This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
Ub-G76V-GFP
catalog :
11941
citations: 24
Reference
Yuan R, Hahn Y, Stempel M, Sidibe D, Laxton O, Chen J, et al. Proteasomal inhibition preferentially stimulates lysosome activity relative to autophagic flux in primary astrocytes. Autophagy. 2022;:1-27 pubmed publisher
Davis P, Miller S, Verhoeven N, Morgan J, Tulis D, Witczak C, et al. Increased AMP deaminase activity decreases ATP content and slows protein degradation in cultured skeletal muscle. Metabolism. 2020;108:154257 pubmed publisher
Fassmannová D, Sedlák F, Sedlacek J, Spicka I, Grantz Sasková K. Nelfinavir Inhibits the TCF11/Nrf1-Mediated Proteasome Recovery Pathway in Multiple Myeloma. Cancers (Basel). 2020;12: pubmed publisher
Akpinar H, Kahraman H, Yaman I. Ochratoxin A Sequentially Activates Autophagy and the Ubiquitin-Proteasome System. Toxins (Basel). 2019;11: pubmed publisher
Towers C, Fitzwalter B, Regan D, Goodspeed A, Morgan M, Liu C, et al. Cancer Cells Upregulate NRF2 Signaling to Adapt to Autophagy Inhibition. Dev Cell. 2019;50:690-703.e6 pubmed publisher
Besse A, Besse L, Kraus M, Mendez Lopez M, Bader J, Xin B, et al. Proteasome Inhibition in Multiple Myeloma: Head-to-Head Comparison of Currently Available Proteasome Inhibitors. Cell Chem Biol. 2019;26:340-351.e3 pubmed publisher
Lee Y, Huang W, Lin J, Kao T, Lin H, Lee K, et al. Znf179 E3 ligase-mediated TDP-43 polyubiquitination is involved in TDP-43- ubiquitinated inclusions (UBI) (+)-related neurodegenerative pathology. J Biomed Sci. 2018;25:76 pubmed publisher
Fan T, Huang Z, Wang W, Zhang B, Xu Y, Mao Z, et al. Proteasome inhibition promotes autophagy and protects from endoplasmic reticulum stress in rat alveolar macrophages exposed to hypoxia-reoxygenation injury. J Cell Physiol. 2018;233:6748-6758 pubmed publisher
Edens B, Yan J, Miller N, Deng H, Siddique T, Ma Y. A novel ALS-associated variant in UBQLN4 regulates motor axon morphogenesis. elife. 2017;6: pubmed publisher
Hall E, Nahorski M, Murray L, Shaheen R, Perkins E, Dissanayake K, et al. PLAA Mutations Cause a Lethal Infantile Epileptic Encephalopathy by Disrupting Ubiquitin-Mediated Endolysosomal Degradation of Synaptic Proteins. Am J Hum Genet. 2017;100:706-724 pubmed publisher
Cornils A, Maurya A, Tereshko L, Kennedy J, Brear A, Prahlad V, et al. Structural and Functional Recovery of Sensory Cilia in C. elegans IFT Mutants upon Aging. PLoS Genet. 2016;12:e1006325 pubmed publisher
Huang Z, Her L. The Ubiquitin Receptor ADRM1 Modulates HAP40-Induced Proteasome Activity. Mol Neurobiol. 2017;54:7382-7400 pubmed publisher
Bal N, Roshchin M, Salozhin S, Balaban P. Nitric Oxide Upregulates Proteasomal Protein Degradation in Neurons. Cell Mol Neurobiol. 2017;37:763-769 pubmed publisher
Xin B, de Bruin G, Huber E, Besse A, Florea B, Filippov D, et al. Structure-Based Design of ?5c Selective Inhibitors of Human Constitutive Proteasomes. J Med Chem. 2016;59:7177-87 pubmed publisher
Pinto M, Alves P, Martins L, Pedro J, Ryu H, Jeon N, et al. The proteasome controls presynaptic differentiation through modulation of an on-site pool of polyubiquitinated conjugates. J Cell Biol. 2016;212:789-801 pubmed publisher
Shih Y, Hsueh Y. VCP and ATL1 regulate endoplasmic reticulum and protein synthesis for dendritic spine formation. Nat Commun. 2016;7:11020 pubmed publisher
Yamakawa M, Ito D, Honda T, Kubo K, Noda M, Nakajima K, et al. Characterization of the dipeptide repeat protein in the molecular pathogenesis of c9FTD/ALS. Hum Mol Genet. 2015;24:1630-45 pubmed publisher
Jing K, Shin S, Jeong S, Kim S, Song K, Park J, et al. Docosahexaenoic acid induces the degradation of HPV E6/E7 oncoproteins by activating the ubiquitin-proteasome system. Cell Death Dis. 2014;5:e1524 pubmed publisher
Yagi T, Ito D, Suzuki N. Evidence of TRK-Fused Gene (TFG1) function in the ubiquitin-proteasome system. Neurobiol Dis. 2014;66:83-91 pubmed publisher
Qiu M, Chen Y, Chu Y, Song S, Yang N, Gao J, et al. Zinc ionophores pyrithione inhibits herpes simplex virus replication through interfering with proteasome function and NF-?B activation. Antiviral Res. 2013;100:44-53 pubmed publisher
Wu Y, Wang X, Guo H, Zhang B, Zhang X, Shi Z, et al. Synthesis and screening of 3-MA derivatives for autophagy inhibitors. Autophagy. 2013;9:595-603 pubmed publisher
Caldeira M, Curcio M, Leal G, Salazar I, Mele M, Santos A, et al. Excitotoxic stimulation downregulates the ubiquitin-proteasome system through activation of NMDA receptors in cultured hippocampal neurons. Biochim Biophys Acta. 2013;1832:263-74 pubmed publisher
Deng H, Chen W, Hong S, Boycott K, Gorrie G, Siddique N, et al. Mutations in UBQLN2 cause dominant X-linked juvenile and adult-onset ALS and ALS/dementia. Nature. 2011;477:211-5 pubmed publisher
Dantuma N, Lindsten K, Glas R, Jellne M, Masucci M. Short-lived green fluorescent proteins for quantifying ubiquitin/proteasome-dependent proteolysis in living cells. Nat Biotechnol. 2000;18:538-43 pubmed
product information
Catalog Number :
11941
Product Name :
Ub-G76V-GFP
article :
doi10.1038/75406
id699
pubmed_id10802622
bacterial resistance :
Kanamycin
cloning :
backboneEGFP-N1
backbone_mutation
backbone_originClontech
backbone_size3970
promoter
sequencing_primer_3
sequencing_primer_5
vector_types
Mammalian Expression
growth notes :
The ubiquitin open reading frame was amplified by PCR from the Ub-Pro-Gal plasmid with the sense primer 5'-GCG GAATTCACCATGCAGATCTTCGTGAAGACT-3' and the antisense primer 5'-GCGGGATCCTGTCGACCAAGCTTC CCCACCACACCTCTGAGACGGAGTAC-3'. The PCR product was cloned into the EcoRI and BamHI sites of the EGFP-N1 vector from Clontech.
origin :
37
pi :
alt_names
Ubiquitin
Ub
cloning
clone_methodRestriction Enzyme
cloning_site_3NotI
cloning_site_5EcoRI
promoter
sequencing_primer_3
sequencing_primer_5EGFP-N (CGTCGCCGTCCAGCTCGACCAG)
site_3_destroyed
site_5_destroyed
entrez_gene
genbank_ids
mutationUbiquitin fused to N-terminus of GFP. Glycine 76 mutated to Valine.
nameUb-G76V-GFP
shRNA_sequence
size990
species
tags
resistance markers :
102
tags :
High Copy
terms :
Neomycin (select with G418)
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
info@addgene.org
https://www.addgene.org
617.225.9000
headquarters: USA