progression as a coactivator of hypoxia-inducible factors. Cancer Res. 2020;: pubmed publisher
Wang Z, Qin J, Zhao J, Li J, Li D, Popp M, et al. Inflammatory IFIT3 renders chemotherapy resistance by regulating post-translational modification of VDAC2 in pancreatic cancer. Theranostics. 2020;10:7178-7192 pubmed publisher
Zhang X, Fan X, Li F, Qiu J, Zhang Y. Effects of PYRIN-containing Apaf1-like protein 1 on isoflurane-induced postoperative cognitive dysfunction in aged rats. Mol Med Rep. 2020;22:1391-1399 pubmed publisher
Paul R, Bharambe H, Shirsat N. Autophagy inhibition impairs the invasion potential of medulloblastoma cells. Mol Biol Rep. 2020;: pubmed publisher
Koundouros N, Karali E, Tripp A, Valle A, Inglese P, Perry N, et al. Metabolic Fingerprinting Links Oncogenic PIK3CA with Enhanced Arachidonic Acid-Derived Eicosanoids. Cell. 2020;181:1596-1611.e27 pubmed publisher
Yang J, Kim N, Yun J, Cho E, Cha Y, Cho S, et al. Snail augments fatty acid oxidation by suppression of mitochondrial ACC2 during cancer progression. Life Sci Alliance. 2020;3: pubmed publisher
Li W, Zhang N, Jin C, Long M, Rajabi H, Yasumizu Y, et al. MUC1-C drives stemness in progression of colitis to colorectal cancer. JCI Insight. 2020;5: pubmed publisher
Yang L, Liu X, Song L, Su G, Di A, Bai C, et al. Melatonin restores the pluripotency of long-term-cultured embryonic stem cells through melatonin receptor-dependent m6A RNA regulation. J Pineal Res. 2020;:e12669 pubmed publisher
Bong S, Bae S, Song B, Gwak H, Yang S, Kim S, et al. Regulation of mRNA export through API5 and nuclear FGF2 interaction. Nucleic Acids Res. 2020;48:6340-6352 pubmed publisher
Pan J, Silva T, Gull N, Yang Q, Plummer J, Chen S, et al. Lineage-Specific Epigenomic and Genomic Activation of Oncogene HNF4A Promotes Gastrointestinal Adenocarcinomas. Cancer Res. 2020;80:2722-2736 pubmed publisher
Gilbert Girard S, Gravel A, Collin V, Wight D, Kaufer B, Lazzerini Denchi E, et al. Role for the shelterin protein TRF2 in human herpesvirus 6A/B chromosomal integration. PLoS Pathog. 2020;16:e1008496 pubmed publisher
Xia L, Bouamar H, Gu X, Zeballos C, Qin T, Wang B, et al. Gli2 mediates the development of castration‑resistant prostate cancer. Int J Oncol. 2020;57:100-112 pubmed publisher
Sharma S, Munger K. KDM6A-Mediated Expression of the Long Noncoding RNA DINO Causes TP53 Tumor Suppressor Stabilization in Human Papillomavirus 16 E7-Expressing Cells. J Virol. 2020;94: pubmed publisher
Qiu Z, Lin A, Jiang S, Elkashef S, Myers J, Srikantan S, et al. MYC Regulation of D2HGDH and L2HGDH Influences the Epigenome and Epitranscriptome. Cell Chem Biol. 2020;27:538-550.e7 pubmed publisher
Teraoka S, Muguruma M, Takano N, Miyahara K, Kawate T, Kaise H, et al. Association of BRCA Mutations and BRCAness Status With Anticancer Drug Sensitivities in Triple-Negative Breast Cancer Cell Lines. J Surg Res. 2020;250:200-208 pubmed publisher
Zhao B, Liu P, Fukumoto T, Nacarelli T, Fatkhutdinov N, Wu S, et al. Topoisomerase 1 cleavage complex enables pattern recognition and inflammation during senescence. Nat Commun. 2020;11:908 pubmed publisher
Wang H, Zhang S, Song L, Qu M, Zou Z. Synergistic lethality between PARP-trapping and alantolactone-induced oxidative DNA damage in homologous recombination-proficient cancer cells. Oncogene. 2020;39:2905-2920 pubmed publisher
Yu L, Kim J, Jiang L, Feng B, Ying Y, Ji K, et al. MTR4 drives liver tumorigenesis by promoting cancer metabolic switch through alternative splicing. Nat Commun. 2020;11:708 pubmed publisher
Ishihara E, Nagaoka Y, Okuno T, Kofuji S, Ishigami Yuasa M, Kagechika H, et al. Prostaglandin E2 and its receptor EP2 trigger signaling that contributes to YAP-mediated cell competition. Genes Cells. 2020;25:197-214 pubmed publisher
De Troyer L, Zhao P, Pastor T, Baietti M, Barra J, Vendramin R, et al. Stress-induced lncRNA LASTR fosters cancer cell fitness by regulating the activity of the U4/U6 recycling factor SART3. Nucleic Acids Res. 2020;48:2502-2517 pubmed publisher
Yasumizu Y, Rajabi H, Jin C, Hata T, Pitroda S, Long M, et al. MUC1-C regulates lineage plasticity driving progression to neuroendocrine prostate cancer. Nat Commun. 2020;11:338 pubmed publisher
Hanniford D, Ulloa Morales A, Karz A, Berzoti Coelho M, Moubarak R, Sánchez Sendra B, et al. Epigenetic Silencing of CDR1as Drives IGF2BP3-Mediated Melanoma Invasion and Metastasis. Cancer Cell. 2020;37:55-70.e15 pubmed publisher
Ware T, Franks C, Granade M, Zhang M, Kim K, Park K, et al. Reprogramming fatty acyl specificity of lipid kinases via C1 domain engineering. Nat Chem Biol. 2020;16:170-178 pubmed publisher
Liu Q, Borcherding N, Shao P, Maina P, Zhang W, Qi H. Contribution of synergism between PHF8 and HER2 signalling to breast cancer development and drug resistance. EBioMedicine. 2020;51:102612 pubmed publisher
Nacarelli T, Fukumoto T, Zundell J, Fatkhutdinov N, Jean S, Cadungog M, et al. NAMPT inhibition suppresses cancer stem-like cells associated with therapy-induced senescence in ovarian cancer. Cancer Res. 2019;: pubmed publisher
Hoj J, Mayro B, Pendergast A. A TAZ-AXL-ABL2 Feed-Forward Signaling Axis Promotes Lung Adenocarcinoma Brain Metastasis. Cell Rep. 2019;29:3421-3434.e8 pubmed publisher
Werner A, Pieh D, Echchannaoui H, Rupp J, Rajalingam K, Theobald M, et al. Cationic Amino Acid Transporter-1-Mediated Arginine Uptake Is Essential for Chronic Lymphocytic Leukemia Cell Proliferation and Viability. Front Oncol. 2019;9:1268 pubmed publisher
Satoh T, Mellett M, Meier Schiesser B, Fenini G, Otsuka A, Beer H, et al. IL-36γ drives skin toxicity induced by EGFR/MEK inhibition and commensal Cutibacterium acnes. J Clin Invest. 2019;: pubmed publisher
Huang Y, Mouttet B, Warnatz H, Risch T, Rietmann F, Frommelt F, et al. The Leukemogenic TCF3-HLF Complex Rewires Enhancers Driving Cellular Identity and Self-Renewal Conferring EP300 Vulnerability. Cancer Cell. 2019;36:630-644.e9 pubmed publisher
Ma G, Gezer D, Herrmann O, Feldberg K, Schemionek M, Jawhar M, et al. LCP1 triggers mTORC2/AKT activity and is pharmacologically targeted by enzastaurin in hypereosinophilia. Mol Carcinog. 2020;59:87-103 pubmed publisher
Valcarcel Jimenez L, Macchia A, Crosas Molist E, Schaub Clerigué A, Camacho L, Martin Martin N, et al. PGC1α Suppresses Prostate Cancer Cell Invasion through ERRα Transcriptional Control. Cancer Res. 2019;79:6153-6165 pubmed publisher
Arreal L, Piva M, Fernandez S, Revandkar A, Schaub Clerigué A, Villanueva J, et al. Targeting PML in triple negative breast cancer elicits growth suppression and senescence. Cell Death Differ. 2019;: pubmed publisher
Lim C, Davis O, Shin H, Zhang J, Berdan C, Jiang X, et al. ER-lysosome contacts enable cholesterol sensing by mTORC1 and drive aberrant growth signalling in Niemann-Pick type C. Nat Cell Biol. 2019;21:1206-1218 pubmed publisher
Hata T, Rajabi H, Takahashi H, Yasumizu Y, Li W, Jin C, et al. MUC1-C Activates the NuRD Complex to Drive Dedifferentiation of Triple-Negative Breast Cancer Cells. Cancer Res. 2019;79:5711-5722 pubmed publisher
Kim Y, Kim H, Kim H, Gawk H, Bae S, Sim H, et al. FAK-Copy-Gain Is a Predictive Marker for Sensitivity to FAK Inhibition in Breast Cancer. Cancers (Basel). 2019;11: pubmed publisher
Heijink A, Everts M, Honeywell M, Richards R, Kok Y, de Vries E, et al. Modeling of Cisplatin-Induced Signaling Dynamics in Triple-Negative Breast Cancer Cells Reveals Mediators of Sensitivity. Cell Rep. 2019;28:2345-2357.e5 pubmed publisher
Hsieh M, Choe J, Gadhvi J, Kim Y, Arguez M, Palmer M, et al. p63 and SOX2 Dictate Glucose Reliance and Metabolic Vulnerabilities in Squamous Cell Carcinomas. Cell Rep. 2019;28:1860-1878.e9 pubmed publisher
Nishimura N, Radwan M, Amano M, Endo S, Fujii E, Hayashi H, et al. Novel p97/VCP inhibitor induces endoplasmic reticulum stress and apoptosis in both bortezomib-sensitive and -resistant multiple myeloma cells. Cancer Sci. 2019;110:3275-3287 pubmed publisher
Kallunki T, Barisic M, Jaattela M, Liu B. How to Choose the Right Inducible Gene Expression System for Mammalian Studies?. Cells. 2019;8: pubmed publisher
Field M, Kuznetsov J, Bussies P, Cai L, Alawa K, Decatur C, et al. BAP1 Loss Is Associated with DNA Methylomic Repatterning in Highly Aggressive Class 2 Uveal Melanomas. Clin Cancer Res. 2019;25:5663-5673 pubmed publisher
Sastre Perona A, Hoang Phou S, Leitner M, Okuniewska M, Meehan S, Schober M. De Novo PITX1 Expression Controls Bi-Stable Transcriptional Circuits to Govern Self-Renewal and Differentiation in Squamous Cell Carcinoma. Cell Stem Cell. 2019;24:390-404.e8 pubmed publisher
Kim J, Yu L, Chen W, Xu Y, Wu M, Todorova D, et al. Wild-Type p53 Promotes Cancer Metabolic Switch by Inducing PUMA-Dependent Suppression of Oxidative Phosphorylation. Cancer Cell. 2019;35:191-203.e8 pubmed publisher
Paschos K, Bazot Q, Lees J, Farrell P, Allday M. Requirement for PRC1 subunit BMI1 in host gene activation by Epstein-Barr virus protein EBNA3C. Nucleic Acids Res. 2019;47:2807-2821 pubmed publisher
Heijink A, Talens F, Jae L, van Gijn S, Fehrmann R, Brummelkamp T, et al. BRCA2 deficiency instigates cGAS-mediated inflammatory signaling and confers sensitivity to tumor necrosis factor-alpha-mediated cytotoxicity. Nat Commun. 2019;10:100 pubmed publisher
Sun Y, Bandi M, Lofton T, Smith M, Bristow C, Carugo A, et al. Functional Genomics Reveals Synthetic Lethality between Phosphogluconate Dehydrogenase and Oxidative Phosphorylation. Cell Rep. 2019;26:469-482.e5 pubmed publisher
Lee J, Kim S, Song J, Lee Y, Ko H. Anti-Human Rhinovirus 1B Activity of Dexamethasone viaGCR-Dependent Autophagy Activation. Osong Public Health Res Perspect. 2018;9:334-339 pubmed publisher
Oladimeji P, Wright W, Wu J, Chen T. RNA interference screen identifies NAA10 as a regulator of PXR transcription. Biochem Pharmacol. 2019;160:92-109 pubmed publisher
Roman M, Lopez I, Guruceaga E, Baraibar I, Ecay M, Collantes M, et al. Inhibitor of Differentiation-1 Sustains Mutant KRAS-Driven Progression, Maintenance, and Metastasis of Lung Adenocarcinoma via Regulation of a FOSL1 Network. Cancer Res. 2019;79:625-638 pubmed publisher
Wehde B, Rädler P, Shrestha H, Johnson S, Triplett A, Wagner K. Janus Kinase 1 Plays a Critical Role in Mammary Cancer Progression. Cell Rep. 2018;25:2192-2207.e5 pubmed publisher
Kubala M, Punj V, Placencio Hickok V, Fang H, Fernandez G, Sposto R, et al. Plasminogen Activator Inhibitor-1 Promotes the Recruitment and Polarization of Macrophages in Cancer. Cell Rep. 2018;25:2177-2191.e7 pubmed publisher
Villar Prados A, Wu S, Court K, Ma S, LaFargue C, Chowdhury M, et al. Predicting Novel Therapies and Targets: Regulation of Notch3 by the Bromodomain Protein BRD4. Mol Cancer Ther. 2019;18:421-436 pubmed publisher
Witwicki R, Ekram M, Qiu X, Janiszewska M, Shu S, Kwon M, et al. TRPS1 Is a Lineage-Specific Transcriptional Dependency in Breast Cancer. Cell Rep. 2018;25:1255-1267.e5 pubmed publisher
Marcus A, Mao A, Lensink Vasan M, Wang L, Vance R, Raulet D. Tumor-Derived cGAMP Triggers a STING-Mediated Interferon Response in Non-tumor Cells to Activate the NK Cell Response. Immunity. 2018;49:754-763.e4 pubmed publisher
Tu W, Shiah Y, Lourenco C, Mullen P, Dingar D, Redel C, et al. MYC Interacts with the G9a Histone Methyltransferase to Drive Transcriptional Repression and Tumorigenesis. Cancer Cell. 2018;34:579-595.e8 pubmed publisher
Bertero T, Oldham W, Grasset E, Bourget I, Boulter E, Pisano S, et al. Tumor-Stroma Mechanics Coordinate Amino Acid Availability to Sustain Tumor Growth and Malignancy. Cell Metab. 2019;29:124-140.e10 pubmed publisher
Lin C, Lo M, Moody R, Jiang H, Harouaka R, Stevers N, et al. Targeting LRP8 inhibits breast cancer stem cells in triple-negative breast cancer. Cancer Lett. 2018;438:165-173 pubmed publisher
Ackerman D, Tumanov S, Qiu B, Michalopoulou E, Spata M, Azzam A, et al. Triglycerides Promote Lipid Homeostasis during Hypoxic Stress by Balancing Fatty Acid Saturation. Cell Rep. 2018;24:2596-2605.e5 pubmed publisher
Song B, Kim D, Shin J, Bae S, Kim H, Won B, et al. OCT4 directly regulates stemness and extracellular matrix-related genes in human germ cell tumours. Biochem Biophys Res Commun. 2018;503:1980-1986 pubmed publisher
Brzek A, Cichocka M, Dolata J, Juzwa W, Schumperli D, Raczynska K. Positive cofactor 4 (PC4) contributes to the regulation of replication-dependent canonical histone gene expression. BMC Mol Biol. 2018;19:9 pubmed publisher
Yang D, Cheng D, Tu Q, Yang H, Sun B, Yan L, et al. HUWE1 controls the development of non-small cell lung cancer through down-regulation of p53. Theranostics. 2018;8:3517-3529 pubmed publisher
Barbieri E, Trizzino M, Welsh S, Owens T, Calabretta B, Carroll M, et al. Targeted Enhancer Activation by a Subunit of the Integrator Complex. Mol Cell. 2018;71:103-116.e7 pubmed publisher
Tsvetkov P, Adler J, Myers N, Biran A, Reuven N, Shaul Y. Oncogenic addiction to high 26S proteasome level. Cell Death Dis. 2018;9:773 pubmed publisher
Zhu H, Xia L, Shen Q, Zhao M, Gu X, Bouamar H, et al. Differential effects of GLI2 and GLI3 in regulating cervical cancer malignancy in vitro and in vivo. Lab Invest. 2018;98:1384-1396 pubmed publisher
Wu C, Jiang X, Wang X, Liu X, Li X, Yang B, et al. Human Cytomegalovirus Immediate Early 1 Protein Causes Loss of SOX2 from Neural Progenitor Cells by Trapping Unphosphorylated STAT3 in the Nucleus. J Virol. 2018;92: pubmed publisher
Chen H, Yu H, Yang M, Tarn W. DDX3 Activates CBC-eIF3-Mediated Translation of uORF-Containing Oncogenic mRNAs to Promote Metastasis in HNSCC. Cancer Res. 2018;78:4512-4523 pubmed publisher
Lee Y, Kim N, Cho E, Yang J, Cha Y, Kang H, et al. Dishevelled has a YAP nuclear export function in a tumor suppressor context-dependent manner. Nat Commun. 2018;9:2301 pubmed publisher
Sanchez D, Steger D, Skuli N, Bansal A, Simon M. PPARγ is dispensable for clear cell renal cell carcinoma progression. Mol Metab. 2018;14:139-149 pubmed publisher
Hong H, An O, Chan T, Ng V, Kwok H, Lin J, et al. Bidirectional regulation of adenosine-to-inosine (A-to-I) RNA editing by DEAH box helicase 9 (DHX9) in cancer. Nucleic Acids Res. 2018;46:7953-7969 pubmed publisher
Sakamoto K, Katayama R, Asaka R, Sakata S, Baba S, Nakasone H, et al. Recurrent 8q24 rearrangement in blastic plasmacytoid dendritic cell neoplasm: association with immunoblastoid cytomorphology, MYC expression, and drug response. Leukemia. 2018;32:2590-2603 pubmed publisher
Ng S, Yoshida N, Christie A, Ghandi M, Dharia N, Dempster J, et al. Targetable vulnerabilities in T- and NK-cell lymphomas identified through preclinical models. Nat Commun. 2018;9:2024 pubmed publisher
Hiraki M, Maeda T, Mehrotra N, Jin C, Alam M, Bouillez A, et al. Targeting MUC1-C suppresses BCL2A1 in triple-negative breast cancer. Signal Transduct Target Ther. 2018;3:13 pubmed publisher
Amaral P, Leonardi T, Han N, Viré E, Gascoigne D, Arias Carrasco R, et al. Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci. Genome Biol. 2018;19:32 pubmed publisher
Deel M, Slemmons K, Hinson A, Genadry K, Burgess B, Crose L, et al. The Transcriptional Coactivator TAZ Is a Potent Mediator of Alveolar Rhabdomyosarcoma Tumorigenesis. Clin Cancer Res. 2018;24:2616-2630 pubmed publisher
Caro Maldonado A, Camacho L, Zabala Letona A, Torrano V, Fern ndez Ruiz S, Zamacola Bascaran K, et al. Low-dose statin treatment increases prostate cancer aggressiveness. Oncotarget. 2018;9:1494-1504 pubmed publisher
Kim S, Song J, Ahn J, Lee G, Ahn H, Yoon S, et al. Antiviral and anti-inflammatory activity of budesonide against human rhinovirus infection mediated via autophagy activation. Antiviral Res. 2018;151:87-96 pubmed publisher
Bozal Basterra L, Martín Ruiz I, Pirone L, Liang Y, Sigurðsson J, Gonzalez Santamarta M, et al. Truncated SALL1 Impedes Primary Cilia Function in Townes-Brocks Syndrome. Am J Hum Genet. 2018;102:249-265 pubmed publisher
Jutten B, Keulers T, Peeters H, Schaaf M, Savelkouls K, Compter I, et al. EGFRvIII expression triggers a metabolic dependency and therapeutic vulnerability sensitive to autophagy inhibition. Autophagy. 2018;14:283-295 pubmed publisher
Vl kov K, Vachtenheim J, R da J, Hor k P, Ondru ov L. Inducibly decreased MITF levels do not affect proliferation and phenotype switching but reduce differentiation of melanoma cells. J Cell Mol Med. 2018;22:2240-2251 pubmed publisher
Hanna J, Garcia M, Lardennois A, Leavey P, Maglic D, Fagnan A, et al. PAX3-FOXO1 drives miR-486-5p and represses miR-221 contributing to pathogenesis of alveolar rhabdomyosarcoma. Oncogene. 2018;37:1991-2007 pubmed publisher
Li Y, Bakke J, Finkelstein D, Zeng H, Wu J, Chen T. HNRNPH1 is required for rhabdomyosarcoma cell growth and survival. Oncogenesis. 2018;7:9 pubmed publisher
Gwinn D, Lee A, Briones Martin del Campo M, Conn C, Simpson D, Scott A, et al. Oncogenic KRAS Regulates Amino Acid Homeostasis and Asparagine Biosynthesis via ATF4 and Alters Sensitivity to L-Asparaginase. Cancer Cell. 2018;33:91-107.e6 pubmed publisher
Maeda T, Hiraki M, Jin C, Rajabi H, Tagde A, Alam M, et al. MUC1-C Induces PD-L1 and Immune Evasion in Triple-Negative Breast Cancer. Cancer Res. 2018;78:205-215 pubmed publisher
He P, Yang J, Yang V, Bialkowska A. Krüppel-like Factor 5, Increased in Pancreatic Ductal Adenocarcinoma, Promotes Proliferation, Acinar-to-Ductal Metaplasia, Pancreatic Intraepithelial Neoplasia, and Tumor Growth in Mice. Gastroenterology. 2018;154:1494-1508.e13 pubmed publisher
Bajikar S, Wang C, Borten M, Pereira E, Atkins K, Janes K. Tumor-Suppressor Inactivation of GDF11 Occurs by Precursor Sequestration in Triple-Negative Breast Cancer. Dev Cell. 2017;43:418-435.e13 pubmed publisher
Shukla S, Cyrta J, Murphy D, Walczak E, Ran L, Agrawal P, et al. Aberrant Activation of a Gastrointestinal Transcriptional Circuit in Prostate Cancer Mediates Castration Resistance. Cancer Cell. 2017;32:792-806.e7 pubmed publisher
Mu Y, Yan X, Li D, Zhao D, Wang L, Wang X, et al. NUPR1 maintains autolysosomal efflux by activating SNAP25 transcription in cancer cells. Autophagy. 2018;14:654-670 pubmed publisher
Alwosaibai K, Abedini A, Al Hujaily E, Tang Y, Garson K, Collins O, et al. PAX2 maintains the differentiation of mouse oviductal epithelium and inhibits the transition to a stem cell-like state. Oncotarget. 2017;8:76881-76897 pubmed publisher
Orlacchio A, Ranieri M, Brave M, Arciuch V, Forde T, De Martino D, et al. SGK1 Is a Critical Component of an AKT-Independent Pathway Essential for PI3K-Mediated Tumor Development and Maintenance. Cancer Res. 2017;77:6914-6926 pubmed publisher
Tagde A, Markert T, Rajabi H, Hiraki M, Alam M, Bouillez A, et al. Targeting MUC1-C suppresses polycomb repressive complex 1 in multiple myeloma. Oncotarget. 2017;8:69237-69249 pubmed publisher
Cheng J, Park D, Berrios C, White E, Arora R, Yoon R, et al. Merkel cell polyomavirus recruits MYCL to the EP400 complex to promote oncogenesis. PLoS Pathog. 2017;13:e1006668 pubmed publisher
Huang H, Seo H, Zhang T, Wang Y, Jiang B, Li Q, et al. MELK is not necessary for the proliferation of basal-like breast cancer cells. elife. 2017;6: pubmed publisher
Slemmons K, Crose L, Riedel S, Sushnitha M, Belyea B, Linardic C. A Novel Notch-YAP Circuit Drives Stemness and Tumorigenesis in Embryonal Rhabdomyosarcoma. Mol Cancer Res. 2017;15:1777-1791 pubmed publisher
Hospital M, Jacquel A, Mazed F, Saland E, Larrue C, Mondesir J, et al. RSK2 is a new Pim2 target with pro-survival functions in FLT3-ITD-positive acute myeloid leukemia. Leukemia. 2018;32:597-605 pubmed publisher
Kranz P, Neumann F, Wolf A, Classen F, Pompsch M, Ocklenburg T, et al. PDI is an essential redox-sensitive activator of PERK during the unfolded protein response (UPR). Cell Death Dis. 2017;8:e2986 pubmed publisher
Rajabi H, Hiraki M, Tagde A, Alam M, Bouillez A, Christensen C, et al. MUC1-C activates EZH2 expression and function in human cancer cells. Sci Rep. 2017;7:7481 pubmed publisher
Maina P, Shao P, Jia X, Liu Q, Umesalma S, Marin M, et al. Histone demethylase PHF8 regulates hypoxia signaling through HIF1? and H3K4me3. Biochim Biophys Acta Gene Regul Mech. 2017;1860:1002-1012 pubmed publisher
Yang D, Sun B, Zhang X, Cheng D, Yu X, Yan L, et al. Huwe1 Sustains Normal Ovarian Epithelial Cell Transformation and Tumor Growth through the Histone H1.3-H19 Cascade. Cancer Res. 2017;77:4773-4784 pubmed publisher
Zabala Letona A, Arruabarrena Aristorena A, Martin Martin N, Fernandez Ruiz S, Sutherland J, Clasquin M, et al. mTORC1-dependent AMD1 regulation sustains polyamine metabolism in prostate cancer. Nature. 2017;547:109-113 pubmed publisher
Zarei M, Lal S, Parker S, Nevler A, Vaziri Gohar A, Dukleska K, et al. Posttranscriptional Upregulation of IDH1 by HuR Establishes a Powerful Survival Phenotype in Pancreatic Cancer Cells. Cancer Res. 2017;77:4460-4471 pubmed publisher
Ashwini A, Naganur S, Smitha B, Sheshadri P, Prasanna J, Kumar A. Cyclosporine A-Mediated IL-6 Expression Promotes Neural Induction in Pluripotent Stem Cells. Mol Neurobiol. 2018;55:4267-4279 pubmed publisher
Raices M, Bukata L, Sakuma S, Borlido J, Hernandez L, Hart D, et al. Nuclear Pores Regulate Muscle Development and Maintenance by Assembling a Localized Mef2C Complex. Dev Cell. 2017;41:540-554.e7 pubmed publisher
Karathedath S, Rajamani B, Musheer Aalam S, Abraham A, Varatharajan S, Krishnamurthy P, et al. Role of NF-E2 related factor 2 (Nrf2) on chemotherapy resistance in acute myeloid leukemia (AML) and the effect of pharmacological inhibition of Nrf2. PLoS ONE. 2017;12:e0177227 pubmed publisher
Choi E, Jung B, Lee S, Yoo H, Shin E, Ko H, et al. A clinical drug library screen identifies clobetasol propionate as an NRF2 inhibitor with potential therapeutic efficacy in KEAP1 mutant lung cancer. Oncogene. 2017;36:5285-5295 pubmed publisher
Lampada A, O Prey J, Szabadkai G, Ryan K, Hochhauser D, Salomoni P. mTORC1-independent autophagy regulates receptor tyrosine kinase phosphorylation in colorectal cancer cells via an mTORC2-mediated mechanism. Cell Death Differ. 2017;24:1045-1062 pubmed publisher
Ku A, Shaver T, Rao A, Howard J, Rodriguez C, Miao Q, et al. TCF7L1 promotes skin tumorigenesis independently of β-catenin through induction of LCN2. elife. 2017;6: pubmed publisher
Ahn S, Kim N, Lee K, Cha Y, Yang J, Cha S, et al. Niclosamide is a potential therapeutic for familial adenomatosis polyposis by disrupting Axin-GSK3 interaction. Oncotarget. 2017;8:31842-31855 pubmed publisher
Poulain L, Sujobert P, Zylbersztejn F, Barreau S, Stuani L, Lambert M, et al. High mTORC1 activity drives glycolysis addiction and sensitivity to G6PD inhibition in acute myeloid leukemia cells. Leukemia. 2017;31:2326-2335 pubmed publisher
Frank S, Schulz V, Miranti C. A streamlined method for the design and cloning of shRNAs into an optimized Dox-inducible lentiviral vector. BMC Biotechnol. 2017;17:24 pubmed publisher
Kohler R, Kettelhack H, Knipprath Mészaros A, Fedier A, Schoetzau A, Jacob F, et al. MELK expression in ovarian cancer correlates with poor outcome and its inhibition by OTSSP167 abrogates proliferation and viability of ovarian cancer cells. Gynecol Oncol. 2017;145:159-166 pubmed publisher
Shah M, Cardenas R, Wang B, Persson J, Mongan N, Grabowska A, et al. HOXC8 regulates self-renewal, differentiation and transformation of breast cancer stem cells. Mol Cancer. 2017;16:38 pubmed publisher
Zaini M, Muller C, Ackermann T, Reinshagen J, Kortman G, Pless O, et al. A screening strategy for the discovery of drugs that reduce C/EBPβ-LIP translation with potential calorie restriction mimetic properties. Sci Rep. 2017;7:42603 pubmed publisher
Paolella B, Gibson W, Urbanski L, Alberta J, Zack T, Bandopadhayay P, et al. Copy-number and gene dependency analysis reveals partial copy loss of wild-type SF3B1 as a novel cancer vulnerability. elife. 2017;6: pubmed publisher
Kim N, Cha Y, Lee J, Lee S, Yang J, Yun J, et al. Snail reprograms glucose metabolism by repressing phosphofructokinase PFKP allowing cancer cell survival under metabolic stress. Nat Commun. 2017;8:14374 pubmed publisher
Gayle S, Landrette S, Beeharry N, Conrad C, Hernandez M, Beckett P, et al. Identification of apilimod as a first-in-class PIKfyve kinase inhibitor for treatment of B-cell non-Hodgkin lymphoma. Blood. 2017;129:1768-1778 pubmed publisher
Paschos K, Bazot Q, Ho G, Parker G, Lees J, Barton G, et al. Core binding factor (CBF) is required for Epstein-Barr virus EBNA3 proteins to regulate target gene expression. Nucleic Acids Res. 2017;45:2368-2383 pubmed publisher
Hiraki M, Maeda T, Bouillez A, Alam M, Tagde A, Hinohara K, et al. MUC1-C activates BMI1 in human cancer cells. Oncogene. 2017;36:2791-2801 pubmed publisher
Yu L, Liang Y, Cao X, Wang X, Gao H, Lin S, et al. Identification of MYST3 as a novel epigenetic activator of ERα frequently amplified in breast cancer. Oncogene. 2017;36:2910-2918 pubmed publisher
Yang W, Nagasawa K, Münch C, Xu Y, Satterstrom K, Jeong S, et al. Mitochondrial Sirtuin Network Reveals Dynamic SIRT3-Dependent Deacetylation in Response to Membrane Depolarization. Cell. 2016;167:985-1000.e21 pubmed publisher
Chromá K, Mistrik M, Moudry P, Gursky J, Liptay M, Strauss R, et al. Tumors overexpressing RNF168 show altered DNA repair and responses to genotoxic treatments, genomic instability and resistance to proteotoxic stress. Oncogene. 2017;36:2405-2422 pubmed publisher
Maina P, Shao P, Liu Q, Fazli L, Tyler S, Nasir M, et al. c-MYC drives histone demethylase PHF8 during neuroendocrine differentiation and in castration-resistant prostate cancer. Oncotarget. 2016;7:75585-75602 pubmed publisher
Alam M, Bouillez A, Tagde A, Ahmad R, Rajabi H, Maeda T, et al. MUC1-C Represses the Crumbs Complex Polarity Factor CRB3 and Downregulates the Hippo Pathway. Mol Cancer Res. 2016;14:1266-1276 pubmed
Martin Martin N, Piva M, Urosevic J, Aldaz P, Sutherland J, Fernandez Ruiz S, et al. Stratification and therapeutic potential of PML in metastatic breast cancer. Nat Commun. 2016;7:12595 pubmed publisher
Lee Y, Kaduwal S, Lee K, Park J, Jeong W, Choi K. Sur8 mediates tumorigenesis and metastasis in colorectal cancer. Exp Mol Med. 2016;48:e249 pubmed publisher
Harwardt T, Lukas S, Zenger M, Reitberger T, Danzer D, Übner T, et al. Human Cytomegalovirus Immediate-Early 1 Protein Rewires Upstream STAT3 to Downstream STAT1 Signaling Switching an IL6-Type to an IFNγ-Like Response. PLoS Pathog. 2016;12:e1005748 pubmed publisher
Murphy M, Chatterjee S, Jain S, KATARI M, DasGupta R. TCF7L1 Modulates Colorectal Cancer Growth by Inhibiting Expression of the Tumor-Suppressor Gene EPHB3. Sci Rep. 2016;6:28299 pubmed publisher
Hiraki M, Suzuki Y, Alam M, Hinohara K, Hasegawa M, Jin C, et al. MUC1-C Stabilizes MCL-1 in the Oxidative Stress Response of Triple-Negative Breast Cancer Cells to BCL-2 Inhibitors. Sci Rep. 2016;6:26643 pubmed publisher
Wang Y, Li Y, Guo C, Lu Q, Wang W, Jia Z, et al. ISL1 and JMJD3 synergistically control cardiac differentiation of embryonic stem cells. Nucleic Acids Res. 2016;44:6741-55 pubmed publisher
Sun S, Cheng S, Zhu Y, Zhang P, Liu N, Xu T, et al. Identification of PRKDC (Protein Kinase, DNA-Activated, Catalytic Polypeptide) as an essential gene for colorectal cancer (CRCs) cells. Gene. 2016;584:90-6 pubmed publisher
Srinivas K, Viji R, Dan V, Sajitha I, Prakash R, Rahul P, et al. DEPTOR promotes survival of cervical squamous cell carcinoma cells and its silencing induces apoptosis through downregulating PI3K/AKT and by up-regulating p38 MAP kinase. Oncotarget. 2016;7:24154-71 pubmed publisher
Mungamuri S, Qiao R, Yao S, Manfredi J, Gu W, Aaronson S. USP7 Enforces Heterochromatinization of p53 Target Promoters by Protecting SUV39H1 from MDM2-Mediated Degradation. Cell Rep. 2016;14:2528-37 pubmed publisher
Pattabiraman D, Bierie B, Kober K, Thiru P, Krall J, Zill C, et al. Activation of PKA leads to mesenchymal-to-epithelial transition and loss of tumor-initiating ability. Science. 2016;351:aad3680 pubmed publisher
Hasegawa M, Takahashi H, Rajabi H, Alam M, Suzuki Y, Yin L, et al. Functional interactions of the cystine/glutamate antiporter, CD44v and MUC1-C oncoprotein in triple-negative breast cancer cells. Oncotarget. 2016;7:11756-69 pubmed publisher
Schlienger S, Campbell S, Pasquin S, Gaboury L, Claing A. ADP-ribosylation factor 1 expression regulates epithelial-mesenchymal transition and predicts poor clinical outcome in triple-negative breast cancer. Oncotarget. 2016;7:15811-27 pubmed publisher
Luo W, Chen I, Chen Y, Alkam D, Wang Y, Semenza G. PRDX2 and PRDX4 are negative regulators of hypoxia-inducible factors under conditions of prolonged hypoxia. Oncotarget. 2016;7:6379-97 pubmed publisher
El Karoui K, Viau A, Dellis O, Bagattin A, Nguyen C, BARON W, et al. Endoplasmic reticulum stress drives proteinuria-induced kidney lesions via Lipocalin 2. Nat Commun. 2016;7:10330 pubmed publisher
Jutz S, Leitner J, Schmetterer K, Doel Perez I, Majdic O, Grabmeier Pfistershammer K, et al. Assessment of costimulation and coinhibition in a triple parameter T cell reporter line: Simultaneous measurement of NF-κB, NFAT and AP-1. J Immunol Methods. 2016;430:10-20 pubmed publisher
Hsiao C, Lampe M, Nillasithanukroh S, Han W, Lian X, Palecek S. Human pluripotent stem cell culture density modulates YAP signaling. Biotechnol J. 2016;11:662-75 pubmed publisher
Jimbo M, Blanco F, Huang Y, Telonis A, Screnci B, Cosma G, et al. Targeting the mRNA-binding protein HuR impairs malignant characteristics of pancreatic ductal adenocarcinoma cells. Oncotarget. 2015;6:27312-31 pubmed publisher
Laperle A, Hsiao C, Lampe M, Mortier J, Saha K, Palecek S, et al. α-5 Laminin Synthesized by Human Pluripotent Stem Cells Promotes Self-Renewal. Stem Cell Reports. 2015;5:195-206 pubmed publisher
Jacque N, Ronchetti A, Larrue C, Meunier G, Birsen R, Willems L, et al. Targeting glutaminolysis has antileukemic activity in acute myeloid leukemia and synergizes with BCL-2 inhibition. Blood. 2015;126:1346-56 pubmed publisher
Zidek L, Ackermann T, Hartleben G, Eichwald S, Kortman G, Kiehntopf M, et al. Deficiency in mTORC1-controlled C/EBPβ-mRNA translation improves metabolic health in mice. EMBO Rep. 2015;16:1022-36 pubmed publisher
D Osualdo A, Anania V, Yu K, Lill J, Kaufman R, Matsuzawa S, et al. Transcription Factor ATF4 Induces NLRP1 Inflammasome Expression during Endoplasmic Reticulum Stress. PLoS ONE. 2015;10:e0130635 pubmed publisher
Kephart J, Tiller R, Crose L, Slemmons K, Chen P, Hinson A, et al. Secreted Frizzled-Related Protein 3 (SFRP3) Is Required for Tumorigenesis of PAX3-FOXO1-Positive Alveolar Rhabdomyosarcoma. Clin Cancer Res. 2015;21:4868-80 pubmed publisher
Qiu B, Ackerman D, Sanchez D, Li B, Ochocki J, Grazioli A, et al. HIF2α-Dependent Lipid Storage Promotes Endoplasmic Reticulum Homeostasis in Clear-Cell Renal Cell Carcinoma. Cancer Discov. 2015;5:652-67 pubmed publisher
Paster W, Bruger A, Katsch K, Grégoire C, Roncagalli R, Fu G, et al. A THEMIS:SHP1 complex promotes T-cell survival. EMBO J. 2015;34:393-409 pubmed publisher
Suarez C, Deng X, Hu C. Targeting CREB inhibits radiation-induced neuroendocrine differentiation and increases radiation-induced cell death in prostate cancer cells. Am J Cancer Res. 2014;4:850-61 pubmed
Shanzer M, Ricardo Lax I, Keshet R, Reuven N, Shaul Y. The polyomavirus middle T-antigen oncogene activates the Hippo pathway tumor suppressor Lats in a Src-dependent manner. Oncogene. 2015;34:4190-8 pubmed publisher
Siegle J, Basin A, Sastre Perona A, Yonekubo Y, Brown J, Sennett R, et al. SOX2 is a cancer-specific regulator of tumour initiating potential in cutaneous squamous cell carcinoma. Nat Commun. 2014;5:4511 pubmed publisher
Mungamuri S, Wang S, Manfredi J, Gu W, Aaronson S. Ash2L enables P53-dependent apoptosis by favoring stable transcription pre-initiation complex formation on its pro-apoptotic target promoters. Oncogene. 2015;34:2461-70 pubmed publisher
Zhang X, Ma D, Caruso M, Lewis M, Qi Y, Yi Z. Quantitative phosphoproteomics reveals novel phosphorylation events in insulin signaling regulated by protein phosphatase 1 regulatory subunit 12A. J Proteomics. 2014;109:63-75 pubmed publisher
Tiemann U, Marthaler A, Adachi K, Wu G, Fischedick G, Araúzo Bravo M, et al. Counteracting activities of OCT4 and KLF4 during reprogramming to pluripotency. Stem Cell Reports. 2014;2:351-65 pubmed publisher
Wu H, Whitfield T, Gordon J, Dobson J, Tai P, Van Wijnen A, et al. Genomic occupancy of Runx2 with global expression profiling identifies a novel dimension to control of osteoblastogenesis. Genome Biol. 2014;15:R52 pubmed publisher
Willems L, Jacque N, Jacquel A, Neveux N, Maciel T, Lambert M, et al. Inhibiting glutamine uptake represents an attractive new strategy for treating acute myeloid leukemia. Blood. 2013;122:3521-32 pubmed publisher
Itou J, Matsumoto Y, Yoshikawa K, Toi M. Sal-like 4 (SALL4) suppresses CDH1 expression and maintains cell dispersion in basal-like breast cancer. FEBS Lett. 2013;587:3115-21 pubmed publisher
Beronja S, Janki P, Heller E, Lien W, Keyes B, Oshimori N, et al. RNAi screens in mice identify physiological regulators of oncogenic growth. Nature. 2013;501:185-90 pubmed publisher
Burns T, Dobromilskaya I, Murphy S, Gajula R, Thiyagarajan S, Chatley S, et al. Inhibition of TWIST1 leads to activation of oncogene-induced senescence in oncogene-driven non-small cell lung cancer. Mol Cancer Res. 2013;11:329-38 pubmed publisher
He M, Jenkins P, Bennett V. Cysteine 70 of ankyrin-G is S-palmitoylated and is required for function of ankyrin-G in membrane domain assembly. J Biol Chem. 2012;287:43995-4005 pubmed publisher
Kobayashi A, Okuda H, Xing F, Pandey P, Watabe M, Hirota S, et al. Bone morphogenetic protein 7 in dormancy and metastasis of prostate cancer stem-like cells in bone. J Exp Med. 2011;208:2641-55 pubmed publisher
Wiederschain D, Wee S, Chen L, Loo A, Yang G, Huang A, et al. Single-vector inducible lentiviral RNAi system for oncology target validation. Cell Cycle. 2009;8:498-504 pubmed
product information
Catalog Number :
21915
Product Name :
Tet-pLKO-puro
article :
doi10.4161/cc.8.3.7701
id2795
pubmed_id19177017
bacterial resistance :
Ampicillin
cloning :
backboneTet-pLKO-puro
backbone_mutation
backbone_origin
backbone_size10633
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Lentiviral
growth notes :
This plasmid was called pLKO-Tet-On in the original publication. The name was changed to clarify that this plasmid does not contain and is not related to the trademarked Tet-On(R) system sold by Clontech. No other changes were made. Clontech does not support or recommend this product. Please look at the manual associated with this plasmid for detailed protocols. Note that no additional technical support or troubleshooting is available from the laboratory that created this plasmid beyond the published manual. For additional information please review the following reference - Wee, S., Wiederschain, D., Maira, S.-M., Loo, A., Miller, C., deBeaumont, R., Stegmeier, F., Yao, Y.-M., and Lengauer, C. PTEN-deficient cancers depend on PIK3CB, Proc Natl Acad Sci U S A. 105: 13057-62, 2008. Please cite the original publication when describing the use of this plasmid in a subsequent publication: Wiederschain et al., Cell Cycle. 2009 Feb 1. 8(3):498-504
growth strain :
3rd generation lentiviral plasmid for inducible expression of shRNA; puromycin selection. See manual for detailed protocols. No further technical support is available from the depositing laboratory.
growth temp :
recommend rec-deficient E.coli (Stbl3, SURE) at 37C
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5AgeI
promoter
sequencing_primer_3
sequencing_primer_5GGCAGGGATATTCACCATTATCGTTTCAGA
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
name
shRNA_sequence
size
species
tags
resistance markers :
580
tags :
Low Copy
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA