This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
GFP Cav2.2 HA L702P pcDNA3
catalog :
206056
product information
Catalog Number :
206056
Product Name :
GFP Cav2.2 HA L702P pcDNA3
article :
doi
id28238448
pubmed_id
bacterial resistance :
Ampicillin
cloning :
backbonepcDNA3
backbone_mutation
backbone_originInvitrogen Life Technologies
backbone_size5446
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
5' end of DNA is very GC rich
growth strain :
expression of rabbit Cav2.2 with a N-terminal GFP tag and an exofacial double HA tag in domain II and a L702P mutation that allows trafficking to the plasma membrane but channel is not functional
origin :
37
pi :
alt_names
Cav2.2 alpha1B
Cav2.2 HA
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5EcoRI
promoterCMV
sequencing_primer_3GCATTTAGGTGACACTATAG
sequencing_primer_5CTGGCTAACTAGAGAACC
site_3_destroyed
site_5_destroyed
entrez_gene
aliases
geneCACNA1B
id100008979
genbank_ids
mutationL702P
namecacna1b
shRNA_sequence
size7857
species
9986
Oryctolagus cuniculus
tags
locationN terminal on insert
tagGFP
plasmid copy :
Yasuo Mori
resistance markers :
2017
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA