This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
tet_pLKO.1_puro_shNRF2 #1
catalog :
136584
citations: 4
| Reference |
|---|
product information
Catalog Number :
136584
Product Name :
tet_pLKO.1_puro_shNRF2 #1
article :
| doi | 10.1126/scisignal.aba4200 |
| id | 28207340 |
| pubmed_id | 32291314 |
bacterial resistance :
Ampicillin
cloning :
| backbone | tet-pLKO-puro | ||
| backbone_mutation | |||
| backbone_origin | Addgene # 21915 | ||
| backbone_size | 10633 | ||
| promoter | |||
| sequencing_primer_3 | |||
| sequencing_primer_5 | |||
| vector_types |
|
growth strain :
Expresses an inducible short hairpin targeting human NRF2 sequence
origin :
30
pi :
sapienstags
Nrf-2gene NFE
2L2 id 4780d> <
/tr>genbank_ids
td>mutation <
/tr>name shNRF2v1 <
/tr>shRNA_sequence AGAG
CAAGATTTAGATCATTTCTGCAGAAATGATCTAAATCTT
GCTCT size d> species <
Nrf-2
2L2
/tr>
| NM_006164.4 |
td>
/tr>
/tr>
CAAGATTTAGATCATTTCTGCAGAAATGATCTAAATCTT
GCTCT
|
