This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLKO.1 puro shSLC2A1-2
catalog :
193703
citations: 1
product information
Catalog Number :
193703
Product Name :
pLKO.1 puro shSLC2A1-2
article :
| doi | 10.1016/j.devcel.2021.12.006 |
| id | 28233167 |
| pubmed_id | 34990589 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pLKO.1 puro | |
| backbone_mutation | ||
| backbone_origin | ||
| backbone_size | ||
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth notes :
Clone ID: TRCN0000043587
growth strain :
Constitutive lentiviral expression of SLC2A1 shRNA
origin :
37
pi :
sapienstags
SDCHCNgene SL
C2A1 id 6513
td>
genbank_ids <
/tr>mutation
name SLC2A1 r>shRNA_sequence CCGGCTTCAA
AGTTCCTGAGACTAACTCGAGTTAGTCTCAGGAACTTTG
AAGTTTTTG size > species le>
SDCHCN
C2A1
td>
/tr>
AGTTCCTGAGACTAACTCGAGTTAGTCTCAGGAACTTTG
AAGTTTTTG
| 9606 | |||||||||||||||||||||||||||
Homo
|
