This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pCoofy51
catalog :
122005
citations: 1
product information
Catalog Number :
122005
Product Name :
pCoofy51
article :
| doi | 10.1186/1472-6750-13-12 |
| id | 6402 |
| pubmed_id | 23410102 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pFastBac | |
| backbone_mutation | ||
| backbone_origin | Thermo | |
| backbone_size | 5334 | |
| promoter | ||
| sequencing_primer_3 | pFastBac rev:5'TGTTTCAGGTTCAGGGGGAGGTGT 3' | |
| sequencing_primer_5 | pFastBac fd: 5' ATTAAAATGATAACCATCTCG 3' | |
| vector_types |
|
growth notes :
ccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain. Please see supplemental file for LP1 and LP2 primers to use for SLIC cloning. A detailed protocol for using pCoofy plasmids is available at https://p4eu.org/wiki . Use one of the following linearization primer pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 reverse vector primer: SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
growth strain :
Baculovirus vector for parallel SLIC cloning containing N-terminal TwinStrep with PreScission Cleavage site
inserts :
DB3.1
origin :
37
pi :
|
resistance markers :
| 1471 |
tags :
High Copy
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
