This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pFP121
catalog :
21670
citations: 1
Reference
Pâques F, Haber J. Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Mol Cell Biol. 1997;17:6765-71 pubmed
product information
Catalog Number :
21670
Product Name :
pFP121
article :
doi
id2721
pubmed_id9343441
bacterial resistance :
Ampicillin
cloning :
backboneTed
backbone_mutation
backbone_originW. Kramer
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Other
centromeric plasmid
growth notes :
Derived from Ted, a centromeric plasmid (provided by W. Kramer) marked by the URA3 gene. Contains two copies of the Escherichia coli lacZ gene in inverted orientation, with one copy containing an HO endonuclease cleavage site. Please note: Addgene was not able to sequence verify the critical features of this plasmid due to its repetitive nature.
origin :
37
pi :
alt_names
2 copies of lacZ
pJH1440
see author's map
cloning
clone_methodRestriction Enzyme
cloning_site_3Eco RI
cloning_site_5Bam Hi
promoter
sequencing_primer_3
sequencing_primer_5n/a
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesECIAI39_0334
genelacZ
id7151913
genbank_ids
mutationThe second lacZ sequence has been modified, the EcoRV/BclI fragment has been replaced by a 20-bp sequence (AGTTTCAGCTTTTTATAAAC), so that the nonhomologous sequences in the cut lacZ repeat are only 10 bp long on each side of the DSB. Second LacZ HO site is no longer present.
nameLacz
shRNA_sequence
size3000
species
E. coli
tags
resistance markers :
183
tags :
Unknown
terms :
URA3
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA