This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pBPGUw
catalog :
17575
citations: 30
Reference
Li M, Chen D, Junker I, Szorenyi F, Chen G, Berger A, et al. Ancestral neural circuits potentiate the origin of a female sexual behavior. bioRxiv. 2023;: pubmed publisher
Wang Z, Pu J, Richards C, Giannetti E, Cong H, Lin Z, et al. Evolution of a fatty acyl-CoA elongase underlies desert adaptation in Drosophila. Sci Adv. 2023;9:eadg0328 pubmed publisher
Buffry A, Kittelmann S, McGregor A. Characterisation of the role and regulation of Ultrabithorax in sculpting fine-scale leg morphology. Front Cell Dev Biol. 2023;11:1119221 pubmed publisher
Wang Z, Receveur J, Pu J, Cong H, Richards C, Liang M, et al. Desiccation resistance differences in Drosophila species can be largely explained by variations in cuticular hydrocarbons. elife. 2022;11: pubmed publisher
Begeman I, Emery B, Kurth A, Kang J. Regeneration and developmental enhancers are differentially compatible with minimal promoters. Dev Biol. 2022;492:47-58 pubmed publisher
Pinto P, Domsch K, Gao X, W xf6 lk M, Carnesecchi J, Lohmann I. Specificity of the Hox member Deformed is determined by transcription factor levels and binding site affinities. Nat Commun. 2022;13:5037 pubmed publisher
Duckhorn J, Cande J, Metkus M, Song H, Altamirano S, Stern D, et al. Regulation of Drosophila courtship behavior by the Tlx/tailless-like nuclear receptor, dissatisfaction. Curr Biol. 2022;32:1703-1714.e3 pubmed publisher
Lucas T, Hafer T, Zhang H, Molotkova N, Kohwi M. Discrete cis-acting element regulates developmentally timed gene-lamina relocation and neural progenitor competence in vivo. Dev Cell. 2021;56:2649-2663.e6 pubmed publisher
Hertenstein H, McMullen E, Weiler A, Volkenhoff A, Becker H, Schirmeier S. Starvation-induced regulation of carbohydrate transport at the blood-brain barrier is TGF-β-signaling dependent. elife. 2021;10: pubmed publisher
Coates J, Brooks E, Brittle A, Armitage E, Zeidler M, Evans I. Identification of functionally distinct macrophage subpopulations in Drosophila. elife. 2021;10: pubmed publisher
Huynh N, Wang S, King Jones K. Spatial and temporal control of gene manipulation in Drosophila via drug-activated Cas9 nucleases. Insect Biochem Mol Biol. 2020;120:103336 pubmed publisher
Wu S, Guo C, Zhao H, Sun M, Chen J, Han C, et al. Drosulfakinin signaling in fruitless circuitry antagonizes P1 neurons to regulate sexual arousal in Drosophila. Nat Commun. 2019;10:4770 pubmed publisher
Massey J, Chung D, Siwanowicz I, Stern D, Wittkopp P. The yellow gene influences Drosophila male mating success through sex comb melanization. elife. 2019;8: pubmed publisher
Kondo T, Hayashi S. Two-step regulation of trachealess ensures tight coupling of cell fate with morphogenesis in the Drosophila trachea. elife. 2019;8: pubmed publisher
Chahda J, Soni N, Sun J, Ebrahim S, Weiss B, Carlson J. The molecular and cellular basis of olfactory response to tsetse fly attractants. PLoS Genet. 2019;15:e1008005 pubmed publisher
Deng B, Li Q, Liu X, Cao Y, Li B, Qian Y, et al. Chemoconnectomics: Mapping Chemical Transmission in Drosophila. Neuron. 2019;101:876-893.e4 pubmed publisher
Nagy O, Nuez I, Savisaar R, Peluffo A, Yassin A, Lang M, et al. Correlated Evolution of Two Copulatory Organs via a Single cis-Regulatory Nucleotide Change. Curr Biol. 2018;28:3450-3457.e13 pubmed publisher
Huynh N, Zeng J, Liu W, King Jones K. A Drosophila CRISPR/Cas9 Toolkit for Conditionally Manipulating Gene Expression in the Prothoracic Gland as a Test Case for Polytene Tissues. G3 (Bethesda). 2018;8:3593-3605 pubmed publisher
Seeholzer L, Seppo M, Stern D, Ruta V. Evolution of a central neural circuit underlies Drosophila mate preferences. Nature. 2018;559:564-569 pubmed publisher
Lin S, Dikler S, Blincoe W, Ferguson R, Sheridan R, Peng Z, et al. Mapping the dark space of chemical reactions with extended nanomole synthesis and MALDI-TOF MS. Science. 2018;361: pubmed publisher
Zhai Z, Boquete J, Lemaitre B. Cell-Specific Imd-NF-κB Responses Enable Simultaneous Antibacterial Immunity and Intestinal Epithelial Cell Shedding upon Bacterial Infection. Immunity. 2018;48:897-910.e7 pubmed publisher
Louradour I, Sharma A, Morin Poulard I, Letourneau M, Vincent A, Crozatier M, et al. Reactive oxygen species-dependent Toll/NF-κB activation in the Drosophila hematopoietic niche confers resistance to wasp parasitism. elife. 2017;6: pubmed publisher
Watanabe K, Chiu H, Pfeiffer B, Wong A, Hoopfer E, Rubin G, et al. A Circuit Node that Integrates Convergent Input from Neuromodulatory and Social Behavior-Promoting Neurons to Control Aggression in Drosophila. Neuron. 2017;95:1112-1128.e7 pubmed publisher
Janssens D, Hamm D, Anhezini L, Xiao Q, Siller K, Siegrist S, et al. An Hdac1/Rpd3-Poised Circuit Balances Continual Self-Renewal and Rapid Restriction of Developmental Potential during Asymmetric Stem Cell Division. Dev Cell. 2017;40:367-380.e7 pubmed publisher
Yu Y, Huang R, Ye J, Zhang V, Wu C, Cheng G, et al. Regulation of starvation-induced hyperactivity by insulin and glucagon signaling in adult Drosophila. elife. 2016;5: pubmed publisher
Lin C, Potter C. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 2016;203:1613-28 pubmed publisher
de Taffin M, Carrier Y, Dubois L, Bataillé L, Painset A, Le Gras S, et al. Genome-Wide Mapping of Collier In Vivo Binding Sites Highlights Its Hierarchical Position in Different Transcription Regulatory Networks. PLoS ONE. 2015;10:e0133387 pubmed publisher
Niepielko M, Yakoby N. Evolutionary changes in TGFα distribution underlie morphological diversity in eggshells from Drosophila species. Development. 2014;141:4710-5 pubmed publisher
Schoofs A, Hückesfeld S, Schlegel P, Miroschnikow A, Peters M, Zeymer M, et al. Selection of motor programs for suppressing food intake and inducing locomotion in the Drosophila brain. PLoS Biol. 2014;12:e1001893 pubmed publisher
Pfeiffer B, Jenett A, Hammonds A, Ngo T, Misra S, Murphy C, et al. Tools for neuroanatomy and neurogenetics in Drosophila. Proc Natl Acad Sci U S A. 2008;105:9715-20 pubmed publisher
product information
Catalog Number :
17575
Product Name :
pBPGUw
article :
doi10.1073/pnas.0803697105
id1972
pubmed_id18621688
bacterial resistance :
Chloramphenicol and Ampicillin
cloning :
backbonepBDP
backbone_mutation
backbone_origin
backbone_size9052
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Insect Expression
growth notes :
pBPGUw is a modular Gateway compatible GAL4 vector amenable to high throughput in vitro cloning using Invitrogen LR clonase and specific in vivo genomic targeting using PhiC31 integrase. pBPGUw contains a Drosophila synthetic core promoter (DSCP) that contains TATA, Inr, MTE, and DPE motifs. In addition the GAL4 CDS and yeast transcriptional terminator can easily be substituted for another driver by a directional 5' KpnI to 3' HindIII digest.
growth temp :
Bacterial Strain DB3.1 (Invitrogen) or similar must be used to propagate plasmids carrying the ccdB gene.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3NotI
cloning_site_5KpnI
promoter
sequencing_primer_3BDP R (bp 5,435) : ATAATGGTGCAGGGCGCTGAC
sequencing_primer_5BDP F (bp 11,652): AAATAGGGGTTCCGCGCACAT
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesYPL248C, GAL81
geneGAL4
id855828
genbank_ids
mutation
nameGAL4
shRNA_sequence
size2646
species
4932
Saccharomyces cerevisiae
tags
plasmid copy :
GAL4 leader, CDS, and hsp70 polyA were cloned from pGaTB (via DGRC).
resistance markers :
428
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA