This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
scramble shRNA
catalog :
1864
citations: 333
Reference
Tarallo D, Mart xed nez J, Leyva A, M xf3 naco A, Perroni C, Tassano M, et al. Mitofusin 1 silencing decreases the senescent associated secretory phenotype, promotes immune cell recruitment and delays melanoma tumor growth after chemotherapy. Sci Rep. 2024;14:909 pubmed publisher
Tang Q, Sensale S, Bond C, Xing J, Qiao A, Hugelier S, et al. Interplay between stochastic enzyme activity and microtubule stability drives detyrosination enrichment on microtubule subsets. Curr Biol. 2023;33:5169-5184.e8 pubmed publisher
Taylor K, Piasecka A, Kajdasz A, Brz x119 k A, Polay Espinoza M, Bourgeois C, et al. Modulatory role of RNA helicases in MBNL-dependent alternative splicing regulation. Cell Mol Life Sci. 2023;80:335 pubmed publisher
Zhang W, Lu C, Nakamoto M, Tsai C, Roy A, Lee C, et al. Curved adhesions mediate cell attachment to soft matrix fibres in three dimensions. Nat Cell Biol. 2023;25:1453-1464 pubmed publisher
Liu Y, Yu K, Kong X, Zhang K, Wang L, Zhang N, et al. FOXA1 O-GlcNAcylation-mediated transcriptional switch governs metastasis capacity in breast cancer. Sci Adv. 2023;9:eadg7112 pubmed publisher
Wang L, Li G, Zhou Z, Ge C, Chen Q, Liu Y, et al. Chromatin-associated OGT promotes the malignant progression of hepatocellular carcinoma by activating ZNF263. Oncogene. 2023;42:2329-2346 pubmed publisher
Varghese G, Patra D, Jaikumar V, Rajan A, Latha N, Srinivas P. βhCG mediates immune suppression through upregulation of CD11b+ Gr1+ myeloid derived suppressor cells, CD206+ M2 macrophages, and CD4+ FOXP3+ regulatory T-cells in BRCA1 deficient breast cancers. Immunology. 2023;: pubmed publisher
Shi F, de Fatima Silva F, Liu D, Patel H, Xu J, Zhang W, et al. Salt-inducible kinase inhibition promotes the adipocyte thermogenic program and adipose tissue browning. Mol Metab. 2023;74:101753 pubmed publisher
Le Minh G, Esquea E, Dhameliya T, Merzy J, Lee M, Ball L, et al. Kruppel-like factor 8 regulates triple negative breast cancer stem cell-like activity. Front Oncol. 2023;13:1141834 pubmed publisher
Wang M, Wisniewski C, Xiong C, Chhoy P, Goel H, Kumar A, et al. Therapeutic blocking of VEGF binding to neuropilin-2 diminishes PD-L1 expression to activate antitumor immunity in prostate cancer. Sci Transl Med. 2023;15:eade5855 pubmed publisher
Kurden Pekmezci A, Cakiroglu E, Eris S, Mazi F, Coskun Deniz O, Dalgic E, et al. MALT1 paracaspase is overexpressed in hepatocellular carcinoma and promotes cancer cell survival and growth. Life Sci. 2023;323:121690 pubmed publisher
Zhang W, Lu C, Nakamoto M, Tsai C, Roy A, Lee C, et al. Curved adhesions mediate cell attachment to soft matrix fibres in 3D. bioRxiv. 2023;: pubmed publisher
Brambati A, Sacco O, Porcella S, Heyza J, Kareh M, Schmidt J, et al. RHINO restricts MMEJ activity to mitosis. bioRxiv. 2023;: pubmed publisher
Shinohara T, Yamamoto T, Morimoto H, Shiromoto Y, Kanatsu Shinohara M. Allogeneic offspring produced by induction of PD-L1 in spermatogonial stem cells via self-renewal stimulation. Stem Cell Reports. 2023;18:985-998 pubmed publisher
Eshima H, Shahtout J, Siripoksup P, Pearson M, Mahmassani Z, Ferrara P, et al. Lipid hydroperoxides promote sarcopenia through carbonyl stress. elife. 2023;12: pubmed publisher
Lu Z, Hu Q, Qin Y, Yang H, Xiao B, Chen W, et al. SETD8 inhibits ferroptosis in pancreatic cancer by inhibiting the expression of RRAD. Cancer Cell Int. 2023;23:50 pubmed publisher
Miyazaki T, Kanatsu Shinohara M, Ogonuki N, Matoba S, Ogura A, Yabe Nishimura C, et al. Glutamine protects mouse spermatogonial stem cells against NOX1-derived ROS for sustaining self-renewal division in vitro. Development. 2023;150: pubmed publisher
Couto Silva C, Nunes K, Venturini G, Ara xfa jo Castro E Silva M, Pereira L, Comas D, et al. Indigenous people from Amazon show genetic signatures of pathogen-driven selection. Sci Adv. 2023;9:eabo0234 pubmed publisher
Yang F, Kalantari S, Ruan B, Sun S, Bian Z, Guan J. Autophagy inhibition prevents lymphatic malformation progression to lymphangiosarcoma by decreasing osteopontin and Stat3 signaling. Nat Commun. 2023;14:978 pubmed publisher
Miyazaki Y, Goto T, Li X, Nakayama K, Okasho K, Takeda M, et al. Up-regulation of secretory leukocyte protease inhibitor in human samples might have a potential role of predicting prostate cancer recurrence and progression after surgery and hormonal therapy. Cancer Med. 2023;12:3328-3342 pubmed publisher
Choi K, Ko C, An S, Cho S, Rowland D, Kim J, et al. Regulation of beige adipocyte thermogenesis by the cold-repressed ER protein NNAT. Mol Metab. 2023;69:101679 pubmed publisher
Shmakova A, Popov V, Romanov I, Khabibullin N, Sabitova N, Karpukhina A, et al. Urokinase System in Pathogenesis of Pulmonary Fibrosis: A Hidden Threat of COVID-19. Int J Mol Sci. 2023;24: pubmed publisher
Llaurado Fernandez M, Hijmans E, Gennissen A, Wong N, Li S, Wisman G, et al. NOTCH Signaling Limits the Response of Low-Grade Serous Ovarian Cancers to MEK Inhibition. Mol Cancer Ther. 2022;21:1862-1874 pubmed publisher
Kaur H, Moreau R. Raptor knockdown concurrently increases the electrical resistance and paracellular permeability of Caco-2 cell monolayers. Life Sci. 2022;308:120989 pubmed publisher
Razpotnik R, Vidmar R, Fonovi x107 M, Rozman D, Re x17e en T. Circular RNA hsa_circ_0062682 Binds to YBX1 and Promotes Oncogenesis in Hepatocellular Carcinoma. Cancers (Basel). 2022;14: pubmed publisher
Mello A, Ngodup T, Lee Y, Donahue K, Li J, Rao A, et al. Hypoxia promotes an inflammatory phenotype of fibroblasts in pancreatic cancer. Oncogenesis. 2022;11:56 pubmed publisher
Rios Garcia M, Meissburger B, Chan J, de Guia R, Mattijssen F, Roessler S, et al. Trip13 Depletion in Liver Cancer Induces a Lipogenic Response Contributing to Plin2-Dependent Mitotic Cell Death. Adv Sci (Weinh). 2022;9:e2104291 pubmed publisher
Frey K, Goetze S, Rohrer L, von Eckardstein A, Wollscheid B. Decoding Functional High-Density Lipoprotein Particle Surfaceome Interactions. Int J Mol Sci. 2022;23: pubmed publisher
Liu H, Heller Trulli D, Moore C. Targeting the mRNA endonuclease CPSF73 inhibits breast cancer cell migration, invasion, and self-renewal. iScience. 2022;25:104804 pubmed publisher
Park S, Shon D, Kim J, Ryu Y, Ko Y. SAMM50 Regulates Thermogenesis of Beige Adipocytes Differentiated from Human Adipose-Derived Stem Cells by Balancing Mitochondrial Dynamics. Int J Mol Sci. 2022;23: pubmed publisher
Diaz Valdivia N, Simón L, Diaz J, Martínez Meza S, Contreras P, Burgos Ravanal R, et al. Mitochondrial Dysfunction and the Glycolytic Switch Induced by Caveolin-1 Phosphorylation Promote Cancer Cell Migration, Invasion, and Metastasis. Cancers (Basel). 2022;14: pubmed publisher
He B, Wang Z, Moreau R. Chylomicron production is repressed by RPTOR knockdown, R-α-lipoic acid and 4-phenylbutyric acid in human enterocyte-like Caco-2 cells. J Nutr Biochem. 2022;108:109087 pubmed publisher
Serna R, Ramrakhiani A, Hernández J, Chen C, Nakagawa C, Machida T, et al. c-JUN inhibits mTORC2 and glucose uptake to promote self-renewal and obesity. iScience. 2022;25:104325 pubmed publisher
Hall A, Pohl S, Cammareri P, Aitken S, Younger N, Raponi M, et al. RNA splicing is a key mediator of tumour cell plasticity and a therapeutic vulnerability in colorectal cancer. Nat Commun. 2022;13:2791 pubmed publisher
Kumar A, Lyu Y, Yanagihashi Y, Chantarasrivong C, Majerciak V, Salemi M, et al. KSHV episome tethering sites on host chromosomes and regulation of latency-lytic switch by CHD4. Cell Rep. 2022;39:110788 pubmed publisher
Vicente Acosta A, Gimenez Cassina A, Diaz Nido J, Loría F. The smoothened agonist SAG reduces mitochondrial dysfunction and neurotoxicity of frataxin-deficient astrocytes. J Neuroinflammation. 2022;19:93 pubmed publisher
Zhu Z, Kitano T, Morimatsu M, Tanaka A, Morioka R, Lin X, et al. BRCA2 C-Terminal RAD51-Binding Domain Confers Resistance to DNA-Damaging Agents. Int J Mol Sci. 2022;23: pubmed publisher
Jeltema D, Wang J, Cai J, Kelley N, Yang Z, He Y. A Single Amino Acid Residue Defines the Difference in NLRP3 Inflammasome Activation between NEK7 and NEK6. J Immunol. 2022;208:2029-2036 pubmed publisher
Ayloo S, Lazo C, Sun S, Zhang W, Cui B, Gu C. Pericyte-to-endothelial cell signaling via vitronectin-integrin regulates blood-CNS barrier. Neuron. 2022;110:1641-1655.e6 pubmed publisher
Kummer D, Steinbacher T, Thölmann S, Schwietzer M, Hartmann C, Horenkamp S, et al. A JAM-A-tetraspanin-αvβ5 integrin complex regulates contact inhibition of locomotion. J Cell Biol. 2022;221: pubmed publisher
Florian A, Woodley C, Wang J, Grieb B, Slota M, Guerrazzi K, et al. Synergistic action of WDR5 and HDM2 inhibitors in SMARCB1-deficient cancer cells. NAR Cancer. 2022;4:zcac007 pubmed publisher
Wang Y, Bao G, Zhang M, Xiang J, Zhou H, Wahafu A, et al. CRB2 enhances malignancy of glioblastoma via activation of the NF-κB pathway. Exp Cell Res. 2022;414:113077 pubmed publisher
Chen H, Yu Y, Yang M, Huang H, Ma S, Hu J, et al. YTHDF1 promotes breast cancer progression by facilitating FOXM1 translation in an m6A-dependent manner. Cell Biosci. 2022;12:19 pubmed publisher
Kim M, Jeong H, Krainc D. Lysosomal ceramides regulate Cathepsin B-mediated processing of saposin C and glucocerebrosidase activity. Hum Mol Genet. 2022;: pubmed publisher
Kim H, Jang S, Lee Y. The m6A(m)-independent role of FTO in regulating WNT signaling pathways. Life Sci Alliance. 2022;5: pubmed publisher
Li Y, Zhu Y, Feng S, Ishida Y, Chiu T, Saito T, et al. Macrophages activated by hepatitis B virus have distinct metabolic profiles and suppress the virus via IL-1β to downregulate PPARα and FOXO3. Cell Rep. 2022;38:110284 pubmed publisher
Martin M, Sandhu P, Kumar R, Buchkovich N. The Immune-Specific E3 Ubiquitin Ligase MARCH1 Is Upregulated during Human Cytomegalovirus Infection to Regulate Iron Levels. J Virol. 2022;96:e0180621 pubmed publisher
Zhao J, Dong Y, Chen X, Xiao X, Tan B, Chen G, et al. p53 Inhibition Protects against Neuronal Ischemia/Reperfusion Injury by the p53/PRAS40/mTOR Pathway. Oxid Med Cell Longev. 2021;2021:4729465 pubmed publisher
Abokyi S, Shan S, Lam C, Catral K, Pan F, Chan H, et al. Targeting Lysosomes to Reverse Hydroquinone-Induced Autophagy Defects and Oxidative Damage in Human Retinal Pigment Epithelial Cells. Int J Mol Sci. 2021;22: pubmed publisher
Taylor S, Ramsamooj S, Liang R, Katti A, Pozovskiy R, VASAN N, et al. Dietary fructose improves intestinal cell survival and nutrient absorption. Nature. 2021;597:263-267 pubmed publisher
Quadri R, Sertic S, Ghilardi A, Rondelli D, Gallo G, Del Giacco L, et al. Phosphorylation of H3-Thr3 by Haspin Is Required for Primary Cilia Regulation. Int J Mol Sci. 2021;22: pubmed publisher
Lee B, Boyer J, Burnett G, Thottumkara A, Tibrewal N, Wilson S, et al. Selective inhibitors of mTORC1 activate 4EBP1 and suppress tumor growth. Nat Chem Biol. 2021;: pubmed publisher
Huang N, Li S, Xie Y, Han Q, Xu X, Sheng Z. Reprogramming an energetic AKT-PAK5 axis boosts axon energy supply and facilitates neuron survival and regeneration after injury and ischemia. Curr Biol. 2021;31:3098-3114.e7 pubmed publisher
Conlon M, Poltorack C, Forcina G, Armenta D, Mallais M, Perez M, et al. A compendium of kinetic modulatory profiles identifies ferroptosis regulators. Nat Chem Biol. 2021;17:665-674 pubmed publisher
Arenas E, Martínez Sabadell A, Rius Ruiz I, Román Alonso M, Escorihuela M, Luque A, et al. Acquired cancer cell resistance to T cell bispecific antibodies and CAR T targeting HER2 through JAK2 down-modulation. Nat Commun. 2021;12:1237 pubmed publisher
Uneda A, Kurozumi K, Fujimura A, Fujii K, Ishida J, Shimazu Y, et al. Differentiated glioblastoma cells accelerate tumor progression by shaping the tumor microenvironment via CCN1-mediated macrophage infiltration. Acta Neuropathol Commun. 2021;9:29 pubmed publisher
Muendlein H, Connolly W, Magri Z, Smirnova I, Ilyukha V, Gautam A, et al. ZBP1 promotes LPS-induced cell death and IL-1β release via RHIM-mediated interactions with RIPK1. Nat Commun. 2021;12:86 pubmed publisher
Kaur H, Moreau R. Curcumin represses mTORC1 signaling in Caco-2 cells by a two-sided mechanism involving the loss of IRS-1 and activation of AMPK. Cell Signal. 2021;78:109842 pubmed publisher
Kaur H, Moreau R. Curcumin steers THP-1 cells under LPS and mTORC1 challenges toward phenotypically resting, low cytokine-producing macrophages. J Nutr Biochem. 2021;88:108553 pubmed publisher
Duan Y, Zhang L, Angosto Bazarra D, Pelegrin P, Nunez G, He Y. RACK1 Mediates NLRP3 Inflammasome Activation by Promoting NLRP3 Active Conformation and Inflammasome Assembly. Cell Rep. 2020;33:108405 pubmed publisher
Dean J, He A, Tan M, Wang J, Lu D, Razani B, et al. MED19 Regulates Adipogenesis and Maintenance of White Adipose Tissue Mass by Mediating PPARγ-Dependent Gene Expression. Cell Rep. 2020;33:108228 pubmed publisher
Fujimura A, Yasui S, Igawa K, Ueda A, Watanabe K, Hanafusa T, et al. In Vitro Studies to Define the Cell-Surface and Intracellular Targets of Polyarginine-Conjugated Sodium Borocaptate as a Potential Delivery Agent for Boron Neutron Capture Therapy. Cells. 2020;9: pubmed publisher
Zhan H, Bhattacharya S, Cai H, Iglesias P, Huang C, Devreotes P. An Excitable Ras/PI3K/ERK Signaling Network Controls Migration and Oncogenic Transformation in Epithelial Cells. Dev Cell. 2020;54:608-623.e5 pubmed publisher
Brownmiller T, Juric J, Ivey A, Harvey B, Westemeier E, Winters M, et al. Y Chromosome LncRNA are involved in Radiation Response of Male Non-Small Cell Lung Cancer Cells. Cancer Res. 2020;: pubmed publisher
Sobral L, Sechler M, Parrish J, McCann T, Jones K, Black J, et al. KDM3A/Ets1/MCAM axis promotes growth and metastatic properties in Rhabdomyosarcoma. Genes Cancer. 2020;11:53-65 pubmed publisher
Ho K, Yang X, Osipovich A, Cabrera O, Hayashi M, Magnuson M, et al. Glucose Regulates Microtubule Disassembly and the Dose of Insulin Secretion Via Tau Phosphorylation. Diabetes. 2020;: pubmed publisher
Wang S, Liu J, Qin J, Zhu Y, Tin V, Yam J, et al. CAMK2A supported tumor initiating cells of lung adenocarcinoma by upregulating SOX2 through EZH2 phosphorylation. Cell Death Dis. 2020;11:410 pubmed publisher
Dan X, Babbar M, Moore A, Wechter N, Tian J, Mohanty J, et al. DNA damage invokes mitophagy through a pathway involving Spata18. Nucleic Acids Res. 2020;48:6611-6623 pubmed publisher
Nagaki Y, Motoyama S, Yamaguchi T, Hoshizaki M, Sato Y, Sato T, et al. m6 A demethylase ALKBH5 promotes proliferation of esophageal squamous cell carcinoma associated with poor prognosis. Genes Cells. 2020;: pubmed publisher
Bare D, Cherny V, DeCoursey T, Abukhdeir A, Morgan D. Expression and function of voltage gated proton channels (Hv1) in MDA-MB-231 cells. PLoS ONE. 2020;15:e0227522 pubmed publisher
Sun Q, Fan G, Zhuo Q, Dai W, Ye Z, Ji S, et al. Pin1 promotes pancreatic cancer progression and metastasis by activation of NF-κB-IL-18 feedback loop. Cell Prolif. 2020;53:e12816 pubmed publisher
Martello A, Lauriola A, Mellis D, Parish E, Dawson J, Imrie L, et al. Trichoplein binds PCM1 and controls endothelial cell function by regulating autophagy. EMBO Rep. 2020;21:e48192 pubmed publisher
Yang F, Sun S, Wang C, Haas M, Yeo S, Guan J. Targeted therapy for mTORC1-driven tumours through HDAC inhibition by exploiting innate vulnerability of mTORC1 hyper-activation. Br J Cancer. 2020;122:1791-1802 pubmed publisher
Zhou B, Chen T, Jiang Y, Wei X, Lu C, Li J, et al. Scinderin suppresses cell proliferation and predicts the poor prognosis of hepatocellular carcinoma. Oncol Lett. 2020;19:2011-2020 pubmed publisher
Yamamoto S, Lee S, Matsuzaki H, Kumagai Takei N, Yoshitome K, Sada N, et al. Enhanced expression of nicotinamide nucleotide transhydrogenase (NNT) and its role in a human T cell line continuously exposed to asbestos. Environ Int. 2020;138:105654 pubmed publisher
Smolina N, Khudiakov A, Knyazeva A, Zlotina A, Sukhareva K, Kondratov K, et al. Desmin mutations result in mitochondrial dysfunction regardless of their aggregation properties. Biochim Biophys Acta Mol Basis Dis. 2020;1866:165745 pubmed publisher
Bryan A, Wang J, Howard G, Guarnaccia A, Woodley C, Aho E, et al. WDR5 is a conserved regulator of protein synthesis gene expression. Nucleic Acids Res. 2020;48:2924-2941 pubmed publisher
Ashcroft S, Bass J, Kazi A, Atherton P, Philp A. The vitamin D receptor regulates mitochondrial function in C2C12 myoblasts. Am J Physiol Cell Physiol. 2020;318:C536-C541 pubmed publisher
Escoll M, Lastra D, Pajares M, Robledinos Antón N, Rojo A, Fernández Ginés R, et al. Transcription factor NRF2 uses the Hippo pathway effector TAZ to induce tumorigenesis in glioblastomas. Redox Biol. 2020;30:101425 pubmed publisher
Ma L, Cao Y, Hu J, Chu M. Casein kinase 2 interacting protein 1 positively regulates caudal-related homeobox 1 in intestinal-type gastric cancer. Chin Med J (Engl). 2020;133:154-164 pubmed publisher
Llorens M, Rossi F, García I, Cooke M, Abba M, Lopez Haber C, et al. PKCα Modulates Epithelial-to-Mesenchymal Transition and Invasiveness of Breast Cancer Cells Through ZEB1. Front Oncol. 2019;9:1323 pubmed publisher
Hu R, Lu Z. Long non‑coding RNA HCP5 promotes prostate cancer cell proliferation by acting as the sponge of miR‑4656 to modulate CEMIP expression. Oncol Rep. 2019;: pubmed publisher
Qin F, Shi X, Li H. Knockdown of Chimeric RNA by RNAi. Methods Mol Biol. 2020;2079:143-154 pubmed publisher
Kang Y, Han S, Jeon H, Lee S, Lee J, Yoo S, et al. Nogo receptor-vimentin interaction: a novel mechanism for the invasive activity of glioblastoma multiforme. Exp Mol Med. 2019;51:125 pubmed publisher
Park H, Lee S, Lee J, Shin H, Yoo S, Lee M, et al. Suppression of CD81 promotes bladder cancer cell invasion through increased matrix metalloproteinase expression via extracellular signal-regulated kinase phosphorylation. Investig Clin Urol. 2019;60:396-404 pubmed publisher
Yang L, Ning Z, Wang L, Yan X, Meng Z. HSF2 regulates aerobic glycolysis by suppression of FBP1 in hepatocellular carcinoma. Am J Cancer Res. 2019;9:1607-1621 pubmed
Lu P, Hogan Cann A, Kamboj A, Roy Chowdhury S, Aghanoori M, Fernyhough P, et al. Poly(ADP-ribose) polymerase-1 inhibits mitochondrial respiration by suppressing PGC-1α activity in neurons. Neuropharmacology. 2019;160:107755 pubmed publisher
Milenkovic V, Slim D, Bader S, Koch V, Heinl E, Alvarez Carbonell D, et al. CRISPR-Cas9 Mediated TSPO Gene Knockout alters Respiration and Cellular Metabolism in Human Primary Microglia Cells. Int J Mol Sci. 2019;20: pubmed publisher
Stone N, Gifford C, Thomas R, Pratt K, Samse Knapp K, Mohamed T, et al. Context-Specific Transcription Factor Functions Regulate Epigenomic and Transcriptional Dynamics during Cardiac Reprogramming. Cell Stem Cell. 2019;25:87-102.e9 pubmed publisher
Wang W, Ishibashi J, Trefely S, Shao M, Cowan A, Sakers A, et al. A PRDM16-Driven Metabolic Signal from Adipocytes Regulates Precursor Cell Fate. Cell Metab. 2019;: pubmed publisher
Fuentes Villalobos F, Farkas C, Riquelme Barrios S, Armijo M, Soto Rifo R, Pincheira R, et al. DISC1 promotes translation maintenance during sodium arsenite-induced oxidative stress. Biochim Biophys Acta Gene Regul Mech. 2019;1862:657-669 pubmed publisher
Hou X, Khan M, Turmaine M, Thrasivoulou C, Becker D, Ahmed A. Wnt signaling regulates cytosolic translocation of Connexin 43. Am J Physiol Regul Integr Comp Physiol. 2019;: pubmed publisher
Qin Y, Hu Q, Xu J, Ji S, Dai W, Liu W, et al. PRMT5 enhances tumorigenicity and glycolysis in pancreatic cancer via the FBW7/cMyc axis. Cell Commun Signal. 2019;17:30 pubmed publisher
Wegner M, Diehl V, Bittl V, de Bruyn R, Wiechmann S, Matthess Y, et al. Circular synthesized CRISPR/Cas gRNAs for functional interrogations in the coding and noncoding genome. elife. 2019;8: pubmed publisher
Salvador Moreno N, Liu J, Haas K, Parker L, Chakraborty C, Kron S, et al. The nuclear structural protein NuMA is a negative regulator of 53BP1 in DNA double-strand break repair. Nucleic Acids Res. 2019;47:2703-2715 pubmed publisher
Wang H, Wang X, Zhang K, Wang Q, Cao X, Wang Z, et al. Rapid depletion of ESCRT protein Vps4 underlies injury-induced autophagic impediment and Wallerian degeneration. Sci Adv. 2019;5:eaav4971 pubmed publisher
Bajc Česnik A, Darovic S, Prpar Mihevc S, Stalekar M, Malnar M, Motaln H, et al. Nuclear RNA foci from C9ORF72 expansion mutation form paraspeckle-like bodies. J Cell Sci. 2019;132: pubmed publisher
Wang C, Tanjaya J, Shen J, Lee S, Bisht B, Pan H, et al. Peroxisome Proliferator-Activated Receptor-γ Knockdown Impairs Bone Morphogenetic Protein-2-Induced Critical-Size Bone Defect Repair. Am J Pathol. 2019;189:648-664 pubmed publisher
Bruns I, Sauer B, Burger M, Eriksson J, Hofmann U, Braun Y, et al. Disruption of peroxisome proliferator-activated receptor γ coactivator (PGC)-1α reverts key features of the neoplastic phenotype of glioma cells. J Biol Chem. 2019;294:3037-3050 pubmed publisher
Anderson E, Ghamari Langroudi M, Cakir I, Litt M, Chen V, Reggiardo R, et al. Late onset obesity in mice with targeted deletion of potassium inward rectifier Kir7.1 from cells expressing the melanocortin-4 receptor. J Neuroendocrinol. 2019;31:e12670 pubmed publisher
OhAinle M, Helms L, Vermeire J, Roesch F, Humes D, Basom R, et al. A virus-packageable CRISPR screen identifies host factors mediating interferon inhibition of HIV. elife. 2018;7: pubmed publisher
Kim D, Reyes Ordoñez A, Chen J. Lentivirus-Mediated RNAi in Skeletal Myogenesis. Methods Mol Biol. 2019;1889:95-110 pubmed publisher
Koutsioumpa M, Hatziapostolou M, Polytarchou C, Tolosa E, Almada L, Mahurkar Joshi S, et al. Lysine methyltransferase 2D regulates pancreatic carcinogenesis through metabolic reprogramming. Gut. 2019;68:1271-1286 pubmed publisher
Kim H, Kim D, Bae S, Gwak H, Jeon J, Kim J, et al. Farnesyl diphosphate synthase is important for the maintenance of glioblastoma stemness. Exp Mol Med. 2018;50:137 pubmed publisher
Duan L, Perez R, Maki C. Alpha ketoglutarate levels, regulated by p53 and OGDH, determine autophagy and cell fate/apoptosis in response to Nutlin-3a. Cancer Biol Ther. 2018;:1-9 pubmed publisher
Chen B, Zhang Y, Yang Y, Chen S, Xu A, Wu L, et al. Involvement of telomerase activity inhibition and telomere dysfunction in silver nanoparticles anticancer effects. Nanomedicine (Lond). 2018;13:2067-2082 pubmed publisher
Feehan R, Nelson A, Shantz L. Inhibition of mTORC2 enhances UVB-induced apoptosis in keratinocytes through a mechanism dependent on the FOXO3a transcriptional target NOXA but independent of TRAIL. Cell Signal. 2018;52:35-47 pubmed publisher
Khan S, LaCroix M, Boyle G, Sherman M, Brown J, Amar F, et al. Bidirectional modulation of Alzheimer phenotype by alpha-synuclein in mice and primary neurons. Acta Neuropathol. 2018;136:589-605 pubmed publisher
Messenger S, Woo S, Sun Z, Martin T. A Ca2+-stimulated exosome release pathway in cancer cells is regulated by Munc13-4. J Cell Biol. 2018;217:2877-2890 pubmed publisher
El Badawy A, Ghoneim N, Nasr M, Elkhenany H, Ahmed T, Ahmed S, et al. Telomerase reverse transcriptase coordinates with the epithelial-to-mesenchymal transition through a feedback loop to define properties of breast cancer stem cells. Biol Open. 2018;7: pubmed publisher
Williams E, Glauser L, Tsika E, Jiang H, Islam S, Moore D. Parkin mediates the ubiquitination of VPS35 and modulates retromer-dependent endosomal sorting. Hum Mol Genet. 2018;27:3189-3205 pubmed publisher
Hojo N, Huisken A, Wang H, Chirshev E, Kim N, Nguyen S, et al. Snail knockdown reverses stemness and inhibits tumour growth in ovarian cancer. Sci Rep. 2018;8:8704 pubmed publisher
Robeson A, Lindblom K, Wojton J, Kornbluth S, Matsuura K. Dimer-specific immunoprecipitation of active caspase-2 identifies TRAF proteins as novel activators. EMBO J. 2018;37: pubmed publisher
Kaur H, He B, Zhang C, Rodriguez E, Hage D, Moreau R. Piperine potentiates curcumin-mediated repression of mTORC1 signaling in human intestinal epithelial cells: implications for the inhibition of protein synthesis and TNF? signaling. J Nutr Biochem. 2018;57:276-286 pubmed publisher
Berns K, Caumanns J, Hijmans E, Gennissen A, Severson T, Evers B, et al. ARID1A mutation sensitizes most ovarian clear cell carcinomas to BET inhibitors. Oncogene. 2018;37:4611-4625 pubmed publisher
Jenkins C, Gusscott S, Wong R, Shevchuk O, Rana G, Giambra V, et al. RUNX1 promotes cell growth in human T-cell acute lymphoblastic leukemia by transcriptional regulation of key target genes. Exp Hematol. 2018;64:84-96 pubmed publisher
Chan K, Wong O, Wong E, Chan K, Ip P, Tse K, et al. Impact of iASPP on chemoresistance through PLK1 and autophagy in ovarian clear cell carcinoma. Int J Cancer. 2018;143:1456-1469 pubmed publisher
Wei C, Lin H, Cui S. The Forkhead Transcription Factor FOXC2 Is Required for Maintaining Murine Spermatogonial Stem Cells. Stem Cells Dev. 2018;27:624-636 pubmed publisher
Wang P, Xie R, Cheng M, Sapolsky R, Ji X, Zhao H. The mTOR cell signaling pathway is crucial to the long-term protective effects of ischemic postconditioning against stroke. Neurosci Lett. 2018;676:58-65 pubmed publisher
Han S, Pang M, Nelson C. Substratum stiffness tunes proliferation downstream of Wnt3a in part by regulating integrin-linked kinase and frizzled-1. J Cell Sci. 2018;131: pubmed publisher
Pappas B, Yang Y, Wang Y, Kim K, Chung H, Cheung M, et al. p23 protects the human aryl hydrocarbon receptor from degradation via a heat shock protein 90-independent mechanism. Biochem Pharmacol. 2018;152:34-44 pubmed publisher
Huang J, Kim D, Shan J, Abu Arish A, Luo Y, Hanrahan J. Most bicarbonate secretion by Calu-3 cells is mediated by CFTR and independent of pendrin. Physiol Rep. 2018;6: pubmed publisher
Lee M, Lee J, Lee S, Yoo S, Kim J, Kim W, et al. Clinical, prognostic, and therapeutic significance of heat shock protein 27 in bladder cancer. Oncotarget. 2018;9:7961-7974 pubmed publisher
Creus Muncunill J, Rue L, Alcalá Vida R, Badillos Rodríguez R, Romaní Aumedes J, Marco S, et al. Increased Levels of Rictor Prevent Mutant Huntingtin-Induced Neuronal Degeneration. Mol Neurobiol. 2018;55:7728-7742 pubmed publisher
Sampson N, Brunner E, Weber A, Puhr M, Schafer G, Szyndralewiez C, et al. Inhibition of Nox4-dependent ROS signaling attenuates prostate fibroblast activation and abrogates stromal-mediated protumorigenic interactions. Int J Cancer. 2018;143:383-395 pubmed publisher
Qi Z, Xu H, Zhang S, Xu J, Li S, Gao H, et al. RIPK4/PEBP1 axis promotes pancreatic cancer cell migration and invasion by activating RAF1/MEK/ERK signaling. Int J Oncol. 2018;52:1105-1116 pubmed publisher
Xiong J, Kawagishi H, Yan Y, Liu J, Wells Q, Edmunds L, et al. A Metabolic Basis for Endothelial-to-Mesenchymal Transition. Mol Cell. 2018;69:689-698.e7 pubmed publisher
Liu R, Zhang T, Zhu G, Xing M. Regulation of mutant TERT by BRAF V600E/MAP kinase pathway through FOS/GABP in human cancer. Nat Commun. 2018;9:579 pubmed publisher
Roilo M, Kullmann M, Hengst L. Cold-inducible RNA-binding protein (CIRP) induces translation of the cell-cycle inhibitor p27Kip1. Nucleic Acids Res. 2018;46:3198-3210 pubmed publisher
Bollaert E, Johanns M, Herinckx G, de Rocca Serra A, Vandewalle V, Havelange V, et al. HBP1 phosphorylation by AKT regulates its transcriptional activity and glioblastoma cell proliferation. Cell Signal. 2018;44:158-170 pubmed publisher
Zhang Y, Zhu T, Liu J, Liu J, Gao D, Su T, et al. FLNa negatively regulated proliferation and metastasis in lung adenocarcinoma A549 cells via suppression of EGFR. Acta Biochim Biophys Sin (Shanghai). 2018;50:164-170 pubmed publisher
Jeon H, Yoo S, Choi H, Mun J, Kang H, Lee J, et al. Extracellular vesicles from KSHV-infected endothelial cells activate the complement system. Oncotarget. 2017;8:99841-99860 pubmed publisher
De Dominici M, Porazzi P, Soliera A, Mariani S, Addya S, Fortina P, et al. Targeting CDK6 and BCL2 Exploits the "MYB Addiction" of Ph+ Acute Lymphoblastic Leukemia. Cancer Res. 2018;78:1097-1109 pubmed publisher
Jafferali M, Figueroa R, Hasan M, Hallberg E. Spindle associated membrane protein 1 (Samp1) is required for the differentiation of muscle cells. Sci Rep. 2017;7:16655 pubmed publisher
Kishore M, Cheung K, Fu H, Bonacina F, Wang G, Coe D, et al. Regulatory T Cell Migration Is Dependent on Glucokinase-Mediated Glycolysis. Immunity. 2017;47:875-889.e10 pubmed publisher
Gagliardi P, Somale D, Puliafito A, Chiaverina G, di Blasio L, Oneto M, et al. MRCKα is activated by caspase cleavage to assemble an apical actin ring for epithelial cell extrusion. J Cell Biol. 2018;217:231-249 pubmed publisher
Shukla S, Cyrta J, Murphy D, Walczak E, Ran L, Agrawal P, et al. Aberrant Activation of a Gastrointestinal Transcriptional Circuit in Prostate Cancer Mediates Castration Resistance. Cancer Cell. 2017;32:792-806.e7 pubmed publisher
Mendoza P, SILVA P, Diaz J, Arriagada C, Canales J, Cerda O, et al. Calpain2 mediates Rab5-driven focal adhesion disassembly and cell migration. Cell Adh Migr. 2018;12:185-194 pubmed publisher
Jayatilaka H, Giri A, Karl M, Aifuwa I, Trenton N, Phillip J, et al. EB1 and cytoplasmic dynein mediate protrusion dynamics for efficient 3-dimensional cell migration. FASEB J. 2018;32:1207-1221 pubmed publisher
Venkataramani V, Küffer S, Cheung K, Jiang X, Trumper L, Wulf G, et al. CD31 Expression Determines Redox Status and Chemoresistance in Human Angiosarcomas. Clin Cancer Res. 2018;24:460-473 pubmed publisher
Kim J, Kim Y, Stinski M, Ahn J, Song Y. Human Cytomegalovirus IE2 86 kDa Protein Induces STING Degradation and Inhibits cGAMP-Mediated IFN-β Induction. Front Microbiol. 2017;8:1854 pubmed publisher
Thiepold A, Lorenz N, Foltyn M, Engel A, Divé I, Urban H, et al. Mammalian target of rapamycin complex 1 activation sensitizes human glioma cells to hypoxia-induced cell death. Brain. 2017;140:2623-2638 pubmed publisher
Arnoult N, Correia A, Ma J, Merlo A, Garcia Gomez S, Maric M, et al. Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature. 2017;549:548-552 pubmed publisher
Vu L, Pickering B, Cheng Y, Zaccara S, Nguyen D, Minuesa G, et al. The N6-methyladenosine (m6A)-forming enzyme METTL3 controls myeloid differentiation of normal hematopoietic and leukemia cells. Nat Med. 2017;23:1369-1376 pubmed publisher
Wong K, Liu J, Chan K. KIF7 attenuates prostate tumor growth through LKB1-mediated AKT inhibition. Oncotarget. 2017;8:54558-54571 pubmed publisher
Godse N, Khan N, Yochum Z, Gomez Casal R, Kemp C, Shiwarski D, et al. TMEM16A/ANO1 Inhibits Apoptosis Via Downregulation of Bim Expression. Clin Cancer Res. 2017;23:7324-7332 pubmed publisher
Zhang Y, Kurupati R, Liu L, Zhou X, Zhang G, Hudaihed A, et al. Enhancing CD8+ T Cell Fatty Acid Catabolism within a Metabolically Challenging Tumor Microenvironment Increases the Efficacy of Melanoma Immunotherapy. Cancer Cell. 2017;32:377-391.e9 pubmed publisher
Bindels L, Porporato P, Ducastel S, Sboarina M, Neyrinck A, Dewulf E, et al. Ffar2 expression regulates leukaemic cell growth in vivo. Br J Cancer. 2017;117:1336-1340 pubmed publisher
Lee D, Yu E, Ham I, Hur H, Kim Y. AKT inhibition is an effective treatment strategy in ARID1A-deficient gastric cancer cells. Onco Targets Ther. 2017;10:4153-4159 pubmed publisher
Kwun H, Wendzicki J, Shuda Y, Moore P, Chang Y. Merkel cell polyomavirus small T antigen induces genome instability by E3 ubiquitin ligase targeting. Oncogene. 2017;36:6784-6792 pubmed publisher
Gallagher L, Radhi O, Abdullah M, McCluskey A, Boyd M, Chan E. Lysosomotropism depends on glucose: a chloroquine resistance mechanism. Cell Death Dis. 2017;8:e3014 pubmed publisher
Hertig V, Matos Nieves A, Garg V, Villeneuve L, Mamarbachi M, Caland L, et al. Nestin expression is dynamically regulated in cardiomyocytes during embryogenesis. J Cell Physiol. 2018;233:3218-3229 pubmed publisher
Kriebs A, Jordan S, Soto E, Henriksson E, Sandate C, Vaughan M, et al. Circadian repressors CRY1 and CRY2 broadly interact with nuclear receptors and modulate transcriptional activity. Proc Natl Acad Sci U S A. 2017;114:8776-8781 pubmed publisher
Guo Y, Cui J, Ji Z, Cheng C, Zhang K, Zhang C, et al. miR-302/367/LATS2/YAP pathway is essential for prostate tumor-propagating cells and promotes the development of castration resistance. Oncogene. 2017;36:6336-6347 pubmed publisher
Button R, Roberts S, Willis T, Hanemann C, Luo S. Accumulation of autophagosomes confers cytotoxicity. J Biol Chem. 2017;292:13599-13614 pubmed publisher
Binothman N, Hachim I, Lebrun J, Ali S. CPSF6 is a Clinically Relevant Breast Cancer Vulnerability Target: Role of CPSF6 in Breast Cancer. EBioMedicine. 2017;21:65-78 pubmed publisher
Gu Y, Albuquerque C, Braas D, Zhang W, Villa G, Bi J, et al. mTORC2 Regulates Amino Acid Metabolism in Cancer by Phosphorylation of the Cystine-Glutamate Antiporter xCT. Mol Cell. 2017;67:128-138.e7 pubmed publisher
Gatliff J, East D, Singh A, Alvarez M, Frison M, Matic I, et al. A role for TSPO in mitochondrial Ca2+ homeostasis and redox stress signaling. Cell Death Dis. 2017;8:e2896 pubmed publisher
Kraus R, Yu X, Cordes B, Sathiamoorthi S, Iempridee T, Nawandar D, et al. Hypoxia-inducible factor-1α plays roles in Epstein-Barr virus's natural life cycle and tumorigenesis by inducing lytic infection through direct binding to the immediate-early BZLF1 gene promoter. PLoS Pathog. 2017;13:e1006404 pubmed publisher
Ahsan M, Tchernychev B, Kessler M, Solinga R, Arthur D, Linde C, et al. Linaclotide activates guanylate cyclase-C/cGMP/protein kinase-II-dependent trafficking of CFTR in the intestine. Physiol Rep. 2017;5: pubmed publisher
Chatterjee S, Huang E, Christie I, Burns T. Reactivation of the p90RSK-CDC25C Pathway Leads to Bypass of the Ganetespib-Induced G2-M Arrest and Mediates Acquired Resistance to Ganetespib in KRAS-Mutant NSCLC. Mol Cancer Ther. 2017;16:1658-1668 pubmed publisher
Moore C, Parrish J, Jedlicka P. MiR-193b, downregulated in Ewing Sarcoma, targets the ErbB4 oncogene to inhibit anchorage-independent growth. PLoS ONE. 2017;12:e0178028 pubmed publisher
Nam M, Akie T, Sanosaka M, Craige S, Kant S, Keaney J, et al. Mitochondrial retrograde signaling connects respiratory capacity to thermogenic gene expression. Sci Rep. 2017;7:2013 pubmed publisher
Wald J, Hatakeyama J, Printsev I, Cuevas A, Fry W, Saldana M, et al. Suppression of planar cell polarity signaling and migration in glioblastoma by Nrdp1-mediated Dvl polyubiquitination. Oncogene. 2017;36:5158-5167 pubmed publisher
Lupey Green L, Moquin S, Martin K, McDevitt S, Hulse M, Caruso L, et al. PARP1 restricts Epstein Barr Virus lytic reactivation by binding the BZLF1 promoter. Virology. 2017;507:220-230 pubmed publisher
Ashkenazi A, Bento C, Ricketts T, Vicinanza M, Siddiqi F, Pavel M, et al. Polyglutamine tracts regulate beclin 1-dependent autophagy. Nature. 2017;545:108-111 pubmed publisher
Chan K, Matchett K, Coulter J, Yuen H, McCrudden C, Zhang S, et al. Erythropoietin drives breast cancer progression by activation of its receptor EPOR. Oncotarget. 2017;8:38251-38263 pubmed publisher
Gordon C, Gong X, Ganesh D, Brooks J. NUSAP1 promotes invasion and metastasis of prostate cancer. Oncotarget. 2017;8:29935-29950 pubmed publisher
Qu N, Hu J, Liu L, Zhang T, Sun G, Shi R, et al. SIRT6 is upregulated and associated with cancer aggressiveness in papillary thyroid cancer via BRAF/ERK/Mcl‑1 pathway. Int J Oncol. 2017;50:1683-1692 pubmed publisher
Sheu S, Chen J, Bee Y, Chen Y, Lin S, Shu C. Differential autophagic effects of vital dyes in retinal pigment epithelial ARPE-19 and photoreceptor 661W cells. PLoS ONE. 2017;12:e0174736 pubmed publisher
Suresh S, Chavalmane A, Dj V, Yarreiphang H, Rai S, Paul A, et al. A novel autophagy modulator 6-Bio ameliorates SNCA/?-synuclein toxicity. Autophagy. 2017;13:1221-1234 pubmed publisher
Su X, Liu S, Zhang X, Lam S, Hu X, Zhou Y, et al. Requirement of cytosolic phospholipase A2 gamma in lipid droplet formation. Biochim Biophys Acta Mol Cell Biol Lipids. 2017;1862:692-705 pubmed publisher
Ota K, Tong K, Goto K, Tomida S, Komuro A, Wang Z, et al. The H3K27 demethylase, Utx, regulates adipogenesis in a differentiation stage-dependent manner. PLoS ONE. 2017;12:e0173713 pubmed publisher
Sechler M, Parrish J, Birks D, Jedlicka P. The histone demethylase KDM3A, and its downstream target MCAM, promote Ewing Sarcoma cell migration and metastasis. Oncogene. 2017;36:4150-4160 pubmed publisher
Yamaji M, Jishage M, Meyer C, Suryawanshi H, Der E, Yamaji M, et al. DND1 maintains germline stem cells via recruitment of the CCR4-NOT complex to target mRNAs. Nature. 2017;543:568-572 pubmed publisher
Coomans de Brachène A, Dif N, de Rocca Serra A, Bonnineau C, Velghe A, Larondelle Y, et al. PDGF-induced fibroblast growth requires monounsaturated fatty acid production by stearoyl-CoA desaturase. FEBS Open Bio. 2017;7:414-423 pubmed publisher
Pappas L, Xu X, Abramson D, Jhanwar S. Genomic instability and proliferation/survival pathways in RB1-deficient malignancies. Adv Biol Regul. 2017;64:20-32 pubmed publisher
Walters B, Mercaldo V, Gillon C, Yip M, Neve R, BOYCE F, et al. The Role of The RNA Demethylase FTO (Fat Mass and Obesity-Associated) and mRNA Methylation in Hippocampal Memory Formation. Neuropsychopharmacology. 2017;42:1502-1510 pubmed publisher
Chatterjee S, Huang E, Christie I, Kurland B, Burns T. Acquired Resistance to the Hsp90 Inhibitor, Ganetespib, in KRAS-Mutant NSCLC Is Mediated via Reactivation of the ERK-p90RSK-mTOR Signaling Network. Mol Cancer Ther. 2017;16:793-804 pubmed publisher
Dahmene M, Bérard M, Oueslati A. Dissecting the Molecular Pathway Involved in PLK2 Kinase-mediated α-Synuclein-selective Autophagic Degradation. J Biol Chem. 2017;292:3919-3928 pubmed publisher
Demetriadou A, Morales Sanfrutos J, Nearchou M, Baba O, Kyriacou K, Tate E, et al. Mouse Stbd1 is N-myristoylated and affects ER-mitochondria association and mitochondrial morphology. J Cell Sci. 2017;130:903-915 pubmed publisher
Van Hée V, Labar D, Dehon G, Grasso D, Grégoire V, Muccioli G, et al. Radiosynthesis and validation of (±)-[18F]-3-fluoro-2-hydroxypropionate ([18F]-FLac) as a PET tracer of lactate to monitor MCT1-dependent lactate uptake in tumors. Oncotarget. 2017;8:24415-24428 pubmed publisher
Kamioka Y, Takakura K, Sumiyama K, Matsuda M. Intravital Förster resonance energy transfer imaging reveals osteopontin-mediated polymorphonuclear leukocyte activation by tumor cell emboli. Cancer Sci. 2017;108:226-235 pubmed publisher
Göllner S, Oellerich T, Agrawal Singh S, Schenk T, Klein H, Rohde C, et al. Loss of the histone methyltransferase EZH2 induces resistance to multiple drugs in acute myeloid leukemia. Nat Med. 2017;23:69-78 pubmed publisher
Pavel M, Imarisio S, Menzies F, Jimenez Sanchez M, Siddiqi F, Wu X, et al. CCT complex restricts neuropathogenic protein aggregation via autophagy. Nat Commun. 2016;7:13821 pubmed publisher
Gokhale A, Hartwig C, Freeman A, Das R, Zlatic S, Vistein R, et al. The Proteome of BLOC-1 Genetic Defects Identifies the Arp2/3 Actin Polymerization Complex to Function Downstream of the Schizophrenia Susceptibility Factor Dysbindin at the Synapse. J Neurosci. 2016;36:12393-12411 pubmed
Faes S, Duval A, Planche A, Uldry E, Santoro T, Pythoud C, et al. Acidic tumor microenvironment abrogates the efficacy of mTORC1 inhibitors. Mol Cancer. 2016;15:78 pubmed
Sulaiman A, Sulaiman B, Khouri L, McGarry S, Nessim C, Arnaout A, et al. Both bulk and cancer stem cell subpopulations in triple-negative breast cancer are susceptible to Wnt, HDAC, and ER? coinhibition. FEBS Lett. 2016;590:4606-4616 pubmed publisher
Perez Diaz S, García Rodríguez B, Gonzalez Irazabal Y, Valero M, Lagos Lizan J, Arbones Mainar J. Knockdown of PTRF ameliorates adipocyte differentiation and functionality of human mesenchymal stem cells. Am J Physiol Cell Physiol. 2017;312:C83-C91 pubmed publisher
Lopez Mosqueda J, Maddi K, Prgomet S, Kalayil S, Marinovic Terzic I, Terzic J, et al. SPRTN is a mammalian DNA-binding metalloprotease that resolves DNA-protein crosslinks. elife. 2016;5: pubmed publisher
Thompson J, Nguyen Q, Singh M, Pavesic M, Nesterenko I, Nelson L, et al. Rho-associated kinase 1 inhibition is synthetically lethal with von Hippel-Lindau deficiency in clear cell renal cell carcinoma. Oncogene. 2017;36:1080-1089 pubmed publisher
Chen W, Xu Y, Zhong J, Wang H, Weng M, Cheng Q, et al. MFHAS1 promotes colorectal cancer progress by regulating polarization of tumor-associated macrophages via STAT6 signaling pathway. Oncotarget. 2016;7:78726-78735 pubmed publisher
Kawakami H, Huang S, Pal K, Dutta S, Mukhopadhyay D, Sinicrope F. Mutant BRAF Upregulates MCL-1 to Confer Apoptosis Resistance that Is Reversed by MCL-1 Antagonism and Cobimetinib in Colorectal Cancer. Mol Cancer Ther. 2016;15:3015-3027 pubmed
Jørgensen S, Coskun M, Homburg K, Pedersen O, Troelsen J. HOXB4 Gene Expression Is Regulated by CDX2 in Intestinal Epithelial Cells. PLoS ONE. 2016;11:e0164555 pubmed publisher
Vasconcelos F, Sessa A, Laranjeira C, Raposo A, Teixeira V, Hagey D, et al. MyT1 Counteracts the Neural Progenitor Program to Promote Vertebrate Neurogenesis. Cell Rep. 2016;17:469-483 pubmed publisher
Wang B, McHugh B, Qureshi A, Campopiano D, Clarke D, Fitzgerald J, et al. IL-1β-Induced Protection of Keratinocytes against Staphylococcus aureus-Secreted Proteases Is Mediated by Human β-Defensin 2. J Invest Dermatol. 2017;137:95-105 pubmed publisher
Norambuena A, Wallrabe H, McMahon L, Silva A, Swanson E, Khan S, et al. mTOR and neuronal cell cycle reentry: How impaired brain insulin signaling promotes Alzheimer's disease. Alzheimers Dement. 2017;13:152-167 pubmed publisher
Hashimoto A, Hashimoto S, Sugino H, Yoshikawa A, Onodera Y, Handa H, et al. ZEB1 induces EPB41L5 in the cancer mesenchymal program that drives ARF6-based invasion, metastasis and drug resistance. Oncogenesis. 2016;5:e259 pubmed publisher
Reid M, Lowman X, Pan M, Tran T, Warmoes M, Ishak Gabra M, et al. IKKβ promotes metabolic adaptation to glutamine deprivation via phosphorylation and inhibition of PFKFB3. Genes Dev. 2016;30:1837-51 pubmed publisher
Li J, Yu H, Xi M, Lu X. Long noncoding RNA C17orf91 is a potential prognostic marker and functions as an oncogene in ovarian cancer. J Ovarian Res. 2016;9:49 pubmed publisher
Gusscott S, Jenkins C, Lam S, Giambra V, Pollak M, Weng A. IGF1R Derived PI3K/AKT Signaling Maintains Growth in a Subset of Human T-Cell Acute Lymphoblastic Leukemias. PLoS ONE. 2016;11:e0161158 pubmed publisher
Martin K, Lupey L, Tempera I. Epstein-Barr Virus Oncoprotein LMP1 Mediates Epigenetic Changes in Host Gene Expression through PARP1. J Virol. 2016;90:8520-30 pubmed publisher
Yan J, Fei Y, Han Y, Lu S. Selenoprotein O deficiencies suppress chondrogenic differentiation of ATDC5 cells. Cell Biol Int. 2016;40:1033-40 pubmed publisher
Chidley C, Trauger S, Birsoy K, O Shea E. The anticancer natural product ophiobolin A induces cytotoxicity by covalent modification of phosphatidylethanolamine. elife. 2016;5: pubmed publisher
Li Q, Qin Y, Wei P, Lian P, Li Y, Xu Y, et al. Gas1 Inhibits Metastatic and Metabolic Phenotypes in Colorectal Carcinoma. Mol Cancer Res. 2016;14:830-40 pubmed publisher
Yang J, Shen Z, Jiang X, Yang H, Huang H, Jin L, et al. Agonist-Activated Bombyx Corazonin Receptor Is Internalized via an Arrestin-Dependent and Clathrin-Independent Pathway. Biochemistry. 2016;55:3874-87 pubmed publisher
Coskun M, Soendergaard C, Joergensen S, Dahlgaard K, Riis L, Nielsen O, et al. Regulation of Laminin γ2 Expression by CDX2 in Colonic Epithelial Cells Is Impaired During Active Inflammation. J Cell Biochem. 2017;118:298-307 pubmed publisher
Gall B, Schroer A, Gross J, Setola V, Siderovski D. Reduction of GPSM3 expression akin to the arthritis-protective SNP rs204989 differentially affects migration in a neutrophil model. Genes Immun. 2016;17:321-7 pubmed publisher
Cormerais Y, Giuliano S, Lefloch R, Front B, Durivault J, Tambutte E, et al. Genetic Disruption of the Multifunctional CD98/LAT1 Complex Demonstrates the Key Role of Essential Amino Acid Transport in the Control of mTORC1 and Tumor Growth. Cancer Res. 2016;76:4481-92 pubmed publisher
Das F, Dey N, Bera A, Kasinath B, Ghosh Choudhury N, Choudhury G. MicroRNA-214 Reduces Insulin-like Growth Factor-1 (IGF-1) Receptor Expression and Downstream mTORC1 Signaling in Renal Carcinoma Cells. J Biol Chem. 2016;291:14662-76 pubmed publisher
Tilston Lünel A, Haley K, Schlecht N, Wang Y, Chatterton A, Moleirinho S, et al. Crumbs 3b promotes tight junctions in an ezrin-dependent manner in mammalian cells. J Mol Cell Biol. 2016;: pubmed
LeNoue Newton M, Wadzinski B, Spiller B. The three Type 2A protein phosphatases, PP2Ac, PP4c and PP6c, are differentially regulated by Alpha4. Biochem Biophys Res Commun. 2016;475:64-9 pubmed publisher
Feehan R, Shantz L. Negative regulation of the FOXO3a transcription factor by mTORC2 induces a pro-survival response following exposure to ultraviolet-B irradiation. Cell Signal. 2016;28:798-809 pubmed publisher
Hashimoto A, Oikawa T, Hashimoto S, Sugino H, Yoshikawa A, Otsuka Y, et al. P53- and mevalonate pathway-driven malignancies require Arf6 for metastasis and drug resistance. J Cell Biol. 2016;213:81-95 pubmed publisher
Gandin V, Masvidal L, Cargnello M, Gyenis L, McLaughlan S, Cai Y, et al. mTORC1 and CK2 coordinate ternary and eIF4F complex assembly. Nat Commun. 2016;7:11127 pubmed publisher
Thongon N, Castiglioni I, Zucal C, Latorre E, D Agostino V, Bauer I, et al. The GSK3β inhibitor BIS I reverts YAP-dependent EMT signature in PDAC cell lines by decreasing SMADs expression level. Oncotarget. 2016;7:26551-66 pubmed publisher
Takaoka S, Kamioka Y, Takakura K, Baba A, Shime H, Seya T, et al. Live imaging of transforming growth factor-β activated kinase 1 activation in Lewis lung carcinoma 3LL cells implanted into syngeneic mice and treated with polyinosinic:polycytidylic acid. Cancer Sci. 2016;107:644-52 pubmed publisher
Yalley A, Schill D, Hatta M, Johnson N, Cirillo L. Loss of Interdependent Binding by the FoxO1 and FoxA1/A2 Forkhead Transcription Factors Culminates in Perturbation of Active Chromatin Marks and Binding of Transcriptional Regulators at Insulin-sensitive Genes. J Biol Chem. 2016;291:8848-61 pubmed publisher
Imakawa K, Dhakal P, Kubota K, Kusama K, Chakraborty D, Karim Rumi M, et al. CITED2 modulation of trophoblast cell differentiation: insights from global transcriptome analysis. Reproduction. 2016;151:509-16 pubmed publisher
Wright H, Arulmoli J, Motazedi M, Nelson L, Heinemann F, Flanagan L, et al. CDCP1 cleavage is necessary for homodimerization-induced migration of triple-negative breast cancer. Oncogene. 2016;35:4762-72 pubmed publisher
Bado I, Nikolos F, Rajapaksa G, Gustafsson J, Thomas C. ERβ decreases the invasiveness of triple-negative breast cancer cells by regulating mutant p53 oncogenic function. Oncotarget. 2016;7:13599-611 pubmed publisher
Prior K, Wittig I, Leisegang M, Groenendyk J, Weissmann N, Michalak M, et al. The Endoplasmic Reticulum Chaperone Calnexin Is a NADPH Oxidase NOX4 Interacting Protein. J Biol Chem. 2016;291:7045-59 pubmed publisher
Ji S, Zhang B, Liu J, Qin Y, Liang C, Shi S, et al. ALDOA functions as an oncogene in the highly metastatic pancreatic cancer. Cancer Lett. 2016;374:127-135 pubmed publisher
Hashimoto S, Mikami S, Sugino H, Yoshikawa A, Hashimoto A, Onodera Y, et al. Lysophosphatidic acid activates Arf6 to promote the mesenchymal malignancy of renal cancer. Nat Commun. 2016;7:10656 pubmed publisher
Piotrowski Daspit A, Tien J, Nelson C. Interstitial fluid pressure regulates collective invasion in engineered human breast tumors via Snail, vimentin, and E-cadherin. Integr Biol (Camb). 2016;8:319-31 pubmed publisher
Llanos S, García Pedrero J, Morgado Palacin L, Rodrigo J, Serrano M. Stabilization of p21 by mTORC1/4E-BP1 predicts clinical outcome of head and neck cancers. Nat Commun. 2016;7:10438 pubmed publisher
Gall B, Wilson A, Schroer A, Gross J, Stoilov P, Setola V, et al. Genetic variations in GPSM3 associated with protection from rheumatoid arthritis affect its transcript abundance. Genes Immun. 2016;17:139-47 pubmed publisher
He Y, Zeng M, Yang D, Motro B, Núñez G. NEK7 is an essential mediator of NLRP3 activation downstream of potassium efflux. Nature. 2016;530:354-7 pubmed publisher
Jung Y, Nolta J. BMI1 Regulation of Self-Renewal and Multipotency in Human Mesenchymal Stem Cells. Curr Stem Cell Res Ther. 2016;11:131-40 pubmed
Hoofd C, Wang X, Lam S, JENKINS C, Wood B, Giambra V, et al. CD44 promotes chemoresistance in T-ALL by increased drug efflux. Exp Hematol. 2016;44:166-71.e17 pubmed publisher
Shan Y, Cortopassi G. Mitochondrial Hspa9/Mortalin regulates erythroid differentiation via iron-sulfur cluster assembly. Mitochondrion. 2016;26:94-103 pubmed publisher
Wu T, Chang S, Li C, Hsu Y, Chen T, Lee W, et al. Severe Hepatitis Promotes Hepatocellular Carcinoma Recurrence via NF-?B Pathway-Mediated Epithelial-Mesenchymal Transition after Resection. Clin Cancer Res. 2016;22:1800-12 pubmed publisher
Foss K, Robeson A, Kornbluth S, Zhang L. Mitotic phosphatase activity is required for MCC maintenance during the spindle checkpoint. Cell Cycle. 2016;15:225-33 pubmed publisher
Ruscetti M, Dadashian E, Guo W, Quach B, Mulholland D, Park J, et al. HDAC inhibition impedes epithelial-mesenchymal plasticity and suppresses metastatic, castration-resistant prostate cancer. Oncogene. 2016;35:3781-95 pubmed publisher
Pérez Escuredo J, Dadhich R, Dhup S, Cacace A, Van Hée V, De Saedeleer C, et al. Lactate promotes glutamine uptake and metabolism in oxidative cancer cells. Cell Cycle. 2016;15:72-83 pubmed publisher
D Agostino V, Lal P, Mantelli B, Tiedje C, Zucal C, Thongon N, et al. Dihydrotanshinone-I interferes with the RNA-binding activity of HuR affecting its post-transcriptional function. Sci Rep. 2015;5:16478 pubmed publisher
Zucal C, D Agostino V, Casini A, Mantelli B, Thongon N, Soncini D, et al. EIF2A-dependent translational arrest protects leukemia cells from the energetic stress induced by NAMPT inhibition. BMC Cancer. 2015;15:855 pubmed publisher
Birket M, Ribeiro M, Kosmidis G, Ward D, Leitoguinho A, van de Pol V, et al. Contractile Defect Caused by Mutation in MYBPC3 Revealed under Conditions Optimized for Human PSC-Cardiomyocyte Function. Cell Rep. 2015;13:733-745 pubmed publisher
Duan L, Perez R, Davaadelger B, Dedkova E, Blatter L, Maki C. p53-regulated autophagy is controlled by glycolysis and determines cell fate. Oncotarget. 2015;6:23135-56 pubmed
Lee D, Forscher C, Di Vizio D, Koeffler H. Induction of p53-independent apoptosis by ectopic expression of HOXA5 in human liposarcomas. Sci Rep. 2015;5:12580 pubmed publisher
Kruse C, Kurz A, Pálfi K, Humbert P, Sperandio M, Brandes R, et al. Polarity Protein Scrib Facilitates Endothelial Inflammatory Signaling. Arterioscler Thromb Vasc Biol. 2015;35:1954-62 pubmed publisher
Hui K, Cheung A, Choi C, Yeung P, Middeldorp J, Lung M, et al. Inhibition of class I histone deacetylases by romidepsin potently induces Epstein-Barr virus lytic cycle and mediates enhanced cell death with ganciclovir. Int J Cancer. 2016;138:125-36 pubmed publisher
Taylor I, Hütt Cabezas M, Brandt W, Kambhampati M, Nazarian J, Chang H, et al. Disrupting NOTCH Slows Diffuse Intrinsic Pontine Glioma Growth, Enhances Radiation Sensitivity, and Shows Combinatorial Efficacy With Bromodomain Inhibition. J Neuropathol Exp Neurol. 2015;74:778-90 pubmed publisher
Hayashi M, Cesare A, Rivera T, Karlseder J. Cell death during crisis is mediated by mitotic telomere deprotection. Nature. 2015;522:492-6 pubmed publisher
Wang Y, Yang C, Gu Q, Sims M, Gu W, Pfeffer L, et al. KLF4 Promotes Angiogenesis by Activating VEGF Signaling in Human Retinal Microvascular Endothelial Cells. PLoS ONE. 2015;10:e0130341 pubmed publisher
Witwicka H, Jia H, Kutikov A, Reyes Gutiérrez P, Li X, Odgren P. TRAFD1 (FLN29) Interacts with Plekhm1 and Regulates Osteoclast Acidification and Resorption. PLoS ONE. 2015;10:e0127537 pubmed publisher
Kan R, Shuen W, Lung H, Cheung A, Dai W, Kwong D, et al. NF-κB p65 Subunit Is Modulated by Latent Transforming Growth Factor-β Binding Protein 2 (LTBP2) in Nasopharyngeal Carcinoma HONE1 and HK1 Cells. PLoS ONE. 2015;10:e0127239 pubmed publisher
Paran C, Verkerke A, Heden T, Park S, Zou K, Lawson H, et al. Reduced efficiency of sarcolipin-dependent respiration in myocytes from humans with severe obesity. Obesity (Silver Spring). 2015;23:1440-9 pubmed publisher
Cheung A, Ip J, Chu A, Cheng Y, Leong M, Ko J, et al. PTPRG suppresses tumor growth and invasion via inhibition of Akt signaling in nasopharyngeal carcinoma. Oncotarget. 2015;6:13434-47 pubmed
Sengupta D, Kannan A, Kern M, Moreno M, Vural E, Stack B, et al. Disruption of BRD4 at H3K27Ac-enriched enhancer region correlates with decreased c-Myc expression in Merkel cell carcinoma. Epigenetics. 2015;10:460-6 pubmed publisher
Mishra D, Chaudhary S, Krishna B, Mishra S. Identification of Critical Elements for Regulation of Inorganic Pyrophosphatase (PPA1) in MCF7 Breast Cancer Cells. PLoS ONE. 2015;10:e0124864 pubmed publisher
Carvalho S, Lindzen M, Lauriola M, Shirazi N, Sinha S, Abdul Hai A, et al. An antibody to amphiregulin, an abundant growth factor in patients' fluids, inhibits ovarian tumors. Oncogene. 2016;35:438-47 pubmed publisher
Jimenez Sanchez M, Lam W, Hannus M, Sönnichsen B, Imarisio S, Fleming A, et al. siRNA screen identifies QPCT as a druggable target for Huntington's disease. Nat Chem Biol. 2015;11:347-354 pubmed publisher
Ip J, Ko J, Yu V, Chan K, Lam A, Law S, et al. A versatile orthotopic nude mouse model for study of esophageal squamous cell carcinoma. Biomed Res Int. 2015;2015:910715 pubmed publisher
Sample V, Ramamurthy S, Gorshkov K, Ronnett G, Zhang J. Polarized activities of AMPK and BRSK in primary hippocampal neurons. Mol Biol Cell. 2015;26:1935-46 pubmed publisher
Papp S, Huber A, Jordan S, Kriebs A, Nguyen M, Moresco J, et al. DNA damage shifts circadian clock time via Hausp-dependent Cry1 stabilization. elife. 2015;4: pubmed publisher
Ji S, Qin Y, Shi S, Liu X, Hu H, Zhou H, et al. ERK kinase phosphorylates and destabilizes the tumor suppressor FBW7 in pancreatic cancer. Cell Res. 2015;25:561-73 pubmed publisher
Bruserud Ã, Reikvam H, Fredly H, Skavland J, Hagen K, van Hoang T, et al. Expression of the potential therapeutic target CXXC5 in primary acute myeloid leukemia cells - high expression is associated with adverse prognosis as well as altered intracellular signaling and transcriptional regulation. Oncotarget. 2015;6:2794-811 pubmed
Niemeyer B, Parrish J, Spoelstra N, Joyal T, Richer J, Jedlicka P. Variable expression of PIK3R3 and PTEN in Ewing Sarcoma impacts oncogenic phenotypes. PLoS ONE. 2015;10:e0116895 pubmed publisher
Karakashev S, Reginato M. Hypoxia/HIF1α induces lapatinib resistance in ERBB2-positive breast cancer cells via regulation of DUSP2. Oncotarget. 2015;6:1967-80 pubmed
Tomida J, Takata K, Lange S, Schibler A, Yousefzadeh M, Bhetawal S, et al. REV7 is essential for DNA damage tolerance via two REV3L binding sites in mammalian DNA polymerase ?. Nucleic Acids Res. 2015;43:1000-11 pubmed publisher
Vijayakumar V, Monypenny J, Chen X, Machesky L, Lilla S, Thrasher A, et al. Tyrosine phosphorylation of WIP releases bound WASP and impairs podosome assembly in macrophages. J Cell Sci. 2015;128:251-65 pubmed publisher
Tan Y, Kim M, Kingsbury T, Civin C, Cheng W. Regulation of RAB5C is important for the growth inhibitory effects of MiR-509 in human precursor-B acute lymphoblastic leukemia. PLoS ONE. 2014;9:e111777 pubmed publisher
Geiger T, Ha N, Faraji F, Michael H, Rodriguez L, Walker R, et al. Functional analysis of prognostic gene expression network genes in metastatic breast cancer models. PLoS ONE. 2014;9:e111813 pubmed publisher
Charni Chaabane S, Coomans de Brachène A, Essaghir A, Velghe A, Lo Re S, Stockis J, et al. PDGF-D expression is down-regulated by TGFβ in fibroblasts. PLoS ONE. 2014;9:e108656 pubmed publisher
Xu X, Singh H, Wang L, Qi D, Poulos B, Abramson D, et al. Rb suppresses human cone-precursor-derived retinoblastoma tumours. Nature. 2014;514:385-8 pubmed publisher
Tripathi R, Ash D, Shaha C. Beclin-1-p53 interaction is crucial for cell fate determination in embryonal carcinoma cells. J Cell Mol Med. 2014;18:2275-86 pubmed publisher
Bailey S, Zhou B, Damrauer J, Krishnan B, Wilson H, Smith A, et al. mTOR inhibition induces compensatory, therapeutically targetable MEK activation in renal cell carcinoma. PLoS ONE. 2014;9:e104413 pubmed publisher
Baskin R, Park S, Keserű G, Bisht K, Wamsley H, Sayeski P. The Jak2 small molecule inhibitor, G6, reduces the tumorigenic potential of T98G glioblastoma cells in vitro and in vivo. PLoS ONE. 2014;9:e105568 pubmed publisher
Yang C, Matsuura K, Huang N, Robeson A, Huang B, Zhang L, et al. Fatty acid synthase inhibition engages a novel caspase-2 regulatory mechanism to induce ovarian cancer cell death. Oncogene. 2015;34:3264-72 pubmed publisher
Ye J, Kim N, Lee K, Nam Y, Lee U, Joo C. Lysine 63-linked TANK-binding kinase 1 ubiquitination by mindbomb E3 ubiquitin protein ligase 2 is mediated by the mitochondrial antiviral signaling protein. J Virol. 2014;88:12765-76 pubmed publisher
Ruas M, Chuang K, Davis L, Al Douri A, Tynan P, Tunn R, et al. TPC1 has two variant isoforms, and their removal has different effects on endo-lysosomal functions compared to loss of TPC2. Mol Cell Biol. 2014;34:3981-92 pubmed publisher
Yao W, Ji S, Qin Y, Yang J, Xu J, Zhang B, et al. Profilin-1 suppresses tumorigenicity in pancreatic cancer through regulation of the SIRT3-HIF1? axis. Mol Cancer. 2014;13:187 pubmed publisher
Gagliardi P, di Blasio L, Puliafito A, Seano G, Sessa R, Chianale F, et al. PDK1-mediated activation of MRCK? regulates directional cell migration and lamellipodia retraction. J Cell Biol. 2014;206:415-34 pubmed publisher
Bieler J, Cannavò R, Gustafson K, Gobet C, Gatfield D, Naef F. Robust synchronization of coupled circadian and cell cycle oscillators in single mammalian cells. Mol Syst Biol. 2014;10:739 pubmed publisher
Khosravi R, Sodek K, Xu W, Bais M, Saxena D, Faibish M, et al. A novel function for lysyl oxidase in pluripotent mesenchymal cell proliferation and relevance to inflammation-associated osteopenia. PLoS ONE. 2014;9:e100669 pubmed publisher
de Renty C, DePamphilis M, Ullah Z. Cytoplasmic localization of p21 protects trophoblast giant cells from DNA damage induced apoptosis. PLoS ONE. 2014;9:e97434 pubmed publisher
Alcaraz L, Exposito J, Chuvin N, Pommier R, Cluzel C, Martel S, et al. Tenascin-X promotes epithelial-to-mesenchymal transition by activating latent TGF-?. J Cell Biol. 2014;205:409-28 pubmed publisher
Fischer S, Ronellenfitsch M, Thiepold A, Harter P, Reichert S, Kogel D, et al. Hypoxia enhances the antiglioma cytotoxicity of B10, a glycosylated derivative of betulinic acid. PLoS ONE. 2014;9:e94921 pubmed publisher
Diaz J, Mendoza P, Ortiz R, Diaz N, Leyton L, Stupack D, et al. Rab5 is required in metastatic cancer cells for Caveolin-1-enhanced Rac1 activation, migration and invasion. J Cell Sci. 2014;127:2401-6 pubmed publisher
Muller K, Zurbriggen M, Weber W. Control of gene expression using a red- and far-red light-responsive bi-stable toggle switch. Nat Protoc. 2014;9:622-32 pubmed publisher
Zhang X, Liu Q, Luo C, Deng Y, Cui K, Shi D. Identification and characterization of buffalo 7SK and U6 pol III promoters and application for expression of short hairpin RNAs. Int J Mol Sci. 2014;15:2596-607 pubmed publisher
O Sullivan R, Arnoult N, Lackner D, Oganesian L, Haggblom C, Corpet A, et al. Rapid induction of alternative lengthening of telomeres by depletion of the histone chaperone ASF1. Nat Struct Mol Biol. 2014;21:167-74 pubmed publisher
Birket M, Casini S, Kosmidis G, Elliott D, Gerencser A, Baartscheer A, et al. PGC-1? and reactive oxygen species regulate human embryonic stem cell-derived cardiomyocyte function. Stem Cell Reports. 2013;1:560-74 pubmed publisher
Munkley J, Rajan P, Lafferty N, Dalgliesh C, Jackson R, Robson C, et al. A novel androgen-regulated isoform of the TSC2 tumour suppressor gene increases cell proliferation. Oncotarget. 2014;5:131-9 pubmed
Li Z, Dong L, Dean E, Yang L. Acidosis decreases c-Myc oncogene expression in human lymphoma cells: a role for the proton-sensing G protein-coupled receptor TDAG8. Int J Mol Sci. 2013;14:20236-55 pubmed publisher
Cheng Y, Cheung A, Ko J, Phoon Y, Chiu P, Lo P, et al. Physiological β-catenin signaling controls self-renewal networks and generation of stem-like cells from nasopharyngeal carcinoma. BMC Cell Biol. 2013;14:44 pubmed publisher
Gow C, Guo C, Wang D, Hu Q, Zhang J. Differential involvement of E2A-corepressor interactions in distinct leukemogenic pathways. Nucleic Acids Res. 2014;42:137-52 pubmed publisher
Jiang H, Lu X, Shimada M, Dou Y, Tang Z, Roeder R. Regulation of transcription by the MLL2 complex and MLL complex-associated AKAP95. Nat Struct Mol Biol. 2013;20:1156-63 pubmed publisher
Salloum S, Wang H, Ferguson C, Parton R, Tai A. Rab18 binds to hepatitis C virus NS5A and promotes interaction between sites of viral replication and lipid droplets. PLoS Pathog. 2013;9:e1003513 pubmed publisher
Mao X, Hütt Cabezas M, Orr B, Weingart M, Taylor I, Rajan A, et al. LIN28A facilitates the transformation of human neural stem cells and promotes glioblastoma tumorigenesis through a pro-invasive genetic program. Oncotarget. 2013;4:1050-64 pubmed
Ge Y, Waldemer R, Nalluri R, Nuzzi P, Chen J. RNAi screen reveals potentially novel roles of cytokines in myoblast differentiation. PLoS ONE. 2013;8:e68068 pubmed publisher
Baird B, Schliekelman M, Ahn Y, Chen Y, Roybal J, Gill B, et al. Fibulin-2 is a driver of malignant progression in lung adenocarcinoma. PLoS ONE. 2013;8:e67054 pubmed publisher
Zenzmaier C, Sampson N, Plas E, Berger P. Dickkopf-related protein 3 promotes pathogenic stromal remodeling in benign prostatic hyperplasia and prostate cancer. Prostate. 2013;73:1441-52 pubmed publisher
Lee D, Amanat S, Goff C, Weiss L, Said J, Doan N, et al. Overexpression of miR-26a-2 in human liposarcoma is correlated with poor patient survival. Oncogenesis. 2013;2:e47 pubmed publisher
Ryder P, Vistein R, Gokhale A, Seaman M, Puthenveedu M, Faundez V. The WASH complex, an endosomal Arp2/3 activator, interacts with the Hermansky-Pudlak syndrome complex BLOC-1 and its cargo phosphatidylinositol-4-kinase type IIα. Mol Biol Cell. 2013;24:2269-84 pubmed publisher
Rybak A, Ingram A, Tang D. Propagation of human prostate cancer stem-like cells occurs through EGFR-mediated ERK activation. PLoS ONE. 2013;8:e61716 pubmed publisher
Kuroda K, Kuang S, Taketo M, Rudnicki M. Canonical Wnt signaling induces BMP-4 to specify slow myofibrogenesis of fetal myoblasts. Skelet Muscle. 2013;3:5 pubmed publisher
Feldman D, Chen C, Punj V, Machida K. The TBC1D15 oncoprotein controls stem cell self-renewal through destabilization of the Numb-p53 complex. PLoS ONE. 2013;8:e57312 pubmed publisher
Zinn R, Gardner E, Dobromilskaya I, Murphy S, Marchionni L, Hann C, et al. Combination treatment with ABT-737 and chloroquine in preclinical models of small cell lung cancer. Mol Cancer. 2013;12:16 pubmed publisher
Burns T, Dobromilskaya I, Murphy S, Gajula R, Thiyagarajan S, Chatley S, et al. Inhibition of TWIST1 leads to activation of oncogene-induced senescence in oncogene-driven non-small cell lung cancer. Mol Cancer Res. 2013;11:329-38 pubmed publisher
Giambra V, Jenkins C, Wang H, Lam S, Shevchuk O, Nemirovsky O, et al. NOTCH1 promotes T cell leukemia-initiating activity by RUNX-mediated regulation of PKC-? and reactive oxygen species. Nat Med. 2012;18:1693-8 pubmed publisher
Durán R, MacKenzie E, Boulahbel H, Frezza C, Heiserich L, Tardito S, et al. HIF-independent role of prolyl hydroxylases in the cellular response to amino acids. Oncogene. 2013;32:4549-56 pubmed publisher
De Saedeleer C, Copetti T, Porporato P, Verrax J, Feron O, Sonveaux P. Lactate activates HIF-1 in oxidative but not in Warburg-phenotype human tumor cells. PLoS ONE. 2012;7:e46571 pubmed publisher
Moleirinho S, Chang N, Sims A, Tilston Lünel A, Angus L, Steele A, et al. KIBRA exhibits MST-independent functional regulation of the Hippo signaling pathway in mammals. Oncogene. 2013;32:1821-30 pubmed publisher
Malek M, Guillaumot P, Huber A, Lebeau J, Petrilli V, Kfoury A, et al. LAMTOR1 depletion induces p53-dependent apoptosis via aberrant lysosomal activation. Cell Death Dis. 2012;3:e300 pubmed publisher
Diez H, Garrido J, Wandosell F. Specific roles of Akt iso forms in apoptosis and axon growth regulation in neurons. PLoS ONE. 2012;7:e32715 pubmed publisher
Sonveaux P, Copetti T, De Saedeleer C, Vegran F, Verrax J, Kennedy K, et al. Targeting the lactate transporter MCT1 in endothelial cells inhibits lactate-induced HIF-1 activation and tumor angiogenesis. PLoS ONE. 2012;7:e33418 pubmed publisher
Stafa K, Trancikova A, Webber P, Glauser L, West A, Moore D. GTPase activity and neuronal toxicity of Parkinson's disease-associated LRRK2 is regulated by ArfGAP1. PLoS Genet. 2012;8:e1002526 pubmed publisher
Xing L, Yao X, Williams K, Bassell G. Negative regulation of RhoA translation and signaling by hnRNP-Q1 affects cellular morphogenesis. Mol Biol Cell. 2012;23:1500-9 pubmed publisher
Woods M, Kelly J, Hattlmann C, Tong J, Xu L, Coleman M, et al. Human HERC5 restricts an early stage of HIV-1 assembly by a mechanism correlating with the ISGylation of Gag. Retrovirology. 2011;8:95 pubmed publisher
Crosnier C, Bustamante L, Bartholdson S, Bei A, Theron M, Uchikawa M, et al. Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Nature. 2011;480:534-7 pubmed publisher
Uygur B, Wu W. SLUG promotes prostate cancer cell migration and invasion via CXCR4/CXCL12 axis. Mol Cancer. 2011;10:139 pubmed publisher
Waldron T, De Dominici M, Soliera A, Audia A, Iacobucci I, Lonetti A, et al. c-Myb and its target Bmi1 are required for p190BCR/ABL leukemogenesis in mouse and human cells. Leukemia. 2012;26:644-53 pubmed publisher
Potts R, Zhang P, Wurster A, Precht P, Mughal M, Wood W, et al. CHD5, a brain-specific paralog of Mi2 chromatin remodeling enzymes, regulates expression of neuronal genes. PLoS ONE. 2011;6:e24515 pubmed publisher
Fink L, Roell M, Caiazza E, Lerner C, STAMATO T, Hrelia S, et al. 53BP1 contributes to a robust genomic stability in human fibroblasts. Aging (Albany NY). 2011;3:836-45 pubmed
Kazi A, Hong Brown L, Lang S, Lang C. Deptor knockdown enhances mTOR Activity and protein synthesis in myocytes and ameliorates disuse muscle atrophy. Mol Med. 2011;17:925-36 pubmed publisher
Alekseev O, Richardson R, TSURUTA J, O Rand M. Depletion of the histone chaperone tNASP inhibits proliferation and induces apoptosis in prostate cancer PC-3 cells. Reprod Biol Endocrinol. 2011;9:50 pubmed publisher
Kawazu M, Saso K, Tong K, McQuire T, Goto K, Son D, et al. Histone demethylase JMJD2B functions as a co-factor of estrogen receptor in breast cancer proliferation and mammary gland development. PLoS ONE. 2011;6:e17830 pubmed publisher
Zlatic S, Tornieri K, L hernault S, Faundez V. Clathrin-dependent mechanisms modulate the subcellular distribution of class C Vps/HOPS tether subunits in polarized and nonpolarized cells. Mol Biol Cell. 2011;22:1699-715 pubmed publisher
Bell E, Emerling B, Ricoult S, Guarente L. SirT3 suppresses hypoxia inducible factor 1? and tumor growth by inhibiting mitochondrial ROS production. Oncogene. 2011;30:2986-96 pubmed publisher
Nowak U, Matthews A, Zheng S, Chaudhuri J. The splicing regulator PTBP2 interacts with the cytidine deaminase AID and promotes binding of AID to switch-region DNA. Nat Immunol. 2011;12:160-6 pubmed publisher
Martín Villar E, Fernández Muñoz B, Parsons M, Yurrita M, Megias D, Perez Gomez E, et al. Podoplanin associates with CD44 to promote directional cell migration. Mol Biol Cell. 2010;21:4387-99 pubmed publisher
Lin F, Chang C, Cheong M, Chen H, Lee D, Chang G, et al. Dual-specificity phosphatase 23 mediates GCM1 dephosphorylation and activation. Nucleic Acids Res. 2011;39:848-61 pubmed publisher
Bitto A, Lerner C, Torres C, Roell M, Malaguti M, Perez V, et al. Long-term IGF-I exposure decreases autophagy and cell viability. PLoS ONE. 2010;5:e12592 pubmed publisher
Patel S, Simon M. Functional analysis of the Cdk7.cyclin H.Mat1 complex in mouse embryonic stem cells and embryos. J Biol Chem. 2010;285:15587-98 pubmed publisher
Torres V, Mielgo A, Barbero S, Hsiao R, Wilkins J, Stupack D. Rab5 mediates caspase-8-promoted cell motility and metastasis. Mol Biol Cell. 2010;21:369-76 pubmed publisher
Smith K, Fu M, Brown E. Tim-Tipin dysfunction creates an indispensible reliance on the ATR-Chk1 pathway for continued DNA synthesis. J Cell Biol. 2009;187:15-23 pubmed publisher
Chen M, Philipp M, Wang J, Premont R, Garrison T, Caron M, et al. G Protein-coupled receptor kinases phosphorylate LRP6 in the Wnt pathway. J Biol Chem. 2009;284:35040-8 pubmed publisher
Copp J, Manning G, Hunter T. TORC-specific phosphorylation of mammalian target of rapamycin (mTOR): phospho-Ser2481 is a marker for intact mTOR signaling complex 2. Cancer Res. 2009;69:1821-7 pubmed publisher
Kulkarni A, McNeill D, Gleichmann M, Mattson M, Wilson D. XRCC1 protects against the lethality of induced oxidative DNA damage in nondividing neural cells. Nucleic Acids Res. 2008;36:5111-21 pubmed publisher
Barr S, Smiley J, Bushman F. The interferon response inhibits HIV particle production by induction of TRIM22. PLoS Pathog. 2008;4:e1000007 pubmed publisher
Sarbassov D, Guertin D, Ali S, Sabatini D. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005;307:1098-101 pubmed
product information
Catalog Number :
1864
Product Name :
scramble shRNA
article :
doi10.1126/science.1106148
id132
pubmed_id15718470
bacterial resistance :
Ampicillin
cloning :
backbonepLKO.1
backbone_mutation
backbone_originStewart SA, RNA 2003 Apr; 9(4):493-501.
backbone_size7032
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
RNAi
growth notes :
For packaging, please use pCMV-dR8.2 dvpr (Addgene plasmid #8455) and pCMV-VSVG (Addgene plasmid #8454). Please note that the 5' cloning site, AgeI, is typically destroyed during the shRNA cloning. Depending on the specific shRNA sequence, the site can occasionally be restored. AgeI is present in this plasmid.
is:CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGA
CTTAACCTTAGG.
shRNA for use as a negative control. Sequence of hairpin
growth strain :
3rd gen lentiviral negative control vector containing scrambled shRNA
growth temp :
XL10-Gold Ultracompetent Cells from Stratagene. 37oC.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3EcoRI
cloning_site_5AgeI
promoter
sequencing_primer_3
sequencing_primer_5LKO.1 5'
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
namescramble
shRNA_sequence
size60
species
tags
resistance markers :
432
tags :
Unknown
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA