This webpage contains legacy information. The product is either no longer available from the supplier or has been delisted at Labome.
product summary
company name :
Addgene
product type :
cDNA
product name :
pcDNA3 HRPT2 136X
catalog :
11049
citations: 1
Reference |
---|
Rozenblatt Rosen O, Hughes C, Nannepaga S, Shanmugam K, Copeland T, Guszczynski T, et al. The parafibromin tumor suppressor protein is part of a human Paf1 complex. Mol Cell Biol. 2005;25:612-20 pubmed
|
product information
Catalog Number :
11049
Product Name :
pcDNA3 HRPT2 136X
article :
doi | 10.1128/MCB.25.2.612-620.2005 |
id | 445 |
pubmed_id | 15632063 |
bacterial resistance :
Ampicillin
cloning :
backbone | pcDNA3 | |
backbone_mutation | ||
backbone_origin | Invitrogen | |
backbone_size | 5400 | |
promoter | ||
sequencing_primer_3 | ||
sequencing_primer_5 | ||
vector_types |
|
growth notes :
Author has deposited insert sequence. Click on sequence to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGCTATGCTTCTGCTAAAACTTC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed).
origin :
37
pi :
|
resistance markers :
338 |
tags :
High Copy
terms :
Neomycin (select with G418) |
company information
Addgene
490 Arsenal Way, Suite 100
Watertown, MA 02472
Watertown, MA 02472
info@addgene.org
https://www.addgene.org617.225.9000
headquarters: USA
questions and comments