This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLDLR-Luc mutSRE
catalog :
14945
citations: 7
| Reference |
|---|
Castoreno A, Wang Y, Stockinger W, Jarzylo L, Du H, Pagnon J, et al. Transcriptional regulation of phagocytosis-induced membrane biogenesis by sterol regulatory element binding proteins. Proc Natl Acad Sci U S A. 2005;102:13129-34 pubmed
|
product information
Catalog Number :
14945
Product Name :
pLDLR-Luc mutSRE
article :
| doi | 10.1073/pnas.0506716102 |
| id | 1402 |
| pubmed_id | 16141315 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pGL2 basic | ||
| backbone_mutation | |||
| backbone_origin | Promega | ||
| backbone_size | 5597 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth notes :
Primers used for site-directed mutagenesis: 5'- ggtgaagacatttgaaaataaccccactgcaaactcc -3' and 5'-GGAGTTTGCAGTGGGGTTATTTTCAAATGTCTTCACC -3'
origin :
37
pi :
|
resistance markers :
| 363 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
