This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLentiCRISPRv2 sgIRF3#5
catalog :
127642
citations: 1
Reference
Gratia M, Rodero M, Conrad C, Bou Samra E, Maurin M, Rice G, et al. Bloom syndrome protein restrains innate immune sensing of micronuclei by cGAS. J Exp Med. 2019;216:1199-1213 pubmed publisher
product information
Catalog Number :
127642
Product Name :
pLentiCRISPRv2 sgIRF3#5
article :
doi10.1084/jem.20181329
id28203517
pubmed_id30936263
bacterial resistance :
Ampicillin
cloning :
backbonepLentiCRISPRv2
backbone_mutation
backbone_origin
backbone_size
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Lentiviral
growth strain :
Knock-out of human IRF3
origin :
30
pi :
alt_names
cloning
clone_methodUnknown
cloning_site_3
cloning_site_5
promoter
sequencing_primer_3
sequencing_primer_5
site_3_destroyed
site_5_destroyed
entrez_gene
aliasesIIAE7
geneIRF3
id3661
genbank_ids
mutation
nameIRF3 sgRNA
shRNA_sequenceGAAGCGGCTGTTGGTGCCGG
size
species
9606
Homo sapiens
tags
resistance markers :
3219
tags :
High Copy
terms :
Puromycin
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA