This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Rev CDK9 (D167N) (P#858)
catalog :
14635
citations: 1
Reference |
---|
Fujinaga K, Cujec T, Peng J, Garriga J, Price D, Grana X, et al. The ability of positive transcription elongation factor B to transactivate human immunodeficiency virus transcription depends on a functional kinase domain, cyclin T1, and Tat. J Virol. 1998;72:7154-9 pubmed
|
product information
Catalog Number :
14635
Product Name :
Rev CDK9 (D167N) (P#858)
article :
doi | |
id | 1308 |
pubmed_id | 9696809 |
bacterial resistance :
Ampicillin
cloning :
backbone | pSPORT-Rev | |
backbone_mutation | ||
backbone_origin | ||
backbone_size | 4200 | |
promoter | ||
sequencing_primer_3 | ||
sequencing_primer_5 | ||
vector_types |
|
growth notes :
3' (lowercase letters indicate the PvuII site) and 5' CAGACGGAGTTTGAGCGCGTCTTCCTCGAGAGGGGCCGGCG 3'. Amplified products (1.1 kbp) were restricted with PvuII and subcloned into pSPORTRev (PvuII).
GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGAC
TCGGT
To construct pSPORTRev, Rev coding sequences (350 bp) were amplified by PCR from pcRev, restricted with AflII and SacI, and cloned into the PstI and SacI sites of pSV SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker sequences . CDK9 (D167N) was amplified by PCR from pRc/CMVCDK9D-NHA [pCDK9(D167N) with the oligonucleotides 5'
GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGAC
TCGGT
To construct pSPORTRev, Rev coding sequences (350 bp) were amplified by PCR from pcRev, restricted with AflII and SacI, and cloned into the PstI and SacI sites of pSV SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker sequences . CDK9 (D167N) was amplified by PCR from pRc/CMVCDK9D-NHA [pCDK9(D167N) with the oligonucleotides 5'
origin :
37
pi :
|
resistance markers :
390 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments