This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCMV-Sport6-CD9-pHuji
catalog :
130906
citations: 1
Reference
Verweij F, Bebelman M, Jimenez C, Garcia Vallejo J, Janssen H, Neefjes J, et al. Quantifying exosome secretion from single cells reveals a modulatory role for GPCR signaling. J Cell Biol. 2018;217:1129-1142 pubmed publisher
product information
Catalog Number :
130906
Product Name :
pCMV-Sport6-CD9-pHuji
article :
doi10.1083/jcb.201703206
id28200311
pubmed_id29339438
bacterial resistance :
Ampicillin
cloning :
backbonepCMV-sport6
backbone_mutation
backbone_originInvitrogen
backbone_size4360
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth strain :
Expression of CD9-pHuji for visualization of multivesicular body-plasma membrane fusion.
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3XbaI
cloning_site_5EcoRI
promoterCMV
sequencing_primer_3AATACGACTCACTATAG
sequencing_primer_5GAGCGGATAACAATTTCACACAGG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesBTCC-1, DRAP-27, MIC3, MRP-1, TSPAN-29, TSPAN29
geneCD9
id928
genbank_ids
mutationpHuji inserted between Asn50 and Asn51 in extracellular loop 1
nameCD9-pHuji
shRNA_sequence
size1407
species
9606
Homo sapiens
100
Synthetic
tags
location
tagpHuji
resistance markers :
4585
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA