This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
C331
catalog :
141123
citations: 1
Reference
Alnahhas R, Sadeghpour M, Chen Y, Frey A, Ott W, Josic K, et al. Majority sensing in synthetic microbial consortia. Nat Commun. 2020;11:3659 pubmed publisher
product information
Catalog Number :
141123
Product Name :
C331
article :
doi10.1038/s41467-020-17475-z
id28211082
pubmed_id32694598
bacterial resistance :
Spectinomycin
cloning :
backbonep15A
backbone_mutation
backbone_origin
backbone_size2735
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Bacterial Expression
growth strain :
RhlI expressing plasmid
origin :
37
pi :
alt_names
cloning
clone_methodGibson Cloning
cloning_site_3
cloning_site_5
promoterengineered lac promoter
sequencing_primer_3GATCAGTTGGAAGAATTTGTCCACT
sequencing_primer_5AGTGCGCTCGAGCTTCCC
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesPA3476
generhlI
id878967
genbank_ids
mutation
nameRhlI
shRNA_sequence
size603
species
tags
locationC terminal on backbone
tagssrA degradation tag
resistance markers :
1988
tags :
Low Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA