This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
TFORF1836
catalog :
142864
citations: 1
Reference
Joung J, Ma S, Tay T, Geiger Schuller K, Kirchgatterer P, Verdine V, et al. A transcription factor atlas of directed differentiation. Cell. 2023;186:209-229.e26 pubmed publisher
product information
Catalog Number :
142864
Product Name :
TFORF1836
article :
doi10.1016/j.cell.2022.11.026
id28211165
pubmed_id36608654
bacterial resistance :
Ampicillin
cloning :
backbonepLX_TRC317
backbone_mutation
backbone_originBroad Institute Genetic Perturbation Platform
backbone_size8264
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Lentiviral
growth notes :
NM_152998,ENST00000350995 . The transcription factor ORF portion of this plasmid was synthesized by Genewiz. Please test multiple small colonies in case of plasmid recombination. To make this collection available in a timely manner, a portion of this collection was not fully sequenced by Addgene. If an Addgene verified full plasmid sequence is not available, please contact us at help@addgene.org prior to placing an order to request the full sequence.
growth strain :
Lentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.
origin :
37
pi :
alt_names
cloning
clone_methodUnknown
cloning_site_3
cloning_site_5
promoterEF1a
sequencing_primer_3CACATAGCGTAAAAGGAGCAACATAG
sequencing_primer_5GGGTGGAGACTGAAGTTAGGCCAG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesENX-1, ENX1, EZH2b, KMT6, KMT6A, WVS, WVS2
geneEZH2
id2146
genbank_ids
mutation
nameEZH2
shRNA_sequence
size2225
species
9606
Homo sapiens
tags
resistance markers :
898
tags :
High Copy
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA