This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
MSCVpic2blast-EGFP-FF2
catalog :
164923
citations: 1
Reference
Smith J, Lee L, Read A, Li Q, Yu B, Lee C, et al. One-step immortalization of primary human airway epithelial cells capable of oncogenic transformation. Cell Biosci. 2016;6:57 pubmed publisher
product information
Catalog Number :
164923
Product Name :
MSCVpic2blast-EGFP-FF2
article :
doi10.1186/s13578-016-0122-6
id28215834
pubmed_id27891214
bacterial resistance :
Ampicillin
cloning :
backboneMSCVpic2
backbone_mutation
backbone_origin
backbone_size6735
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Retroviral
growth strain :
Expresses EGFP cDNA and FF2 shRNA in mammalian cells
origin :
37
pi :
alt_names
EGFP
cloning
clone_methodRestriction Enzyme
cloning_site_3NotI
cloning_site_5FseI
promoter
sequencing_primer_3
sequencing_primer_5ATGGTGAGCAAGGGCGAGGA
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutation
nameEnhanced green fluorescent protein
shRNA_sequence
size720
species
100
Synthetic
tags
alt_names
FF2
cloning
clone_methodRestriction Enzyme
cloning_site_3Eco R1
cloning_site_5Xho 1
promoter
sequencing_primer_3
sequencing_primer_5GGGATAACAGGGTAATTGTTTGAATG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesGPR74, HLWAR77, NPFF2, NPGPR
geneNPFFR2
id10886
genbank_ids
mutation
nameNeuropeptide FF receptor 2
shRNA_sequence
size22
species
9606
Homo sapiens
tags
resistance markers :
5444
tags :
High Copy
terms :
Blasticidin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA