This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCMV10-3xFLAG-prs-MCP1
catalog :
184341
citations: 1
product information
Catalog Number :
184341
Product Name :
pCMV10-3xFLAG-prs-MCP1
article :
| doi | 10.1083/jcb.202202030 |
| id | 28225067 |
| pubmed_id | 35357422 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pCMV10 | |
| backbone_mutation | Digested with NotI and BamHI | |
| backbone_origin | ||
| backbone_size | 6281 | |
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth strain :
Express yeast MCP1 in Expi293F cells
origin :
37
pi :
MCP1shRNA_sequence size 909 species
tags
Cloningcloning_site_3
cloning_site
_5 promoter
td> CMV sequencing_
primer_3 agggatgccacccgggatccct
aattcacgtgcaacagc sequ
encing_primer_5 aggggccccttgcgg
ccgccATGATAAAGTTGCATGAAGTGCC <
tr>site_3_destroyed
tr>site_5_destroyed d> entrez
_gene
genb
ank_ids
|
|
Cloning
_5
td>
primer_3
aattcacgtgcaacagc
encing_primer_5
ccgccATGATAAAGTTGCATGAAGTGCC
tr>
tr>
_gene
/td> |
ank_ids
| NC_00114 7.6 | ||||||||||
| YOR228C | ||||||||||
| mutation | <||||||||||
| name | Yeast
|
