This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pDSM-de-Phhf2-PYC-Tadh1
catalog :
127737
citations: 1
product information
Catalog Number :
127737
Product Name :
pDSM-de-Phhf2-PYC-Tadh1
article :
| doi | 10.1016/j.ymben.2018.05.002 |
| id | 28197680 |
| pubmed_id | 29753070 |
bacterial resistance :
Kanamycin
cloning :
| backbone | pDSM-de | ||
| backbone_mutation | |||
| backbone_origin | |||
| backbone_size | |||
| promoter | |||
| sequencing_primer_3 | AAAGCAAAGGAAGGAGAGAAC | ||
| sequencing_primer_5 | AAGCGACTTCCAATCGCTTTGC | ||
| vector_types |
|
growth notes :
PYC transcription unit with pathway position 5 homology arms, compatible with 5' position 4 and 3' position 6 homology arm. Sequencing primers are also the primers for amplifying DNA for integration into the S. cerevisiae genome.
growth strain :
Yeast pathway position 5. PYC transcription unit with the HHF2 promoter and ADH1 terminator.
origin :
37
pi :
|
resistance markers :
| 626 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
