This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCIneoGFP-BMI1
catalog :
128328
citations: 1
Reference
Hossain S, Iwasa H, Sarkar A, Maruyama J, Arimoto Matsuzaki K, Hata Y. The RASSF6 Tumor Suppressor Protein Regulates Apoptosis and Cell Cycle Progression via Retinoblastoma Protein. Mol Cell Biol. 2018;38: pubmed publisher
product information
Catalog Number :
128328
Product Name :
pCIneoGFP-BMI1
article :
doi10.1128/MCB.00046-18
id28199887
pubmed_id29891515
bacterial resistance :
Ampicillin
cloning :
backbonepCIneo
backbone_mutation
backbone_originPromega
backbone_size5472
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
The insert for BMI1 contains an S572P compared to the reference NP_001190991.1 that does not affect function.
growth strain :
Mammalian expression vector of GFP-tagged human BMI1
origin :
37
pi :
alt_names
cloning
clone_methodRestriction Enzyme
cloning_site_3SalI
cloning_site_5MluI
promoterCMV
sequencing_primer_3gaacctgaaacataaaatgaat
sequencing_primer_5ggcatggacgagctgtacaa
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesFLVI2/BMI1, PCGF4, RNF51, flvi-2/bmi-1
geneBMI1
id648
genbank_ids
648
mutation
nameBMI1
shRNA_sequence
size980
species
9606
Homo sapiens
tags
locationN terminal on backbone
tagGFP
resistance markers :
1244
tags :
High Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA