This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
modified pcAT7-Glo1
catalog :
160996
citations: 1
product information
Catalog Number :
160996
Product Name :
modified pcAT7-Glo1
article :
doi | 10.1186/s13059-018-1437-x |
id | 28215329 |
pubmed_id | 29859120 |
bacterial resistance :
Ampicillin
cloning :
backbone | pCAGGS | ||
backbone_mutation | |||
backbone_origin | |||
backbone_size | 5000 | ||
promoter | |||
sequencing_primer_3 | |||
sequencing_primer_5 | |||
vector_types |
|
growth notes :
Cloning for initial Vex-seq inserts is between the PstI and XbaI sites. The second step for generating the final splicing reporter involves PCR amplifying intron 2 and exon 3 from modified pcAT7-Glo1 using GTGTGGAAGTCTCAGGATCG and AACGGGCCCTCTAGAGC and digesting with XbaI and MfeI.
growth strain :
Splicing reporter backbone
origin :
37
pi :
|
plasmid copy :
The original version of this plasmid was received from Kristen Lynch at University of Pennsylvania. A 40 bp deletion in intron 1 was made in intron 1 compared to the original pcAT7-Glo1.
resistance markers :
5166 |
tags :
High Copy
terms :
Zeocin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments