This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
ERK1C202
catalog :
164647
citations: 1
Reference
Lai K, Galan S, Zeng Y, Zhou T, He C, Raj R, et al. LanCLs add glutathione to dehydroamino acids generated at phosphorylated sites in the proteome. Cell. 2021;184:2680-2695.e26 pubmed publisher
product information
Catalog Number :
164647
Product Name :
ERK1C202
article :
doi10.1016/j.cell.2021.04.001
id28215772
pubmed_id33932340
bacterial resistance :
Ampicillin
cloning :
backboneNpT7-5
backbone_mutation
backbone_origin
backbone_size2357
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth strain :
Bacterial expression plasmid for His6-ERK1C202
origin :
37
pi :
alt_names
MAPK3
cloning
clone_methodRestriction Enzyme
cloning_site_3BamHI
cloning_site_5EcoRI
promoterT7
sequencing_primer_3GCTAGTTATTGCTCAGCGG
sequencing_primer_5TAATACGACTCACTATAGGG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesERK, ERK-2, ERK2, ERT1, MAPK2, NS13, P42MAPK, PRKM1, PRKM2, p38, p40, p41, p41mapk, p42-MAPK
geneMAPK1
id5594
genbank_ids
mutationK71R/C82S/C144S/C178S/C183S/T202C/C271S
nameERK1C202
shRNA_sequence
size1167
species
9606
Homo sapiens
tags
locationN terminal on insert
tagHis6-tag
plasmid copy :
Melanie Cobb (Addgene plasmid # 39229; RRID: Addgene_39229; http://n2t.net/addgene:39229)
resistance markers :
5295
tags :
Unknown
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA