This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO.1.sh.beta-catenin.2279
catalog :
19762
citations: 8
| Reference |
|---|
product information
Catalog Number :
19762
Product Name :
pLKO.1.sh.beta-catenin.2279
article :
| doi | 10.1038/nature07179 |
| id | 2325 |
| pubmed_id | 18794900 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pLKO.1 puro | |||
| backbone_mutation | ||||
| backbone_origin | ||||
| backbone_size | 7032 | |||
| promoter | ||||
| sequencing_primer_3 | ||||
| sequencing_primer_5 | ||||
| vector_types |
|
growth notes :
CCGGGCTTGGAATGAGACTGCTGATCTCGAGATCAGCAG
TCTCATTCCAAGCTTTTT
2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is:
TCTCATTCCAAGCTTTTT
2279 refers to the shRNA clone name from the RNAi Consortium at the Broad Institute and indicates the location on the CTNNB1 mRNA that is targeted. shRNA sequence for 2279 is:
origin :
37
pi :
|
resistance markers :
| 184 |
tags :
High Copy
terms :
| Puromycin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
