This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pLD-puro-Cc-CR-PARK7V51G-VA
catalog :
115188
citations: 1
product information
Catalog Number :
115188
Product Name :
pLD-puro-Cc-CR-PARK7V51G-VA
article :
| doi | 10.1016/j.isci.2019.08.057 |
| id | 28203664 |
| pubmed_id | 31536960 |
bacterial resistance :
Ampicillin
cloning :
| backbone | pLD-Cc-puro-VA | |
| backbone_mutation | ||
| backbone_origin | Jason Moffat, Addgene plasmid # 24588 | |
| backbone_size | 7737 | |
| promoter | ||
| sequencing_primer_3 | ||
| sequencing_primer_5 | ||
| vector_types |
|
growth strain :
Lentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)
origin :
30
pi :
|
resistance markers :
| 3055 |
tags :
High Copy
terms :
| Puromycin |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments
