This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pcAla17
catalog :
17681
citations: 1
| Reference |
|---|
Yaciuk P, Choi J, Shalloway D. Mutation of amino acids in pp60c-src that are phosphorylated by protein kinases C and A. Mol Cell Biol. 1989;9:2453-63 pubmed
|
product information
Catalog Number :
17681
Product Name :
pcAla17
article :
| doi | |
| id | 2018 |
| pubmed_id | 2474754 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pEVX | |
| backbone_mutation | ||
| backbone_origin | ||
| backbone_size | 6400 | |
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth notes :
between the BamHI (codon 10) and BstNI (codon 18) sites of pcAlal2.
GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCC
GCCCGGGA
pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer
GATCCCAGCCAGCGCCGGCGGGCCCGGTCGGTCGCGGCC
GCCCGGGA
pcAlal7 was constructed by inserting the synthetic double-stranded DNA oligomer
origin :
37
pi :
|
resistance markers :
| 460 |
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
