This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pDEST-Tol2-PA2-CMV-AB-mCh
catalog :
160435
citations: 1
product information
Catalog Number :
160435
Product Name :
pDEST-Tol2-PA2-CMV-AB-mCh
article :
| doi | 10.21769/BioProtoc.3856 |
| id | 28215240 |
| pubmed_id | 33659494 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pDEST-Tol2-PA2 | ||
| backbone_mutation | |||
| backbone_origin | |||
| backbone_size | |||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth strain :
Expresses human Amyloid Beta-mCherry in Zebrafish
origin :
37
pi :
Beta_fwd: ataagcagagctatggatgcagaattccgacatgactcagsite_3_destroyed site_5_destroyed entrez_gene
genbank_ids mutation name Human Amyloid Beta peptide (1-42) shRNA_sequence size species
tags
tatcttatcatgtctggatcatcatgtacagctcgtcca
tgccgccggtgsequencing
_primer_5 hAmyloid
|
| ||
|
|
tatcttatcatgtctggatcatcatgtacagctcgtcca
tgccgccggtg
_primer_5
|
