This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pB-MultiplexedReporter-MOR170-1
catalog :
129461
citations: 1
Reference
Jones E, Jajoo R, Cancilla D, Lubock N, Wang J, Satyadi M, et al. A Scalable, Multiplexed Assay for Decoding GPCR-Ligand Interactions with RNA Sequencing. Cell Syst. 2019;8:254-260.e6 pubmed publisher
product information
Catalog Number :
129461
Product Name :
pB-MultiplexedReporter-MOR170-1
article :
doi10.1016/j.cels.2019.02.009
id28203820
pubmed_id30904378
bacterial resistance :
Ampicillin
cloning :
backbonepB-CMV expression vector
backbone_mutation
backbone_originSBI
backbone_size8608
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
Synthetic Biology
growth strain :
piggyBac transposon vector encoding the receptor MOR170-1 and the barcoded CRE reporter gene
origin :
37
pi :
alt_names
Olfr895
cloning
clone_methodGibson Cloning
cloning_site_3
cloning_site_5
promoterTRE (Tet-On)
sequencing_primer_3CTGCTGAGGAGTCTTTCC
sequencing_primer_5GCTTTATTGCGGTAGTTTATCACAG
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesMOR170-1
geneOlfr895
id258875
genbank_ids
AY073215.1
mutation
nameMOR170-1
shRNA_sequence
size1080
species
10090
Mus musculus
tags
locationN terminal on insert
tagLUCY tag, Rho tag
resistance markers :
3845
tags :
High Copy
terms :
Blasticidin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA